ID: 1006791443

View in Genome Browser
Species Human (GRCh38)
Location 6:36703850-36703872
Sequence GACCTGGAGGGTGGTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 6, 3: 50, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006791443_1006791450 28 Left 1006791443 6:36703850-36703872 CCTGTGTAACCACCCTCCAGGTC 0: 1
1: 1
2: 6
3: 50
4: 350
Right 1006791450 6:36703901-36703923 GAATAGGATATATTCTCTAATGG 0: 1
1: 0
2: 2
3: 19
4: 202
1006791443_1006791448 4 Left 1006791443 6:36703850-36703872 CCTGTGTAACCACCCTCCAGGTC 0: 1
1: 1
2: 6
3: 50
4: 350
Right 1006791448 6:36703877-36703899 CACGAGATAGATTCTGCGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 32
1006791443_1006791449 12 Left 1006791443 6:36703850-36703872 CCTGTGTAACCACCCTCCAGGTC 0: 1
1: 1
2: 6
3: 50
4: 350
Right 1006791449 6:36703885-36703907 AGATTCTGCGTGCGGTGAATAGG 0: 1
1: 0
2: 0
3: 1
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006791443 Original CRISPR GACCTGGAGGGTGGTTACAC AGG (reversed) Intronic
900400919 1:2472568-2472590 GCCCTGGAGGGTGGGTAGGCTGG + Intronic
900401967 1:2476341-2476363 GCCCTGGAGGGTGGATAGGCTGG + Exonic
900486487 1:2925137-2925159 GCCCAGGAAGGTGGGTACACAGG + Intergenic
900581971 1:3413918-3413940 GCCCTGGAGGGTGTTTAGACAGG + Intronic
902170232 1:14604366-14604388 GAACTGGAGAGTGGTGACAGGGG - Intronic
902654654 1:17859165-17859187 GACCTGGAGGGGGCTACCACTGG - Intergenic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
905204592 1:36336055-36336077 GGCCTGGAGGGTTGATACAGTGG - Intergenic
905334105 1:37232251-37232273 GCCCTGGAGGCTGGATGCACAGG + Intergenic
905424173 1:37869765-37869787 GACCTGGAGGCTGGGTGCAGTGG - Intronic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
906149027 1:43577153-43577175 GACCTGGTGGCTGGTGCCACAGG - Intronic
906249288 1:44299083-44299105 GACCTGGGTGGTAGTTACCCAGG + Intronic
906454147 1:45979189-45979211 AACCTAGATGGTGTTTACACAGG + Intronic
908188417 1:61675344-61675366 GAACTGGATGGTGGTTAAATGGG + Intergenic
908218330 1:61977995-61978017 TACCTGGATGGTGGTTACATGGG - Intronic
908400478 1:63768461-63768483 GACGTGCAGGGTTGTTACATAGG + Intergenic
908412847 1:63884213-63884235 CACGTGGAGGGTGGTGCCACTGG + Intronic
911104190 1:94117314-94117336 GACCCGGAGCCTGGGTACACTGG + Intronic
911368289 1:96966868-96966890 GACGTGCAGGTTTGTTACACAGG + Intergenic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
912304166 1:108547958-108547980 AACCTGCAGGTTTGTTACACAGG - Intergenic
914969465 1:152294049-152294071 AACCTGCAGGTTTGTTACACAGG - Intergenic
915420627 1:155778590-155778612 GACATGGAGGTTTGTTACACAGG + Intronic
916172865 1:162014142-162014164 GAGCTGGTTGGTGGTTACACAGG + Intronic
916866039 1:168859904-168859926 GACCTGCAGGTTTGTTACATAGG - Intergenic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
918744634 1:188183943-188183965 GACCTGGGGGCTGGTCACAGTGG + Intergenic
918839751 1:189518999-189519021 GACCTGCAGGTTTGTTACATAGG - Intergenic
918921100 1:190711543-190711565 GACATGCAGGTTTGTTACACAGG + Intergenic
919154289 1:193742218-193742240 AACGTGGAGGTTTGTTACACAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920904797 1:210152633-210152655 GACCTGGATGGTAATTACATGGG - Intronic
921533554 1:216315517-216315539 GACAGGGATGGTGATTACACAGG + Intronic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922439289 1:225639247-225639269 GACCTGGTTGGTGGCTACACAGG + Intronic
922796047 1:228340417-228340439 GAGCTGGAGGGTGGGTCCCCAGG - Intronic
924520377 1:244801113-244801135 GACCTGGATGGTAGTTACAAGGG + Intergenic
924625294 1:245692438-245692460 GTCCGGGAGGGTGCTTACATCGG + Intronic
924817632 1:247456656-247456678 AACGTGGAGGTTTGTTACACAGG + Intergenic
924876698 1:248112737-248112759 GAACTGGCAAGTGGTTACACAGG - Intergenic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1064430048 10:15262944-15262966 GCCCTGGTGGCTGGTTTCACAGG - Intronic
1064629728 10:17297340-17297362 GACCTGGCGGGTGGCTAAGCAGG + Intergenic
1065240119 10:23695710-23695732 GGGCTGGAGGGTGGGGACACTGG + Intronic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1065709245 10:28499492-28499514 CACCTGGAGGGTGGCCACAGTGG - Intergenic
1069015200 10:63421496-63421518 GACCTGGGGGATAGTTACACAGG + Intronic
1069435927 10:68382804-68382826 GACCTGGGTGGAGGTTACGCAGG + Intronic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1070725937 10:78790522-78790544 GACGTGCAGGTTTGTTACACAGG - Intergenic
1070898307 10:80005014-80005036 GACCTGCAGGTTTGTTACATAGG - Intergenic
1070979911 10:80635844-80635866 AACCTGCAGGTTTGTTACACAGG + Intronic
1072270877 10:93775155-93775177 GACCTGGGTGCTGGTTACAAGGG - Intronic
1073368217 10:102962278-102962300 GATGTGCAGGTTGGTTACACAGG - Intronic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1075820698 10:125306440-125306462 GACCTGGGAGGTGGTTACAAGGG - Intergenic
1076314987 10:129533657-129533679 GGCCTGGATGGTGGTCACACTGG + Intronic
1076437838 10:130458905-130458927 GACTGGGAGGATGGTTTCACAGG + Intergenic
1076611612 10:131729469-131729491 GAGCTGGAGGATGGTGACAGCGG - Intergenic
1078126196 11:8565905-8565927 GACAGGGAGGGAAGTTACACAGG - Intronic
1078374116 11:10778548-10778570 GACCTAAATAGTGGTTACACAGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1082607883 11:55264392-55264414 GACATGCAGGCTTGTTACACAGG + Intronic
1083481243 11:62949053-62949075 GCCCTGGAGGGGTGTCACACAGG + Intronic
1083525020 11:63355097-63355119 GACGTGCAGGTTTGTTACACAGG + Intronic
1085174525 11:74474424-74474446 CACCTGGATGGTGCTGACACAGG + Intergenic
1085230002 11:74958871-74958893 GATCTGGAGGGGAGTAACACTGG - Intronic
1085243739 11:75080323-75080345 GACGTGGAGGTTTGTTACATAGG + Intergenic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1085907025 11:80775775-80775797 GAGCTGGATGGTGGTTACCAAGG + Intergenic
1086695822 11:89844265-89844287 GACATGCAGGCTTGTTACACAGG + Intergenic
1086702734 11:89918194-89918216 GACGTGCAGGCTTGTTACACAGG - Intronic
1086703433 11:89926256-89926278 GACGTGCAGGCTTGTTACACAGG + Intergenic
1086710332 11:90000218-90000240 GACATGCAGGCTTGTTACACAGG - Intergenic
1087086451 11:94223651-94223673 AATCTGGGGGGTGGTTACATAGG - Intergenic
1087237090 11:95732169-95732191 GAAATGGATGGTGGTTACATGGG - Intergenic
1087489021 11:98799754-98799776 AAGCTAGAGGGTGGTTACATGGG - Intergenic
1087764399 11:102134585-102134607 AACCTGGAGAGTGGTTAACCTGG - Intronic
1092237913 12:6821561-6821583 GAACTGGACGGTGGTGACTCGGG - Exonic
1095215433 12:39542058-39542080 AACCTGGGTGGTGGTTAAACAGG + Intergenic
1095393186 12:41733346-41733368 AACGTGCAGGTTGGTTACACAGG + Intergenic
1097852497 12:64426650-64426672 CACATGGAGGTTTGTTACACGGG - Intronic
1098201277 12:68058552-68058574 GACATGGAGGTTTGTTACATAGG + Intergenic
1098780910 12:74685486-74685508 GAGCAGGAAGGGGGTTACACTGG + Intergenic
1099827196 12:87791932-87791954 GACCTGGTGGGAGGGTACCCAGG - Intergenic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1100741109 12:97594656-97594678 GAGCTGGAAGGTGATTGCACTGG - Intergenic
1101186414 12:102285409-102285431 GACGTGCAGGTTTGTTACACAGG + Intergenic
1101610590 12:106287786-106287808 GGGCTGGGGGGTGGTTACAGAGG + Intronic
1101834339 12:108284818-108284840 GACCTAGATAGTGGTTACACGGG - Intergenic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1101981655 12:109412627-109412649 GATCCGCATGGTGGTTACACAGG - Intronic
1102392519 12:112560792-112560814 GACCTGAATGCTGGTTACATTGG - Intergenic
1102808877 12:115806712-115806734 GACCTAAATTGTGGTTACACAGG - Intergenic
1102942380 12:116954875-116954897 CAGCTGGAGGGAGGTTAGACGGG - Intronic
1103142695 12:118563641-118563663 AATCTGGAGGGTGATTACACAGG - Intergenic
1103317683 12:120069770-120069792 GATCTCCATGGTGGTTACACAGG - Intronic
1104170478 12:126275643-126275665 GAGGTGGAGGGTGGTGAGACAGG + Intergenic
1104584662 12:130038319-130038341 GATCTGGAGGGAGGAGACACGGG - Intergenic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1106803363 13:33280057-33280079 AACCTGGAGGGTGAATGCACTGG - Intronic
1107463561 13:40628703-40628725 GACCTGGTGGGAGGTAACAATGG + Intronic
1107522753 13:41199715-41199737 GACCGGGCTGGTGGTTACATGGG + Intergenic
1107523084 13:41202492-41202514 GACCTGAGTGGAGGTTACACAGG - Intergenic
1108077067 13:46692259-46692281 GAACTGGAAGCTGGTTATACGGG - Intronic
1110715231 13:78695118-78695140 TACCGGGATAGTGGTTACACAGG - Intergenic
1111699871 13:91673154-91673176 AACCTGCAGGTTTGTTACACAGG - Intronic
1112716673 13:102194312-102194334 GACGTGCAGGTTTGTTACACAGG + Intronic
1113214549 13:108023857-108023879 GACATGCAGGTTTGTTACACAGG + Intergenic
1113841006 13:113361564-113361586 GACCTGGAGGTTGGTTACAGCGG - Intronic
1114420552 14:22578731-22578753 GATCTGGATAGTGGTTAGACAGG + Intronic
1115167146 14:30461771-30461793 GACCTGGAGGGTGGTGGGGCAGG + Intergenic
1115318472 14:32052028-32052050 GACATGCAGGTTTGTTACACAGG + Intergenic
1115882472 14:37935210-37935232 GACATGCAGGTTTGTTACACAGG + Intronic
1118929223 14:70224611-70224633 GACCTGGGTGGTGGTTACGCAGG + Intergenic
1121088652 14:91166173-91166195 GATCTGGATGCTGGTTACATGGG + Intronic
1121238298 14:92409563-92409585 GACCTGGATGCTGGTGACATGGG - Intronic
1121334496 14:93069199-93069221 TACATGGAGGGTGATTAGACAGG - Intronic
1122973752 14:105162765-105162787 GCCCTGGACTGTGGGTACACTGG - Intronic
1124419822 15:29511136-29511158 GACCTGCAGGTTTGTTACATAGG - Intronic
1124961607 15:34401165-34401187 GACCAGGTTGGTGGTTACATGGG - Intronic
1124978233 15:34547387-34547409 GACCAGGTTGGTGGTTACATGGG - Intronic
1125127619 15:36242590-36242612 GACGTGCAGGTTTGTTACACAGG + Intergenic
1125935189 15:43628890-43628912 GATCTGCATGGTGGTTACACCGG - Intronic
1125947947 15:43725202-43725224 GATCTGCATGGTGGTTACACCGG - Intergenic
1126700282 15:51360616-51360638 GACCTGGAGGATAGTTATCCGGG - Intronic
1127798880 15:62460812-62460834 GAGCTGGATGCAGGTTACACAGG - Intronic
1127937539 15:63656643-63656665 GATCTGGAGGGCGGTGACATGGG - Intronic
1129222823 15:74142904-74142926 GATCTGGATGGTGGCTACATGGG + Intergenic
1129679605 15:77650766-77650788 GTCCTGCAGGGTGGTCACAGAGG + Intronic
1129828959 15:78654798-78654820 GAGCTGGATGCTGGTTACACAGG - Intronic
1130266454 15:82409067-82409089 GACCAGGTTGGTGGTTACATGGG + Intergenic
1130505570 15:84537815-84537837 GACCAGGTTGGTGGTTACATGGG - Intergenic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1131271760 15:90951707-90951729 GACGTGCAGGTTTGTTACACAGG - Intronic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1133160075 16:3905401-3905423 GACGTGCAGGTTTGTTACACAGG + Intergenic
1133463107 16:6004143-6004165 GACGTGCAGGTTTGTTACACAGG - Intergenic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1134117126 16:11557353-11557375 CACCTGGGGGCTGGTTACAGAGG + Intronic
1134147384 16:11777107-11777129 GACCTGGATGGTGTGTACATGGG - Intronic
1135665719 16:24334237-24334259 GGCCTGGAATGTGGTTGCACTGG + Intronic
1141558571 16:84852294-84852316 CATCTGGATGGTAGTTACACGGG - Intronic
1142114644 16:88350315-88350337 GACCTGGATGGTGCCCACACAGG + Intergenic
1142276365 16:89120962-89120984 GCCCCCCAGGGTGGTTACACTGG + Intronic
1143844220 17:9760583-9760605 GATCTGCATGGTGGTTACATGGG + Intergenic
1145243775 17:21254340-21254362 GATTTGGATGGTGGTCACACGGG - Intergenic
1145958984 17:28874926-28874948 GACCTGGATGGTGATTACATGGG - Intergenic
1146110791 17:30087329-30087351 GACGTGCAGGTTTGTTACACAGG + Intronic
1146234674 17:31147161-31147183 GATCTGGATACTGGTTACACTGG - Intronic
1147560585 17:41506560-41506582 GTCCTGGGTGGTGTTTACACAGG - Intergenic
1149026574 17:52034546-52034568 GAGCTGGGGGATGGTTACATAGG + Intronic
1150076621 17:62197822-62197844 GACCTGCAGGGTCCTTACCCAGG - Intergenic
1150299107 17:64033761-64033783 GATCTGGGAGGTGGTTATACTGG + Intergenic
1151562516 17:74878210-74878232 GACCTGGAGAGTGGAGGCACCGG - Exonic
1151581796 17:74983474-74983496 GAGCTGGGTGCTGGTTACACAGG - Intergenic
1152469508 17:80482986-80483008 GACCTGGAGGGTGATGTCACAGG + Intergenic
1155027516 18:21955856-21955878 GACGTGCAGGTTTGTTACACAGG - Intergenic
1155879203 18:31123029-31123051 GACCTGGGGCAGGGTTACACTGG + Intergenic
1157251398 18:46099049-46099071 GACGTGCAGGTTTGTTACACAGG - Intronic
1157865238 18:51177338-51177360 GACTTGGACGGTGGTTTGACCGG + Exonic
1158305573 18:56101604-56101626 AACCTGTAAAGTGGTTACACAGG - Intergenic
1159190304 18:65033020-65033042 GACATGCAGGTTTGTTACACAGG + Intergenic
1159531122 18:69656926-69656948 TACCTGGAGGGTTGTTAGAGTGG - Intronic
1159908011 18:74115995-74116017 GACCTGGATGGTGATCACACAGG + Intronic
1160672464 19:372733-372755 GAACTGCAGGGTGTTGACACTGG - Intronic
1163650631 19:18515754-18515776 GACCTGAAGGGGAGTCACACTGG - Intronic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1164617428 19:29675302-29675324 CACCTGGAGAGAGGTGACACAGG - Exonic
1165988970 19:39795073-39795095 GACCTGGAGGGTGACTTCAGTGG + Intergenic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1167731640 19:51261935-51261957 GACCTCAGTGGTGGTTACACTGG - Intronic
1167837624 19:52087246-52087268 GACGTGCAGGCTGGTTACATAGG + Intronic
1168178117 19:54640300-54640322 GATCTGCAGGTTTGTTACACAGG + Intronic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG + Intergenic
925171878 2:1755044-1755066 GACCTGGAGGCTGGGGACCCAGG - Intergenic
926054717 2:9767883-9767905 GACCTGGAGGGTCCACACACCGG - Intergenic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
927183378 2:20464717-20464739 GATCTGCAGGTTTGTTACACAGG - Intergenic
927466132 2:23338075-23338097 GAGCAGAAGGGTGGTTACAGCGG + Intergenic
927612511 2:24556034-24556056 GATCTGCAGGTTTGTTACACAGG + Intronic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928145710 2:28773107-28773129 GATCTGGATGATGGTTACTCAGG + Intronic
930414177 2:51068877-51068899 TATCTGGTTGGTGGTTACACAGG - Intergenic
931468542 2:62514238-62514260 GATCTGGTTGCTGGTTACACAGG - Intergenic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
931805223 2:65797544-65797566 GACGTGCAGGTTTGTTACACAGG - Intergenic
932313198 2:70760699-70760721 GACCTGCATGGTGGTCACACGGG + Intronic
933400662 2:81793072-81793094 GACGTGCAGGTTTGTTACACAGG + Intergenic
933568879 2:83983810-83983832 GACCTGAGTGGTGATTACACAGG - Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
936035190 2:109105492-109105514 TACCTGGAAGGTGGTCAAACAGG - Intergenic
936645286 2:114362128-114362150 GGTCTGGGCGGTGGTTACACAGG + Intergenic
937881009 2:126864774-126864796 AAGCTGCAGGGTGGATACACAGG + Intergenic
938588692 2:132716570-132716592 GAACTTGAGGGGGGTAACACTGG + Intronic
940456180 2:153903838-153903860 GACCTGTGGGATGGTTACATGGG - Intronic
941134035 2:161690897-161690919 GACATGCAGGTTTGTTACACAGG - Intronic
941501921 2:166289944-166289966 AACATGCAGGTTGGTTACACAGG + Intronic
942312569 2:174669009-174669031 GCCTTAGAGGGTGGTTACATGGG + Intronic
942600194 2:177633151-177633173 CACCTGCAAGGTGTTTACACGGG - Intronic
942972902 2:181978634-181978656 GGACTGGAGGGGTGTTACACAGG + Intronic
943084313 2:183294453-183294475 GACATGCAGGTTGGTTACATAGG + Intergenic
944378535 2:199077635-199077657 AACCTGGAGGTTTGTTACATGGG - Intergenic
944655101 2:201869474-201869496 AACCTGCAGGTTTGTTACACAGG - Intronic
945144204 2:206719484-206719506 GACGTGCAGGTTTGTTACACAGG - Intergenic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
947471813 2:230407949-230407971 GACGTGCAGGTTTGTTACACAGG - Intergenic
948309626 2:236975302-236975324 AACCTGCTGGGTGGTTACAAAGG + Intergenic
948861442 2:240754599-240754621 GCCCTGGAGGGTGTCTCCACTGG - Intronic
1169407459 20:5334445-5334467 GACATGCAGGTTTGTTACACAGG + Intergenic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172848190 20:37942704-37942726 GCTCTGGATGGTGGTTACACAGG + Intronic
1173758758 20:45541343-45541365 GACCTGCAGGTTTGTTACATAGG - Exonic
1173839480 20:46148015-46148037 GACATGGATGGTGGTCACACAGG - Intergenic
1174771860 20:53307712-53307734 GATCTGGCGGGTGGTTAAATGGG - Intronic
1175134613 20:56813691-56813713 GACGTGCAGGTTGGTTACATAGG + Intergenic
1175349921 20:58310131-58310153 GAGCTGGAGGGAGGGTCCACGGG - Intronic
1175517114 20:59576921-59576943 GAGCTGGTTGGTGGTTACAAAGG + Intergenic
1175675103 20:60939591-60939613 GACCTGCAGGGTTGTTTCGCTGG - Intergenic
1176905449 21:14494652-14494674 AACATGGAGGTTTGTTACACAGG - Intronic
1176916788 21:14635293-14635315 GACATGCAGGGTTGTTACATAGG - Intronic
1176987093 21:15449869-15449891 GACCTGCAGGTTTGTTACATAGG + Intergenic
1178286350 21:31328588-31328610 AACGTGCAGGTTGGTTACACAGG + Intronic
1178685376 21:34706517-34706539 GATCTGCACGGTGGCTACACGGG - Intronic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1179635958 21:42709409-42709431 GACATGCAGGGATGTTACACAGG - Intronic
1180833188 22:18916723-18916745 GAGCTGGAGGGTGGCTTCAGTGG - Intronic
1181066636 22:20309533-20309555 GAGCTGGAGGGTGGCTTCAGTGG + Intergenic
1183169667 22:36177966-36177988 GATCTGGAGGGCGTTTTCACTGG - Intergenic
1183220088 22:36506751-36506773 AACCTGGAGGGTGGTTCAAAGGG - Intronic
1184558000 22:45243595-45243617 GATCTGGGGGCTGGTTACACGGG + Intergenic
1203283273 22_KI270734v1_random:142027-142049 GAGCTGGAGGGTGGCTTCAGTGG - Intergenic
949550019 3:5104878-5104900 GACCTGGAGGCTGGGCACAGTGG - Intergenic
949574610 3:5326728-5326750 GACGTGCAGGTTTGTTACACAGG - Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
952219209 3:31307466-31307488 GCCCTGGAGCGTGGTTAGAAAGG + Intergenic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
952329676 3:32352749-32352771 GATTTGGATGCTGGTTACACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952785136 3:37146342-37146364 GACCTGCAGGTTTGTTACATAGG + Intronic
952800265 3:37284229-37284251 GATGTGCAGGGTTGTTACACTGG + Intronic
953386384 3:42508542-42508564 GACCTGGGCAGTGGTGACACAGG - Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
954853003 3:53619049-53619071 TGCATGGAGGGAGGTTACACTGG - Intronic
955226345 3:57063465-57063487 GACCTGGAGGGTGGTAGGAGCGG + Intronic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
958677369 3:97282943-97282965 GACATGGAGGTTTGTTACACAGG - Intronic
959882996 3:111467953-111467975 GATGTGCAGGGTTGTTACACAGG + Intronic
960961854 3:123076545-123076567 GACCTGAAGGGTGGAAACAGTGG + Intronic
961666011 3:128493378-128493400 GGCCTGGAGTGTGGATGCACAGG - Intergenic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
966450548 3:180055462-180055484 GAGCTGGACGCTGGTTACACAGG + Intergenic
967672301 3:192251895-192251917 TATCTGGATAGTGGTTACACAGG + Intronic
968854882 4:3112353-3112375 GACCTGGGTGGCGGTTACAAGGG - Intronic
969594298 4:8140208-8140230 GACATGCAGGTTTGTTACACAGG - Intronic
969964892 4:10984044-10984066 AGCCTGGAGGGTGGTTTCGCAGG - Intergenic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
972249889 4:37288227-37288249 AACGTGGAGGGTTGTTACATAGG - Intronic
972578478 4:40373789-40373811 GACCCGGATGGTGGTTACGTAGG + Intergenic
976603959 4:86965033-86965055 GATGTGGAGGGTGGTTATAATGG + Intronic
977191648 4:94008362-94008384 GACATGCAGGTTTGTTACACAGG - Intergenic
977734954 4:100403110-100403132 CATCTGGAGGTTGGTTACATGGG + Intronic
979732287 4:124039677-124039699 GACATGCAGGCTTGTTACACAGG + Intergenic
980903243 4:138924833-138924855 GAAATGGAGGGCGCTTACACTGG + Intergenic
981807422 4:148732829-148732851 GACCTGGGTGTTGGTTACACAGG - Intergenic
981933352 4:150213354-150213376 CACCCAGAGGGTGGTAACACAGG - Intronic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
983403387 4:167294374-167294396 GGCCTGCAGGGTGGAGACACAGG - Intergenic
984428311 4:179615950-179615972 GAACTGGAGGATGGATATACAGG + Intergenic
984479977 4:180287694-180287716 GACGTGCAGGCTTGTTACACAGG - Intergenic
984818778 4:183861892-183861914 CACCTGGATGGTGGTTACGTGGG - Intronic
985470094 5:35974-35996 AACCTGCAGGCTTGTTACACAGG - Intergenic
987206976 5:15638082-15638104 CACCTGGGGGGTGGTGACATTGG - Intronic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
988352550 5:30130435-30130457 GACTTGCAGGTTTGTTACACAGG + Intergenic
990996554 5:61737673-61737695 GACCTGGAGAGGGGTGGCACTGG + Intronic
992067247 5:73119998-73120020 GACCTGGAGTGGGGTTACAGAGG - Intergenic
993542162 5:89165151-89165173 AACCTGCAGGTTTGTTACACAGG - Intergenic
995460618 5:112399373-112399395 AACCTGGATGGTGATTACACAGG - Intronic
997138674 5:131354310-131354332 GACCTGGGTGGTAGCTACACAGG - Intronic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
998732494 5:145096429-145096451 AACGTGCAGGGTTGTTACACAGG + Intergenic
999949567 5:156634369-156634391 GATGTGCAGGTTGGTTACACAGG - Intronic
1000716069 5:164645731-164645753 GACATGCAGGTTTGTTACACAGG - Intergenic
1000721796 5:164717403-164717425 GATCTGGATGCTAGTTACACTGG - Intergenic
1001392260 5:171388390-171388412 GTCCTGGAGGCTGGGTTCACCGG + Intronic
1001661007 5:173393366-173393388 GACCTGGAGGATTGTAAAACAGG - Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1003629208 6:7771674-7771696 GGCATGGAGGGGTGTTACACAGG + Intronic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1005785284 6:29239027-29239049 GACGTGGAGGTTTGTTACATAGG + Intergenic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1006947189 6:37792524-37792546 GATGTGGAGGGCGGTTACACAGG - Intergenic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1008778901 6:55077426-55077448 GATCTGCAGGTTTGTTACACAGG - Intergenic
1009950518 6:70390081-70390103 GACTTGGATGGTGGTTAAATGGG + Intergenic
1010082901 6:71885356-71885378 GATGTGGAGGGTTGTTACATAGG - Intergenic
1010780244 6:79937439-79937461 GAGCTGAAGGCTGGTTACCCTGG + Intronic
1011926899 6:92656470-92656492 GGCCTGGATGGTGTTTACATGGG + Intergenic
1012202684 6:96425272-96425294 GACCTGGTGGGAGGTTCCAGGGG - Intergenic
1012349571 6:98233783-98233805 AACCTGCAGGTTTGTTACACAGG + Intergenic
1012384495 6:98663432-98663454 AACCTGCAGGTTTGTTACACAGG + Intergenic
1013313531 6:108919970-108919992 GAGCTGGATGATGGGTACACAGG - Intronic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1013601898 6:111712798-111712820 GACCTGGCTGGTGGCCACACAGG + Intronic
1014580022 6:123125870-123125892 GACATGCAGGTTTGTTACACAGG + Intergenic
1015807511 6:137126347-137126369 GATCTGGGCAGTGGTTACACAGG + Intergenic
1015850397 6:137565994-137566016 GACATGCAGGTTTGTTACACAGG + Intergenic
1016306517 6:142690252-142690274 GACCTGCAGGTTTGTTACATAGG + Intergenic
1016755730 6:147684043-147684065 GATCTGGATGGTGGTGACATGGG - Intronic
1017927231 6:158921174-158921196 GACCTGGAGTGGGGGCACACAGG - Intergenic
1018158216 6:161009973-161009995 GACGTGCAGGTTTGTTACACAGG - Intronic
1018578793 6:165288891-165288913 GATGTGGAGGTTTGTTACACAGG - Intronic
1019496302 7:1342078-1342100 GCCCTGGAGGCTGGGTGCACCGG - Intergenic
1019570002 7:1706726-1706748 GGCCTGGAGGGTGGTCTCTCTGG - Intronic
1020419506 7:7985491-7985513 GACGTGCAGGTTTGTTACACAGG - Intronic
1020811983 7:12859052-12859074 GATCTGTATGGTGGTTACATAGG - Intergenic
1021826275 7:24555397-24555419 CACCTTGCTGGTGGTTACACAGG + Intergenic
1021843836 7:24745157-24745179 CACCTGGATAGTGGTTAAACAGG - Intronic
1021866089 7:24959589-24959611 GTTCTGGACGCTGGTTACACAGG + Intronic
1022129072 7:27387206-27387228 GCCCTGGCGGGTGGAGACACTGG + Intergenic
1022948316 7:35310410-35310432 GACCTGGGAGATGGTTACACTGG + Intergenic
1023956266 7:44889332-44889354 GATCTGGAAGGTAGTTAGACTGG + Intergenic
1024272840 7:47655436-47655458 GACCTGGGAAGTGGTTACATGGG + Intronic
1024933508 7:54689235-54689257 GACCTGCAGGTTTGTTACATAGG - Intergenic
1026176211 7:67999730-67999752 GACCTAAATGGTGATTACACTGG - Intergenic
1026394017 7:69933039-69933061 GATCTGCACGTTGGTTACACTGG + Intronic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1026814818 7:73502409-73502431 AACCTGTATGGTGGGTACACAGG - Intronic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1030733176 7:113014132-113014154 GACCTGGAGCTTGGGTCCACAGG + Intergenic
1030793048 7:113752990-113753012 GACATGCAGGTTTGTTACACAGG + Intergenic
1031509284 7:122628348-122628370 GATCTGGGAGGTGGCTACACAGG + Intronic
1031570207 7:123349780-123349802 GAACTGCAGGTTTGTTACACAGG - Intergenic
1032333064 7:130998395-130998417 GACATGCAGGTTGGTTACACAGG + Intergenic
1032597849 7:133259923-133259945 CAGCTGGACAGTGGTTACACAGG - Intronic
1032671268 7:134084622-134084644 GGCCTGGCAGGTGGTTACAAAGG + Intergenic
1033803430 7:144927426-144927448 GATCTGGATAGTGGTTACATGGG - Intergenic
1034400976 7:150861201-150861223 GAACTGGGGGCTGGTCACACAGG - Exonic
1035283835 7:157793992-157794014 GGCCTGGAGGGTGGGGACCCGGG - Intronic
1038457741 8:27688866-27688888 GACCTGGGTGAAGGTTACACAGG + Intergenic
1038606014 8:29005645-29005667 GATCTGGAGGGTGGTTATATGGG - Intronic
1042321005 8:67475567-67475589 GACCTGGAGGCTTGTTTCAATGG + Intronic
1042503298 8:69533282-69533304 GACGTGCAGGTTTGTTACACAGG + Intronic
1042682491 8:71401241-71401263 GACATGCAGGTTTGTTACACAGG - Intergenic
1044367878 8:91371317-91371339 GACGTGCAGGATGATTACACTGG + Intronic
1044394358 8:91692686-91692708 GACATGGAGGTTTGTTACATAGG + Intergenic
1047332561 8:123905122-123905144 GACGTGCAGGTTTGTTACACAGG + Intronic
1049688984 8:143950563-143950585 GACCTGCAGGTTGGTGACGCCGG + Exonic
1050470653 9:5986007-5986029 GACATGCAGGTTTGTTACACAGG + Intronic
1050656181 9:7831248-7831270 GAAATGGATGGTGGTTACACAGG - Intronic
1051481814 9:17569875-17569897 AACCTGCAGGCTTGTTACACAGG + Intergenic
1052082415 9:24223513-24223535 CACCTGTGTGGTGGTTACACAGG + Intergenic
1052471306 9:28899972-28899994 GACCTGGAACCTGATTACACAGG - Intergenic
1053344532 9:37368703-37368725 GACATGGTAGGTGGTTACATCGG + Intergenic
1053509406 9:38674848-38674870 GACCTAGGTGATGGTTACACAGG + Intergenic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1055028046 9:71743330-71743352 GACCTGGGTGGTGGCTACACAGG + Intronic
1056057579 9:82843343-82843365 GACGTGCAGGTTTGTTACACAGG - Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1057936682 9:99245762-99245784 GGCCTGAGTGGTGGTTACACAGG - Intergenic
1059022663 9:110593558-110593580 GATGTGGAGGTTTGTTACACAGG + Intergenic
1059961592 9:119570236-119570258 GACATGCAGGTTGGTTACATAGG - Intergenic
1060315888 9:122510101-122510123 GACGTGCAGGTTTGTTACACAGG - Intergenic
1060451026 9:123740128-123740150 GACATGCAGGGTTGTTACATAGG - Intronic
1060885533 9:127149580-127149602 GTCCTGGAGGGTAGGCACACAGG - Intronic
1186521470 X:10210382-10210404 GTCCTGGGTGCTGGTTACACAGG - Intronic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1188224439 X:27579514-27579536 GACATGCAGGTTTGTTACACAGG - Intergenic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189327151 X:40119729-40119751 GATCTGGAAGCTGGTTACATGGG + Intronic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1192506762 X:71690451-71690473 GATCTGGATGGCGGTTACATGGG + Intergenic
1192513176 X:71738589-71738611 GATCTGGATGGCGGTTACATGGG - Intergenic
1192513521 X:71742924-71742946 GATCTGGATGGCGGTTACATGGG + Intergenic
1192519935 X:71791095-71791117 GATCTGGATGGCGGTTACATGGG - Intergenic
1192566107 X:72164837-72164859 GACCTGCATGGTAGTCACACTGG + Intergenic
1192850498 X:74950980-74951002 GACATGCAGGTTTGTTACACAGG + Intergenic
1193329670 X:80222310-80222332 GACATGCAGGTTTGTTACACAGG - Intergenic
1193426998 X:81351124-81351146 GACATGCAGGTTTGTTACACAGG - Intergenic
1193668912 X:84359225-84359247 GACCTGCAGGTTTGTTACAAAGG + Intronic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195362789 X:104101216-104101238 TTCCTGGAGGGTGGTGACCCAGG - Exonic
1195564281 X:106323513-106323535 GACCTGGAGGCTGGGTCCATAGG - Intergenic
1196746174 X:119073313-119073335 GACCGGGAGGGCGGTGACTCTGG + Intergenic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198805579 X:140491074-140491096 GACCTGGAGCGAGGTGACCCTGG + Intergenic
1198814217 X:140570166-140570188 GCCCTGGGTGTTGGTTACACAGG + Intergenic
1199758299 X:150885226-150885248 GACCTGGTCGGTGGTGACACAGG + Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1200839411 Y:7765253-7765275 CACCTGCAGGTTTGTTACACAGG - Intergenic
1201752310 Y:17446433-17446455 GACCTGCAGGTTTGTTACAGAGG + Intergenic
1201987011 Y:19979719-19979741 GAAATGGAGGGTGGTTGCAAGGG + Intergenic