ID: 1006791497

View in Genome Browser
Species Human (GRCh38)
Location 6:36704134-36704156
Sequence CCAAGGGTGATGGGAGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 373}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006791487_1006791497 8 Left 1006791487 6:36704103-36704125 CCGGGCTTTGGCAGCCACAGTGG 0: 1
1: 0
2: 2
3: 29
4: 280
Right 1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG 0: 1
1: 0
2: 4
3: 48
4: 373
1006791482_1006791497 27 Left 1006791482 6:36704084-36704106 CCGGCGGGACACCATCAGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG 0: 1
1: 0
2: 4
3: 48
4: 373
1006791481_1006791497 28 Left 1006791481 6:36704083-36704105 CCCGGCGGGACACCATCAGGCCG 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG 0: 1
1: 0
2: 4
3: 48
4: 373
1006791489_1006791497 -6 Left 1006791489 6:36704117-36704139 CCACAGTGGATTTTCTTCCAAGG 0: 1
1: 0
2: 3
3: 24
4: 192
Right 1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG 0: 1
1: 0
2: 4
3: 48
4: 373
1006791486_1006791497 16 Left 1006791486 6:36704095-36704117 CCATCAGGCCGGGCTTTGGCAGC 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG 0: 1
1: 0
2: 4
3: 48
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006791497 Original CRISPR CCAAGGGTGATGGGAGCCAG GGG Intronic
900314102 1:2048574-2048596 CCAGGAGTGATGGGAACCACTGG + Intergenic
900427843 1:2588551-2588573 CCAAGGCTGTTGGCATCCAGGGG + Exonic
900488728 1:2935846-2935868 CCAAGAGGGGTGGGAGCCGGTGG - Intergenic
900582050 1:3414232-3414254 GCAGGGGTGCTGGCAGCCAGGGG + Intronic
900798684 1:4724686-4724708 GGCAGGGTGCTGGGAGCCAGGGG - Intronic
900988211 1:6085647-6085669 CTTAGGGTCAGGGGAGCCAGGGG + Intronic
902867507 1:19288991-19289013 CCAAGGGTGAGGGGGTCCAAGGG + Exonic
903682013 1:25103458-25103480 CCCAGGCTGAGGGGAGCAAGAGG + Intergenic
904302731 1:29565742-29565764 CCAAAGATGATGGGACCCAGGGG - Intergenic
904353075 1:29921555-29921577 CTGGGGGTGATGGGAGACAGTGG + Intergenic
904602759 1:31682974-31682996 CCAGGGGTGAAAGGAGCCACCGG - Exonic
904822229 1:33253242-33253264 GAAAGGGGGATGGGTGCCAGTGG + Intergenic
905447649 1:38037732-38037754 CCAAGGGTGATGGGGTTCATTGG - Intergenic
905478901 1:38247837-38247859 GTAAGGGTGATGTGAGCCAGGGG + Intergenic
907299401 1:53477217-53477239 CCAAGGGTGAGGGGAGCATGGGG - Intergenic
908147237 1:61259534-61259556 ACCAGGGTGTAGGGAGCCAGAGG + Intronic
909122299 1:71618543-71618565 CTGGGGGTGATGGGAGACAGTGG - Intronic
909746792 1:79107824-79107846 CCAAGGAGGATGGAAGCAAGTGG + Intergenic
910469055 1:87531247-87531269 CTGAGGGTGATGGGAGACAGTGG - Intergenic
910480982 1:87658125-87658147 GCATGGATGATGTGAGCCAGAGG + Intergenic
910904634 1:92162366-92162388 CAATGGGAGATGAGAGCCAGTGG + Intergenic
912390612 1:109300158-109300180 ACAAGGATGCTGGGAGCAAGAGG + Intronic
912545587 1:110448894-110448916 CCAAGTGTGATGGGAACCCTTGG - Intergenic
912545611 1:110448999-110449021 CAAAGAGTGAGGTGAGCCAGGGG - Intergenic
915625403 1:157111375-157111397 CCTGGGGTCATGGCAGCCAGTGG + Intergenic
916739975 1:167639269-167639291 CCTAGTGTGCTGGGAGTCAGAGG - Intronic
916931792 1:169586403-169586425 CCTGGGGTGGTGGCAGCCAGCGG - Exonic
917437027 1:175032070-175032092 CCAATGGAGATGGAAGCCAAGGG + Intergenic
917970331 1:180201934-180201956 CCAATGGCCGTGGGAGCCAGTGG + Exonic
918152274 1:181807867-181807889 CCAATGGTGATAGAAGCCACAGG - Intronic
918248223 1:182679428-182679450 CCAAGGGGAAGGGCAGCCAGGGG - Intronic
919751550 1:201041050-201041072 CCAAGGATGCTGGGGGCTAGTGG - Intronic
920269320 1:204751465-204751487 CCAAGTGGGATGGGAGCTGGTGG + Intergenic
921819893 1:219605181-219605203 CCAAGGGTGATGGGAAACATGGG - Intergenic
922131719 1:222786879-222786901 GGATGAGTGATGGGAGCCAGGGG - Intergenic
922454362 1:225762939-225762961 CCGAGGGTAAGAGGAGCCAGCGG - Intergenic
923273851 1:232380026-232380048 CCAAGGTTGCTGGGAGAGAGGGG - Intergenic
923385627 1:233462794-233462816 CCAATTGGGAGGGGAGCCAGAGG - Intergenic
923475149 1:234325054-234325076 CCAGGGGCTATGAGAGCCAGTGG + Intergenic
924074204 1:240316439-240316461 CCTAGGGAAATGGGAGTCAGAGG + Intronic
924247973 1:242103439-242103461 CCAAGCGTCATGTGAGCCATTGG + Intronic
1062858377 10:790930-790952 CTAAGGGTGAGGCCAGCCAGGGG + Intergenic
1063951524 10:11227449-11227471 CAAAGGAGGATGGGTGCCAGGGG + Intronic
1064871901 10:19946721-19946743 CGGTGGGTGATGGGAGACAGAGG + Intronic
1067452204 10:46388687-46388709 CCAAGGGGAATGGGGGGCAGAGG + Intronic
1067585033 10:47471068-47471090 CCAAGGGGAATGGGGGGCAGAGG - Intronic
1069358447 10:67614457-67614479 CTGGGGGTGATGGGAGACAGTGG + Intronic
1069492269 10:68871241-68871263 CCATGGGGGAAGGGAGCTAGAGG + Intronic
1070406838 10:76104806-76104828 CCCAGTGAGATGGCAGCCAGAGG - Intronic
1070567638 10:77615686-77615708 CCGTGGGTGATGAGAGGCAGAGG + Intronic
1070587260 10:77775691-77775713 CCAAGGGAGGTGGGAGCCAGAGG - Intergenic
1071473789 10:86007360-86007382 AGAAGGGTCATGGGAGGCAGTGG + Intronic
1071491803 10:86141230-86141252 CCAAGGGTGTTGACAGCCTGGGG - Intronic
1071829388 10:89356606-89356628 CTGGGGGTGATGGGAGACAGTGG - Intronic
1071866594 10:89741126-89741148 CTGGGGGTGATGGGAGACAGTGG + Intronic
1072249647 10:93571518-93571540 CCAAGGGTGACGGTATCCAGAGG - Intronic
1073827057 10:107336469-107336491 CCAGTGGTGATGGGACCCACAGG - Intergenic
1074253374 10:111776459-111776481 CCAAGGCTGATGGTTGCCTGGGG + Intergenic
1074553738 10:114469364-114469386 CCTAGGAGGATGGAAGCCAGAGG - Intronic
1074748488 10:116559696-116559718 CCATGGGTGATGGGAATTAGAGG + Intronic
1075651938 10:124132892-124132914 CGAGGGGTGATAGGAGCCTGGGG + Intergenic
1075654734 10:124153353-124153375 CTGAGTGTGGTGGGAGCCAGAGG + Intergenic
1075671608 10:124267123-124267145 CCAGGGGTGTCGTGAGCCAGTGG + Intergenic
1075682860 10:124344744-124344766 CTGGGGGTGATGGGAGACAGTGG + Intergenic
1076076424 10:127537385-127537407 CCCATGGTGATGGGAAGCAGGGG - Intergenic
1076124270 10:127962157-127962179 CCCATGGTGCTGGGTGCCAGTGG + Intronic
1076714560 10:132356764-132356786 CACAGGGTGGTGGGAGCCGGTGG + Intronic
1076940746 10:133605723-133605745 ACAAGAGGAATGGGAGCCAGAGG - Intergenic
1076978982 11:195373-195395 CCAAGGGGGTTGGGAGCCGCAGG + Intronic
1077154523 11:1085430-1085452 CCAAGGCTGAGGGGTGCCTGGGG + Intergenic
1077317484 11:1925887-1925909 CCAAGGGTGCTGGCAGCCCTGGG - Intronic
1077332942 11:1991282-1991304 CCAGGGCTGAGGGAAGCCAGCGG - Intergenic
1077540679 11:3145194-3145216 CCACAGGCGATGGGAGGCAGTGG - Intronic
1077810128 11:5628413-5628435 CCAATGGTCATTGTAGCCAGGGG + Intronic
1078359416 11:10656918-10656940 CTAAGGATGGTGGGAGGCAGAGG + Intronic
1078896000 11:15597765-15597787 TCAAGGGTGATGGATGTCAGTGG + Intergenic
1079130142 11:17742486-17742508 CCAGAGCTGATGGGAGGCAGTGG - Intronic
1080161965 11:29187459-29187481 CCAAGTGTGAAATGAGCCAGGGG - Intergenic
1080364399 11:31554081-31554103 ACAGGGGTGATGGGAGACAGTGG - Intronic
1081613950 11:44579496-44579518 TCAAGGGTGAAGGGAGCCTCTGG - Intronic
1081742903 11:45453427-45453449 CCAGTGGTGATAGGAGCCAAGGG + Intergenic
1081746063 11:45473306-45473328 CCAAGGGAGAGGGGAGAAAGGGG - Intergenic
1082079093 11:47997962-47997984 TGAAGGGTGATGCCAGCCAGGGG + Intronic
1083611144 11:64004934-64004956 TCAAGGGGGATGGGAGACTGAGG + Intronic
1083993826 11:66262427-66262449 CCAAGGGTCAGGGAAGCTAGTGG - Intronic
1084095697 11:66909694-66909716 CCAAGTGTGGTGGGAGCCAAAGG + Intronic
1084330902 11:68429626-68429648 CCAAGGGTGATGGGACACCACGG + Exonic
1084780697 11:71406443-71406465 ACATGGATGCTGGGAGCCAGTGG - Intergenic
1085138010 11:74111658-74111680 ACATGGGGGATGGGAGGCAGGGG + Intronic
1085426838 11:76412288-76412310 TCAAGTGTTTTGGGAGCCAGAGG + Intronic
1086130254 11:83394003-83394025 AGAAGGGTGATTGGGGCCAGAGG + Intergenic
1088482089 11:110303939-110303961 CTCGGGGTGATGGGAGACAGTGG - Intergenic
1089561017 11:119343106-119343128 CCAAAGGTGATGGAAGACACAGG + Intronic
1089580489 11:119478902-119478924 GCAAAGGTGCTGGGAGGCAGGGG - Intergenic
1089671369 11:120059144-120059166 CCCAGAGAGATGGGAGCCGGAGG + Intergenic
1089779131 11:120860840-120860862 CTATGTGTGATGGGACCCAGGGG - Intronic
1090653323 11:128824872-128824894 CCGAGGGTGCTGGGAGCCACAGG + Intergenic
1090668482 11:128930556-128930578 CCAAGGGTCAGGGAGGCCAGGGG + Intergenic
1202815925 11_KI270721v1_random:46458-46480 CCAGGGCTGAGGGAAGCCAGCGG - Intergenic
1091385453 12:91878-91900 CCAAGCGAGATGGGAGTCAATGG - Intronic
1091715237 12:2772083-2772105 CCGAGGGTGGAGTGAGCCAGGGG - Intergenic
1092021904 12:5209754-5209776 CAAAGGGTGCTGGGACCCAGAGG - Intergenic
1092262480 12:6959989-6960011 CCAAGGGTGAGGGGCACCTGGGG + Exonic
1094492004 12:30966640-30966662 ACAAGCCTGATGGGAGGCAGAGG + Intronic
1094655853 12:32418982-32419004 CCAGTGGTGATGGCAGCCACAGG - Intronic
1095276392 12:40288418-40288440 CTAAGGGTCAGGGGGGCCAGGGG - Intronic
1095958632 12:47819996-47820018 CCAAGGGGGAGGGGAGGGAGGGG + Intronic
1096614888 12:52826655-52826677 GCAAGGGTAAAGGGAGCCAGCGG + Intronic
1102457930 12:113082337-113082359 CCACGGGTCTTGAGAGCCAGAGG - Intronic
1102555476 12:113723934-113723956 CTGAGGGAGATGGGAGCCATGGG + Intergenic
1104828314 12:131730740-131730762 CCCAGGGTGGTGGTAGTCAGGGG - Intronic
1105069543 12:133226373-133226395 CCAAGGACCATGGGAGCCACTGG - Exonic
1105468448 13:20669208-20669230 AGAAGAGTGATGAGAGCCAGAGG + Intronic
1108736903 13:53293677-53293699 CCAAGGGGAATGGGTGCCTGGGG - Intergenic
1113903785 13:113809964-113809986 CCCAGGCTCATGGGATCCAGTGG - Intronic
1113923622 13:113928470-113928492 CCAAGGGTCCTGGGAGAGAGAGG + Intergenic
1113967856 13:114164655-114164677 TCAAGGAGGATGGAAGCCAGAGG + Intergenic
1114709710 14:24766153-24766175 CCCATGGTGAGGGAAGCCAGAGG - Intergenic
1114792453 14:25674815-25674837 CTAAGGATGAAGAGAGCCAGTGG + Intergenic
1115935475 14:38547573-38547595 TCAATGGTGATTGGCGCCAGTGG + Intergenic
1116889178 14:50250367-50250389 CCAAAGGTGGTGGTAGCCACAGG + Intronic
1117105438 14:52393691-52393713 CCCAGGGTACTGGTAGCCAGTGG + Intergenic
1117335525 14:54754321-54754343 CAAAGTGTGATGGCAGCCAGTGG + Intronic
1117754255 14:58957813-58957835 TTAAGGGTGAGTGGAGCCAGAGG + Intergenic
1118535900 14:66763970-66763992 CTGGGGGTGATGGGAGACAGTGG - Intronic
1118729368 14:68655718-68655740 CCATGGCTGCTGGAAGCCAGAGG - Intronic
1119424131 14:74524850-74524872 CCATGGGAGAAGGAAGCCAGGGG - Intronic
1120227993 14:81812063-81812085 CCTGGGGTGATTAGAGCCAGTGG + Intergenic
1121053025 14:90831633-90831655 CCATGGGTGATGGGCGCCCTGGG - Intergenic
1121467532 14:94125752-94125774 CTAATGGTGGTGGGAGCCAAGGG + Intergenic
1121500937 14:94436932-94436954 CCAGGGGTGATGGGAGACAGTGG - Intergenic
1122073893 14:99223394-99223416 GGTAGGGTGGTGGGAGCCAGGGG + Intronic
1124140263 15:27071214-27071236 CCAAAGCTGCTAGGAGCCAGTGG + Intronic
1124900373 15:33817110-33817132 CTAATGGTCATAGGAGCCAGAGG + Intronic
1125393920 15:39226517-39226539 CCAAGTGTCATGGGAGGCACTGG + Intergenic
1126425396 15:48522133-48522155 CTGAGGGTGATGGGAGACATTGG - Intronic
1128233346 15:66050594-66050616 CTGAGTGTGATGGGAGCCATCGG + Intronic
1128379638 15:67103196-67103218 ACTGGGGTGATGGGAGGCAGGGG - Intronic
1128639943 15:69328740-69328762 CCCAGGGGGATGGGTGACAGAGG - Intronic
1129531158 15:76265912-76265934 ACAAGAGGAATGGGAGCCAGAGG - Intronic
1130128149 15:81111662-81111684 CACAGGGTGATGAGAGGCAGAGG - Intronic
1130311898 15:82763612-82763634 GCATGGGTGAGAGGAGCCAGGGG - Intronic
1131672234 15:94631949-94631971 CCAAGAGCAATGTGAGCCAGAGG + Intergenic
1131831085 15:96354757-96354779 CCAAGGGTGTGCGGAGCCCGAGG - Intergenic
1132044690 15:98553644-98553666 CCAGGGGCTATGGAAGCCAGAGG + Intergenic
1132667569 16:1089205-1089227 GGATGGGAGATGGGAGCCAGGGG - Intergenic
1134342835 16:13360781-13360803 CAGTGGGTGATGGGAGTCAGTGG + Intergenic
1135114111 16:19711320-19711342 CCAAGGGTGGCAGGAGGCAGCGG + Intronic
1135240819 16:20806185-20806207 CCGAGGGTGACAGGAGCCCGAGG - Intronic
1135920433 16:26644490-26644512 CCAAGGGGGATGGGAGTGAGAGG - Intergenic
1136612822 16:31377667-31377689 CCAAGGGGTATGAGAGCCTGGGG - Intronic
1136620656 16:31426504-31426526 TCTATGGTGATGGGAGCCTGAGG + Exonic
1138335374 16:56248869-56248891 CCAGGTGTGATGGGAGCCCATGG + Intronic
1138583283 16:57955350-57955372 TCAGGGGTGATGGGAGCTGGAGG - Intronic
1138963349 16:62053550-62053572 ACCAGGGTGATGGGAGTCAGAGG + Intergenic
1139329313 16:66175256-66175278 TCAAGGCTGTTGGGAGTCAGGGG + Intergenic
1141029158 16:80572769-80572791 CTAAGGATGATGGAAGCCATTGG - Intergenic
1141269781 16:82528591-82528613 CCAAGGGTGTGGGTATCCAGAGG + Intergenic
1141409464 16:83822590-83822612 GCAAGGGTGAATGGGGCCAGTGG - Intergenic
1141658584 16:85429523-85429545 CCCAGGGACATGGGAGCCACAGG - Intergenic
1141669101 16:85482194-85482216 CCGTGGGTGATGGGAGACAGTGG + Intergenic
1142049165 16:87946842-87946864 CCAGGGGTGATGGGAGGGGGTGG - Intergenic
1142466472 17:140191-140213 CCAAGGGGGTTGGGAGCCGCAGG + Intergenic
1142949748 17:3468861-3468883 GCAAGGATGATGAGAACCAGGGG - Intronic
1143184401 17:5001511-5001533 CCATTGGTGATGGGAGATAGAGG + Intronic
1143334662 17:6163221-6163243 GCAAGGGTGCAGAGAGCCAGTGG + Intergenic
1143576231 17:7795003-7795025 CCAAGTGTGGTGGGAGGCTGAGG - Intronic
1144680244 17:17188468-17188490 CAAGGGGTGATGGGAGCTGGTGG - Exonic
1145821068 17:27835930-27835952 CCAAGGGTGGCTGCAGCCAGGGG - Intronic
1146916679 17:36682539-36682561 CCAAGGGTCATGGTGGCCAGAGG - Intergenic
1147381913 17:40061394-40061416 CCATGGGTGAAGGGAGCCTGTGG - Intronic
1147936146 17:44012425-44012447 CCTAGGGTGAGGGGAGACATGGG - Intronic
1148329815 17:46807004-46807026 CCAGTTGTGAAGGGAGCCAGGGG + Intronic
1148357077 17:46982667-46982689 CCAGGGATGATGGGAGAGAGGGG - Intronic
1148489169 17:48012302-48012324 ACAGGGCTGCTGGGAGCCAGGGG - Intergenic
1150299077 17:64033648-64033670 TCTATGGTGATGGAAGCCAGAGG + Intergenic
1150908362 17:69362325-69362347 CAAAGTGAGATGGGAGCCACTGG + Intergenic
1151315549 17:73319897-73319919 CAAAGGGTGATGGGGGCAGGTGG - Intergenic
1151347671 17:73512356-73512378 CTAAGGCTGAGGGGAGCCACTGG - Intronic
1152055964 17:78027070-78027092 CCAAGGGGGATGGGAAATAGTGG + Intronic
1152100979 17:78301651-78301673 CCACTGTGGATGGGAGCCAGTGG + Intergenic
1152118143 17:78401365-78401387 TCAAGGGAGCTGGGAGCCACAGG - Intronic
1152231753 17:79117403-79117425 CCCCGGGTGATGGGAGCGTGGGG - Intronic
1152439091 17:80294454-80294476 CCCAGGGTCATGGGATGCAGCGG - Intronic
1152614990 17:81333861-81333883 CCAGGGGTGCTGGGAGACAGAGG + Intergenic
1153967676 18:10196358-10196380 CCAGCGGTGCTGGGAGCCACAGG + Intergenic
1155071475 18:22320705-22320727 CAAAGGGTGAAGGGAGAGAGAGG + Intergenic
1155151579 18:23127542-23127564 TCCCGGGGGATGGGAGCCAGGGG - Intergenic
1155549670 18:26951876-26951898 ACTAGGTTGCTGGGAGCCAGAGG + Intronic
1155736096 18:29224332-29224354 CTTGGGGTGATGGGAGACAGTGG - Intergenic
1157330779 18:46702402-46702424 CCAAGGGCCATGAGAGCCACGGG - Intronic
1158306213 18:56109075-56109097 CCGAGGGAGAGAGGAGCCAGGGG - Intergenic
1158398034 18:57094980-57095002 CCAGGGGTCCTGGGATCCAGAGG + Intergenic
1160271312 18:77386840-77386862 CTGGGGGTGATGGGAGACAGTGG - Intergenic
1160387182 18:78503776-78503798 CCCAGGGGAGTGGGAGCCAGGGG + Intergenic
1160525636 18:79533861-79533883 CCAGGGGTGCTGGGATCCGGAGG - Intergenic
1160675718 19:390196-390218 CCCACGGTAATGGGAGACAGAGG + Intergenic
1160949047 19:1657033-1657055 CCCAGACTTATGGGAGCCAGAGG + Intergenic
1161167735 19:2797220-2797242 CCTAGGGTAATGGGGGCCGGTGG + Intronic
1161246829 19:3257393-3257415 CCAAGGGTGACTGGGACCAGGGG + Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161512085 19:4677481-4677503 CCCAGGGTGATGGGCAACAGTGG - Intronic
1161596099 19:5151642-5151664 CCTAGGGCGACAGGAGCCAGCGG + Exonic
1161638570 19:5405212-5405234 CAAGGGATGATGGGAGGCAGAGG - Intergenic
1161862316 19:6807308-6807330 CTGGGGGTGATGGGAGACAGTGG + Intronic
1162087966 19:8259941-8259963 CCATGGAGGATGGCAGCCAGAGG - Intronic
1162379109 19:10321426-10321448 ACAAGGGCGCTGGGACCCAGAGG + Intronic
1162844733 19:13383467-13383489 CCAAGCCTGATGGAAGCCATTGG - Intronic
1163371931 19:16905986-16906008 ACAGGGGTGCTGGGAGACAGGGG - Intronic
1163372251 19:16907898-16907920 AGAATGGTAATGGGAGCCAGGGG - Intronic
1163391122 19:17030526-17030548 CTGGGGGTGATGGGAGACAGTGG + Intergenic
1163698556 19:18775935-18775957 CCAAGCTTGATGGGGGCCTGAGG + Intronic
1164035629 19:21451563-21451585 CAAAGGGTGGTGGGAGGCTGAGG + Intronic
1164061280 19:21677638-21677660 CTAGGGATGATGGGATCCAGTGG + Intergenic
1164065370 19:21710056-21710078 CTAGGGATGATGGGATCCAGTGG - Intergenic
1164246749 19:23436604-23436626 CCAAGGGTCATGGGTGGCATCGG + Intergenic
1164479221 19:28598568-28598590 GCAAGGCTCATGGGAGGCAGGGG + Intergenic
1164579687 19:29427002-29427024 CTTGGGGTGATGGGAGACAGTGG - Intergenic
1164656046 19:29922761-29922783 CCAAGGGTGAATGGAGCTGGGGG - Intergenic
1165114944 19:33523026-33523048 GCCAGGCTGGTGGGAGCCAGGGG + Intergenic
1165601132 19:37056571-37056593 CCAAGGGAGGAGGGAGGCAGAGG + Intronic
1165601561 19:37058925-37058947 CCAAGGGAGAAGGGAGGCAGAGG + Intronic
1165735437 19:38172755-38172777 CCAAGGGACATGGGAGCCATGGG + Intronic
1167017083 19:46848224-46848246 CCAGGTGTGATGGGGGGCAGGGG + Intronic
1167486721 19:49767147-49767169 CCAAGGGCGATGGGATGCGGGGG + Exonic
1168207319 19:54860623-54860645 CCCAGCGTGTTGGGAGGCAGAGG - Intronic
925703187 2:6659352-6659374 CCATGAGTGAAGGGAGCCTGGGG + Intergenic
926311627 2:11679788-11679810 TGAAGGGTGATGGGGGCCGGGGG + Intronic
926904242 2:17791143-17791165 CCAAGGGCCAGGGGAGCAAGGGG - Intronic
927603993 2:24469945-24469967 TCAAGGGTGCTTGTAGCCAGGGG + Intergenic
929320105 2:40532595-40532617 CCTAGGGTAATGGGAGGGAGTGG + Intronic
929865110 2:45710893-45710915 CCAGGGGTGCTGGGAGAGAGGGG + Intronic
930619639 2:53630437-53630459 CAAAGGAGAATGGGAGCCAGTGG - Intronic
931248459 2:60510203-60510225 CCAAGGGAGATGGAAGCCACTGG - Intronic
932806215 2:74785645-74785667 AGAAGAGGGATGGGAGCCAGAGG + Intergenic
933384276 2:81589923-81589945 CTCAGGGCGCTGGGAGCCAGTGG + Intergenic
933614962 2:84474401-84474423 ACAAGAGGAATGGGAGCCAGAGG + Intergenic
934656365 2:96118487-96118509 CCAAGTGTGGTTGGAGACAGTGG - Intergenic
934913829 2:98281951-98281973 CCATGGGTGATGAAAGTCAGAGG - Intronic
935415566 2:102813793-102813815 CCAAGAGTGTTTGGAACCAGTGG + Intronic
936539763 2:113340664-113340686 TCAGGGGTGATGGGGGTCAGGGG + Intergenic
936785217 2:116086884-116086906 CCCAGAGTGCTGGGACCCAGAGG - Intergenic
936886911 2:117321666-117321688 CAAAGGGTTATGGAAACCAGAGG + Intergenic
937219195 2:120331866-120331888 CCAAGGGGGAGGGCAGGCAGGGG + Intergenic
937433077 2:121856807-121856829 CCCAGAGTGTTGGGAGGCAGGGG - Intergenic
937582082 2:123499301-123499323 CCAATGGTGCTGGGTGTCAGTGG - Intergenic
937779231 2:125818626-125818648 CCAATGGAGATGGGATCCTGTGG - Intergenic
938777013 2:134550880-134550902 TCCAGAGTGCTGGGAGCCAGGGG - Intronic
939251910 2:139692330-139692352 CCAAGGATGCTTGGACCCAGAGG + Intergenic
940037115 2:149322651-149322673 ACAAGAGAAATGGGAGCCAGAGG - Intergenic
940396437 2:153196760-153196782 CCCAGGGTGGTGGGCTCCAGGGG + Intergenic
940532980 2:154903935-154903957 CCATGTGTGGTGGGACCCAGTGG + Intergenic
940678303 2:156752329-156752351 ACAAGGGTGATGCCAGCCTGAGG - Intergenic
940792940 2:158047353-158047375 CCAGGGGTGTTGGGAACGAGAGG + Intronic
941760509 2:169237165-169237187 CCAAAATTGATGGGAGCCACAGG - Exonic
941993894 2:171583129-171583151 CCAAGGGTGCAGTGAGCCAAGGG + Intergenic
942458832 2:176155860-176155882 CAAAGTGAGATGGGAGTCAGAGG - Intronic
943062894 2:183057153-183057175 CCAAAGGTCTTGGCAGCCAGAGG - Intergenic
944177708 2:196851366-196851388 ACAAGGGTGGTGGCAGCCCGAGG - Intronic
944551018 2:200844824-200844846 CCAGGGGTGATGGCAGCAAGGGG - Intergenic
945301956 2:208222693-208222715 CTGGGGGTGAGGGGAGCCAGTGG + Intergenic
946355420 2:219181538-219181560 CCAAAGGAGGTGGAAGCCAGAGG + Intronic
946436493 2:219659768-219659790 CCAAGTGAGATGGGAGCCATTGG - Intergenic
946704407 2:222444144-222444166 GCATGGGTGATGGGAGACAAGGG + Intronic
946860504 2:223996552-223996574 AGAATGGTGATGGGAGGCAGAGG + Intronic
946932636 2:224686021-224686043 ACAAGGATGATGGGAGGCTGGGG - Intergenic
947096044 2:226568059-226568081 CCAAGGTTTATGGAAGTCAGTGG + Intergenic
947734275 2:232446676-232446698 CTAAGGGGGATGGGACACAGAGG - Intergenic
948753929 2:240148464-240148486 CCAGTGGAGATGGGAGACAGTGG - Intergenic
1169082579 20:2806161-2806183 ACTGGGGGGATGGGAGCCAGGGG - Intergenic
1169090806 20:2860412-2860434 CCATGGGTTAAGGGAGCCACAGG - Intronic
1169954132 20:11082511-11082533 CCAATGGGGATGGGAGCCAGTGG - Intergenic
1171144594 20:22770613-22770635 TCAAGGGTAATGGGAGTTAGTGG + Intergenic
1171180984 20:23090257-23090279 CAAAGGGTGAAGGGACACAGTGG - Intergenic
1171402061 20:24880086-24880108 CCAAGGGTGCTGAGGCCCAGCGG - Intergenic
1172844685 20:37922815-37922837 CCATGGCTCCTGGGAGCCAGTGG - Intronic
1174557584 20:51406823-51406845 CCAAGGGTGACAGGAGTCAGTGG + Intronic
1177909111 21:27008939-27008961 ACAAGTATGATGGGAACCAGGGG - Intergenic
1179949453 21:44701567-44701589 CTGGGGGTGATGGGAGACAGGGG + Intronic
1180247082 21:46555357-46555379 CCACGGCAGAGGGGAGCCAGGGG - Intronic
1181779233 22:25180940-25180962 TCCAGGCTGATGGGAGCCAGAGG - Intronic
1181793899 22:25289689-25289711 TCAAGGGTGGTGGGAGACACAGG + Intergenic
1181833897 22:25586232-25586254 TCAAGGGTGGTGGGAGACACAGG + Intronic
1182888632 22:33797536-33797558 CCAACGGTGGTTGGAGGCAGAGG + Intronic
1183564207 22:38601504-38601526 CTAAGGGTCATGGAAGCCACTGG + Intronic
1183818671 22:40325757-40325779 CCAAGGCTCCTGCGAGCCAGTGG + Exonic
1184233775 22:43172246-43172268 CCAAGGGAGATGGGCTCCAAGGG + Intronic
1184419747 22:44372822-44372844 CCAAGGTCCATGGGAGGCAGTGG + Intergenic
1184424006 22:44398476-44398498 CCGTGGGTGATGGGGGCCTGAGG + Intergenic
1184551448 22:45206349-45206371 CGACGGGAGATGGGACCCAGGGG + Intronic
1184564789 22:45285454-45285476 CCTGGGGTGAGGGGAGCCTGTGG + Intronic
1184783234 22:46659396-46659418 CCAATGGTGGTGGGAGGCTGAGG - Intronic
1185270251 22:49926636-49926658 CCCAGGGTGGTGGGAGGGAGGGG - Intronic
950142348 3:10624047-10624069 ACAAGGGGGATGGGAGCTACAGG - Intronic
950592890 3:13951653-13951675 CCAAGAGTGATGGGGGCCCAAGG - Intronic
951288322 3:20843320-20843342 CCAAGCTTGATGTGGGCCAGAGG - Intergenic
951688971 3:25375503-25375525 CAAATAGTGATGGGAGCCAGGGG - Intronic
952965598 3:38619181-38619203 CCAGGTGTGATGGGAGTCACCGG - Intronic
953183938 3:40621006-40621028 GCAATGGGGATGGGAGTCAGTGG + Intergenic
954629864 3:52041959-52041981 CAGAGGGCCATGGGAGCCAGAGG + Intergenic
954870349 3:53763166-53763188 CAAAGGGTGATGCCAGCCAGTGG + Intronic
956596941 3:70977917-70977939 CCTTGGGTGACGGGAGTCAGGGG + Exonic
958705270 3:97646245-97646267 AGAAGGGCCATGGGAGCCAGTGG + Intronic
961381717 3:126499967-126499989 CCGAGTGAGGTGGGAGCCAGTGG + Intronic
962925554 3:139989722-139989744 CCAAGGGTGGTGGCAGGTAGAGG - Intronic
964282329 3:155080053-155080075 CCCAGGGCGCTGGGAGCCCGTGG + Intronic
964958658 3:162394667-162394689 CCAAGAGTGCTGGTAGCCAAGGG - Intergenic
965727341 3:171732265-171732287 AGAAGGATGATGGGAGGCAGGGG - Intronic
966412620 3:179658744-179658766 CAATGGGGGATGGGAGCCAGTGG - Intronic
968046122 3:195624733-195624755 CCATGGGTGACGGAAGACAGAGG - Intergenic
968308532 3:197665354-197665376 CCATGGGTGACGGAAGACAGAGG + Intergenic
969279712 4:6161677-6161699 CCAAGGGTGACCAGAGCCACCGG + Intronic
969484912 4:7466800-7466822 CCAGGGGTGCTGGGAGGCATAGG + Intronic
969787998 4:9473912-9473934 CCAAGAGCGAGGGGAGCAAGAGG - Intergenic
970110287 4:12630038-12630060 CAATGGGAGATTGGAGCCAGTGG + Intergenic
970169897 4:13278963-13278985 ATGAGGATGATGGGAGCCAGTGG - Intergenic
971304184 4:25465862-25465884 CTAAGTGGGATGGGAGCCACAGG + Intergenic
972187231 4:36544941-36544963 CTGAGGGTGATGGGAGACAGTGG + Intergenic
972703189 4:41514298-41514320 CAAAGAGTGTTGGGACCCAGAGG + Intronic
976281968 4:83334703-83334725 CCAGGGGAGAGGGGACCCAGCGG + Exonic
978306202 4:107331074-107331096 ACAAGAGGAATGGGAGCCAGAGG - Intergenic
979486432 4:121275799-121275821 CACAGGGTGATGGGAGCCCAGGG - Intergenic
980080070 4:128334751-128334773 CGATGGGAGATGGGAGCCCGTGG + Intergenic
980379490 4:131993282-131993304 TCTAGTGTGATGGGAGCCAAGGG - Intergenic
982039793 4:151385429-151385451 CCACGGGTGATGGGAGACCGTGG + Intergenic
982178798 4:152731055-152731077 CCAAGTGAGCTGGGAGCCACTGG + Intronic
985621968 5:960502-960524 CAAAGCGTGAGGGAAGCCAGTGG - Intergenic
985753814 5:1701125-1701147 CCCACGCTGATGGTAGCCAGAGG - Intergenic
987502623 5:18733023-18733045 TCATAGGTGAGGGGAGCCAGTGG - Intergenic
987836363 5:23168424-23168446 CTGGGGGTGATGGGAGACAGTGG - Intergenic
987923180 5:24309578-24309600 ACAAGAGGAATGGGAGCCAGAGG + Intergenic
988687428 5:33538580-33538602 CAAAGGGAGATAGGAGCCAGTGG + Intronic
990468882 5:56095034-56095056 CTCAGGGTGATGGGAAACAGTGG + Intergenic
990980617 5:61599677-61599699 CCAAGTGGTATGGGAGGCAGAGG + Intergenic
994458751 5:100048074-100048096 CCATGGCTGAGGGGAGTCAGGGG + Intergenic
995089601 5:108158564-108158586 CCCAGGGTGAGGGGAGGTAGAGG + Intronic
996230333 5:121055981-121056003 CCAAAGGAGATTTGAGCCAGTGG - Intergenic
997627386 5:135340121-135340143 CCAATGGAGATGGGAGGCAGGGG + Intronic
998214473 5:140227037-140227059 ACTGGGGTGAGGGGAGCCAGAGG + Intronic
999695993 5:154189638-154189660 CCGACGGTGATGCCAGCCAGCGG - Intronic
1003505172 6:6734732-6734754 CAGAGGGTCATGGAAGCCAGGGG - Intergenic
1003526857 6:6905333-6905355 CCATGGAGGATGGGAGCCAGGGG - Intergenic
1006219934 6:32480252-32480274 CCAAGGGTGATGGGAGGGAAGGG + Intergenic
1006224371 6:32524024-32524046 CCAAGGGTGATGGGAGGGAAAGG + Intronic
1006229219 6:32567999-32568021 CCAAGGGTGATGGGAGGGAAGGG + Intronic
1006632272 6:35437953-35437975 CCATGGGTGAAGGGAGACTGTGG - Intergenic
1006791497 6:36704134-36704156 CCAAGGGTGATGGGAGCCAGGGG + Intronic
1006849787 6:37090040-37090062 GCAAGGGTGATGAGAGGGAGAGG + Intergenic
1006928029 6:37669571-37669593 CCAAGGGTGACCTGAGCCAATGG - Intronic
1007083654 6:39127381-39127403 AAAAGAGTGATGGGAGACAGGGG - Intergenic
1007346387 6:41232675-41232697 CTGGGGGTGATGGGAGACAGTGG + Intronic
1007585224 6:42985034-42985056 CGAAGGGGGATCGGGGCCAGGGG - Intronic
1007623862 6:43231329-43231351 CCAAGTGAGATGGGAACCACTGG - Intergenic
1007950638 6:45869041-45869063 CCATAGGTAATGGGAGCCTGTGG + Intergenic
1009523582 6:64715255-64715277 CTGGGGGTGATGGGAGACAGTGG + Intronic
1009565747 6:65309406-65309428 CCAAGGGTGATGGGAAACATGGG + Intronic
1009686434 6:66963620-66963642 CTAAGTGTGATGGTAGACAGGGG - Intergenic
1009931327 6:70180193-70180215 CCAAGGGTGATGCTCTCCAGTGG - Intronic
1010278428 6:73995674-73995696 CCAAAGGTCATGGCAGCCAGTGG - Intergenic
1010632339 6:78213080-78213102 CCCAAGGGTATGGGAGCCAGAGG - Intergenic
1013361326 6:109396330-109396352 GCAAAGGTGATGGGGGCCATGGG - Intronic
1015568953 6:134602348-134602370 ACAAGAGGAATGGGAGCCAGAGG + Intergenic
1016702359 6:147067886-147067908 CCAAGGGTGAGGTGGGGCAGGGG - Intergenic
1016844401 6:148556707-148556729 CCAAGGGTGCTGAGAGGCAGTGG - Intergenic
1017675339 6:156807249-156807271 CCCAGGGTGAAGGGAGCCAGCGG + Intronic
1018894674 6:168005428-168005450 CCAAATGAGATGGGAGACAGAGG + Intronic
1019571941 7:1716917-1716939 GCATGGGGCATGGGAGCCAGAGG + Intronic
1020032754 7:4944382-4944404 CCAGAGATGAGGGGAGCCAGGGG + Intronic
1021579980 7:22142162-22142184 CCTAAGGTGAAGGGACCCAGGGG - Intronic
1021785456 7:24146990-24147012 CTAGGGGTGGTGGGAGACAGTGG + Intergenic
1025818488 7:64942271-64942293 CCAGGGATGGTGGGATCCAGTGG + Intergenic
1026850152 7:73719022-73719044 CCACAGGTGATGGGAGCCACAGG + Intronic
1026981472 7:74529227-74529249 CCAAATGAGATGGGAGCCACTGG + Intronic
1027422703 7:78032962-78032984 CCAAGTGTGATGGAAGCCACTGG + Intronic
1029172259 7:98639484-98639506 CAAAGGGTGATGGGCTCGAGTGG + Intergenic
1029244496 7:99189259-99189281 CCAAAAGGGATGGGATCCAGAGG - Intronic
1029609380 7:101618616-101618638 CCAACGATGATGGGAGGAAGTGG - Intronic
1029976173 7:104836302-104836324 CTAACTGTGATGGGAGCCACTGG + Intronic
1030392680 7:108946508-108946530 CCAAGGGTGATGGTATTAAGAGG - Intergenic
1033085971 7:138342157-138342179 ACAAGAGGAATGGGAGCCAGAGG - Intergenic
1033647509 7:143316420-143316442 CCATGGATGAGGGGAGACAGTGG + Intronic
1033904317 7:146183289-146183311 CCATGGCTGATGGGACCAAGTGG - Intronic
1034988038 7:155529584-155529606 CCAAGGGCCCTGGGAGGCAGAGG - Intronic
1035080526 7:156212313-156212335 ACAATGGTGATGACAGCCAGGGG + Intergenic
1035451623 7:158980642-158980664 GCAAGGGTGATGGGAGCTGGCGG + Intergenic
1037571710 8:20163558-20163580 TCAAAGGTGTTGGGAGCCAAAGG - Intronic
1040380195 8:46864973-46864995 CTGAGGCTTATGGGAGCCAGTGG + Intergenic
1040760233 8:50832925-50832947 CCAGGGGTGATGTTAGCCTGGGG - Intergenic
1042201401 8:66282261-66282283 CCAAAGGTAATGGGAGCCACTGG - Intergenic
1042508000 8:69581877-69581899 CCAAGGCTGATGGGGGCCTTGGG - Intronic
1043536470 8:81210373-81210395 CTTAGGGTGATGGGAGACAGTGG + Intergenic
1044360418 8:91276985-91277007 CCAAGGATGACAGGAACCAGAGG - Intronic
1049081337 8:140445559-140445581 CCATGGATCCTGGGAGCCAGTGG + Intronic
1049328697 8:142038380-142038402 CCAAGGGTGACGGGACTCAGTGG + Intergenic
1049599031 8:143498681-143498703 CCAAGGGGGATGGGAACCGGGGG + Intronic
1050698542 9:8308321-8308343 CAAAGGATGATGTGAGCAAGTGG - Intergenic
1051367663 9:16332618-16332640 CTTCGGGTGATGGGAGGCAGAGG + Intergenic
1053276472 9:36787236-36787258 CCCAGGCTGCTGTGAGCCAGTGG + Intergenic
1053385531 9:37684172-37684194 CCAAGGCTGGGGGGAGGCAGTGG + Intronic
1054450746 9:65402431-65402453 CCAAGGATGCTTGGAGCCACCGG - Intergenic
1055909348 9:81329550-81329572 CTGGGGGTGATGGGAGACAGTGG - Intergenic
1057195164 9:93112474-93112496 CCAAGGGTGGCAGGGGCCAGTGG - Intronic
1057691615 9:97291348-97291370 CTAGGAGTGAAGGGAGCCAGTGG - Intergenic
1058287150 9:103192364-103192386 CTGAGGGTGATGGGAGACAGTGG - Intergenic
1059686896 9:116646441-116646463 GGAAGGGTGATGGGAGTTAGTGG + Intronic
1059757361 9:117306148-117306170 CCAAGTGGGGTGGGAGCCAGAGG - Intronic
1060016180 9:120088309-120088331 CAAAGGGTGGAGGGAGACAGAGG - Intergenic
1061135677 9:128731952-128731974 CCAACAGTGATGGGTGGCAGGGG - Intronic
1061518771 9:131105041-131105063 CCCAGGGTCAGGGCAGCCAGGGG + Intronic
1061890142 9:133614975-133614997 CCAGGGGCGGTGGGAGCCACAGG + Intergenic
1062003005 9:134226205-134226227 CCAGGGGGGCTGGGAGGCAGGGG + Intergenic
1062088695 9:134662567-134662589 CCTTGGGTGATGGGAGGCTGAGG + Intronic
1062181877 9:135195293-135195315 ACATGGGTGATGGGAGAGAGAGG - Intergenic
1185720480 X:2377348-2377370 CGGGGGGTGATGGGAGACAGTGG + Intronic
1188588265 X:31803096-31803118 CCAATGGAGATGGGAGCCCATGG - Intronic
1190064284 X:47229644-47229666 CCGAGTGGGATGGGAGCAAGGGG - Exonic
1192232209 X:69273161-69273183 CAAATGGTGATGGGTGGCAGAGG + Intergenic
1194033720 X:88845830-88845852 ACAAGAGGAATGGGAGCCAGAGG + Intergenic
1194795932 X:98210953-98210975 CCAGGGGTGGTGGTAGCCACAGG + Intergenic
1195060184 X:101186882-101186904 ACAAGAGGAATGGGAGCCAGAGG + Intergenic
1196664033 X:118297742-118297764 ACAAGAGGAATGGGAGCCAGAGG + Intergenic
1198102755 X:133436281-133436303 TTAAGAGTGATGGGAGCCAAAGG + Intergenic
1199492283 X:148413575-148413597 GCAATTGGGATGGGAGCCAGAGG + Intergenic
1199992990 X:152999848-152999870 CCAAGGGTGCTCATAGCCAGGGG - Intergenic
1200961578 Y:9001014-9001036 CCCAGGATGAAGGGAGGCAGTGG + Intergenic
1201900479 Y:19042941-19042963 CCGAGGCTGATGGGAGACAATGG - Intergenic