ID: 1006790379

View in Genome Browser
Species Human (GRCh38)
Location 6:36697508-36697530
Sequence ACCTGCTGCTGTCTGGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006790370_1006790379 23 Left 1006790370 6:36697462-36697484 CCGGGGCATCCCATACACTTAGC No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790371_1006790379 14 Left 1006790371 6:36697471-36697493 CCCATACACTTAGCTTCAGCCAC No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790372_1006790379 13 Left 1006790372 6:36697472-36697494 CCATACACTTAGCTTCAGCCACG No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790374_1006790379 -5 Left 1006790374 6:36697490-36697512 CCACGGCTGTGCCCATCAACCTG No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790369_1006790379 24 Left 1006790369 6:36697461-36697483 CCCGGGGCATCCCATACACTTAG No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006790379 Original CRISPR ACCTGCTGCTGTCTGGGATA AGG Intergenic