ID: 1006790381

View in Genome Browser
Species Human (GRCh38)
Location 6:36697519-36697541
Sequence TCTGGGATAAGGCATTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006790372_1006790381 24 Left 1006790372 6:36697472-36697494 CCATACACTTAGCTTCAGCCACG No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data
1006790377_1006790381 -6 Left 1006790377 6:36697502-36697524 CCATCAACCTGCTGCTGTCTGGG No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data
1006790371_1006790381 25 Left 1006790371 6:36697471-36697493 CCCATACACTTAGCTTCAGCCAC No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data
1006790375_1006790381 -5 Left 1006790375 6:36697501-36697523 CCCATCAACCTGCTGCTGTCTGG No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data
1006790374_1006790381 6 Left 1006790374 6:36697490-36697512 CCACGGCTGTGCCCATCAACCTG No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006790381 Original CRISPR TCTGGGATAAGGCATTGCCT TGG Intergenic