ID: 1006794405

View in Genome Browser
Species Human (GRCh38)
Location 6:36722502-36722524
Sequence GCCCTTGGTTCCCTGGAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006794405_1006794409 1 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794409 6:36722526-36722548 GAGAGCAGGCTTGAAGATCCAGG 0: 1
1: 0
2: 1
3: 10
4: 162
1006794405_1006794411 14 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794411 6:36722539-36722561 AAGATCCAGGAATGGACTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 252
1006794405_1006794412 15 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794412 6:36722540-36722562 AGATCCAGGAATGGACTCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 230
1006794405_1006794410 6 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794410 6:36722531-36722553 CAGGCTTGAAGATCCAGGAATGG 0: 1
1: 0
2: 0
3: 33
4: 370
1006794405_1006794414 22 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794414 6:36722547-36722569 GGAATGGACTCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 33
4: 279
1006794405_1006794415 23 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794415 6:36722548-36722570 GAATGGACTCCAGGGAAGCTGGG 0: 1
1: 1
2: 0
3: 22
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006794405 Original CRISPR GCCCTTGGTTCCCTGGAGTG AGG (reversed) Exonic
900024677 1:260736-260758 GCCATTGGCTCCATGGGGTGGGG + Intergenic
900028286 1:350141-350163 GCCATTGGCTCCATGGGGTGGGG + Intergenic
900125443 1:1067071-1067093 CCCCTTGCTGGCCTGGAGTGAGG + Intergenic
900134954 1:1112643-1112665 GCCATGTGTTCCCTGGAGGGAGG - Intronic
901703799 1:11059369-11059391 GACCTGGGTTCTCTGGGGTGGGG + Intronic
902333224 1:15741102-15741124 GCCCATTGTTCCCGGGACTGAGG + Exonic
902395766 1:16131866-16131888 GGCCTGGGTTCCCTGCAGGGCGG - Exonic
902943863 1:19819880-19819902 TCCCTGTGTTCACTGGAGTGTGG - Intergenic
903657668 1:24959128-24959150 TCCCTCGGTTACCTGGAGGGAGG - Intronic
904318459 1:29681255-29681277 GACCTTGGCAGCCTGGAGTGGGG + Intergenic
904439027 1:30517727-30517749 GACCTTGGCAGCCTGGAGTGGGG - Intergenic
905399535 1:37691706-37691728 GCCCTGGGCTCCCTGGAGCCTGG + Intronic
905507952 1:38494991-38495013 GTCCTTGGCTCCCTGTAGTAAGG - Intergenic
907756655 1:57317122-57317144 TCCCTTGGTTCCCTGTCATGTGG - Intronic
908757351 1:67481091-67481113 GCCCTTGGTTCCTAGGACTCAGG + Intergenic
910226778 1:84943957-84943979 CCCCTTGGATCCATGGAATGGGG + Intronic
912870484 1:113300081-113300103 ACCCTTGGTTCCTTGCGGTGTGG - Intergenic
913465699 1:119140543-119140565 GTCTTTGGTTACCTGGAGAGCGG + Exonic
915777495 1:158506721-158506743 GCACTGGGTTGCCTGGAGTTGGG + Intergenic
915970051 1:160348396-160348418 ACCCTAGGTTTCCTGGAATGAGG + Intronic
917488224 1:175474646-175474668 GCCATGTGTGCCCTGGAGTGAGG + Intronic
917503272 1:175605019-175605041 CCCTTTGGTACCCTGGAGAGAGG - Intronic
917713402 1:177710071-177710093 TCTCTTGGCTCTCTGGAGTGTGG + Intergenic
920684906 1:208101954-208101976 AATCTTGGTTCCCTGCAGTGAGG - Intronic
920910405 1:210210963-210210985 GGCCTTGGTCCCCTGGTGGGGGG - Intergenic
923630515 1:235646632-235646654 GCCCTGGGTGCCCAGGAGTGAGG - Intronic
924956560 1:248933863-248933885 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1063385452 10:5613690-5613712 GCCCGGGGTTCACTGGAGTAGGG - Intergenic
1066417934 10:35238446-35238468 GTCCTGGGTTCCCTGGACTGTGG + Intergenic
1067909167 10:50327134-50327156 GCCCTGGGGTCCTTTGAGTGAGG - Intronic
1069707042 10:70465441-70465463 GCCCTGGGTTCCAGGGAGGGAGG + Intergenic
1069920517 10:71812940-71812962 ACCCTGTGTTCTCTGGAGTGGGG - Intronic
1070522682 10:77268113-77268135 GCACTTGGGTCCTTGGAGAGAGG + Intronic
1075785702 10:125048634-125048656 GCCCCTGGCTCCCTGGGGTCGGG - Intronic
1076081960 10:127590384-127590406 GCACTTAGTTTCCTGGAGTGGGG + Intergenic
1076500753 10:130934220-130934242 GCCATGGCTTCCCTGGAGTCTGG + Intergenic
1076609179 10:131710437-131710459 CTCCTGGCTTCCCTGGAGTGTGG - Intergenic
1076810516 10:132884219-132884241 GCCTCTGGTTCCCCGGAGCGAGG + Intronic
1076962363 10:133774751-133774773 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1079008456 11:16809465-16809487 CCCCCTGGTTCCTTGGAGGGGGG - Intronic
1079097578 11:17520758-17520780 GCCCTTGGTGCTCTGGGCTGTGG - Intronic
1079366651 11:19815786-19815808 GCCCATGTTTCCCAGGATTGTGG + Intronic
1084327871 11:68412083-68412105 GCCCTGGGGTCCCGGGCGTGTGG - Intronic
1085681341 11:78577860-78577882 GCACATTGTTCCCTGGAGTAGGG - Intergenic
1088711703 11:112514229-112514251 GCCAGTGGGTCCCTGGAGAGAGG + Intergenic
1088939644 11:114439967-114439989 GGGCTTGGGTCACTGGAGTGGGG + Intronic
1089124375 11:116166117-116166139 GGTCTTGGTAGCCTGGAGTGGGG - Intergenic
1090795883 11:130135396-130135418 GCCCTGGGGTCCCTGGTGTTGGG + Intronic
1092038478 12:5362444-5362466 GCCCTTAGGACCCTGGAGGGAGG + Intergenic
1095888719 12:47215684-47215706 GCCTGTGGTTTCCTGTAGTGTGG + Intronic
1100782036 12:98037534-98037556 GCCCTTGGATTCCTAGGGTGAGG - Intergenic
1100822469 12:98444282-98444304 GACCTGTGTTCCCTGGAGTTCGG + Intergenic
1101396415 12:104352302-104352324 ACCCTTGGTTCCCTGGTCTCAGG + Intergenic
1101448308 12:104754183-104754205 GCCCTTGCTTCTCTGGAATCTGG + Intronic
1102046470 12:109833041-109833063 GCCTTTGGTTCCCTGGCTTGGGG + Intronic
1102438857 12:112946359-112946381 GCCCTTTCACCCCTGGAGTGGGG - Intronic
1102796248 12:115691398-115691420 GCCCTGGCACCCCTGGAGTGGGG + Intergenic
1107332095 13:39312152-39312174 GATCTCGGGTCCCTGGAGTGTGG - Intergenic
1110475228 13:75906527-75906549 TCCCTCTGTTGCCTGGAGTGCGG + Intergenic
1112384131 13:98922115-98922137 TCCCTTGGTTCCCAGAAGGGTGG - Exonic
1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG + Intergenic
1113763925 13:112869128-112869150 TCCCTTGGTGGCCTGAAGTGGGG - Intronic
1113779101 13:112965816-112965838 GCCTCTGGTTCCCGGGAGAGAGG + Intronic
1113933502 13:113981147-113981169 ACCCTCTGTTCCATGGAGTGAGG + Intronic
1115209083 14:30946615-30946637 GCTCATGGTACCATGGAGTGGGG + Intronic
1118662277 14:68028059-68028081 GCCCCTGGTTTCATGGAGTTAGG + Intronic
1120136609 14:80877799-80877821 GCTCTGGGTTCCTGGGAGTGGGG - Intronic
1120953472 14:90062124-90062146 GCCCTTATTTCCCGGGGGTGTGG + Exonic
1123058003 14:105581528-105581550 ACCCCTGTTTCCCTGGTGTGGGG + Intergenic
1128225284 15:65997164-65997186 CCCCTGGTTTCCCTGGAGAGAGG + Intronic
1128504215 15:68255142-68255164 GCCCTTGGCTCCCAGGAAGGGGG + Intronic
1129065071 15:72895702-72895724 GCTTTTGGTTCCCCTGAGTGTGG - Intergenic
1129455553 15:75674649-75674671 GCACTTGGTTCCATGGAGCCTGG - Exonic
1131039865 15:89254282-89254304 AGCCCTGGTTCCCTTGAGTGAGG - Intronic
1132956335 16:2596067-2596089 GCCCCAGGCTCCCAGGAGTGTGG - Intronic
1132977354 16:2717340-2717362 GCCCTTTGTGTCCTGGGGTGTGG - Intronic
1133178590 16:4035243-4035265 GACACTGGTTCCCTGGAGTGAGG - Intronic
1133237532 16:4394483-4394505 GCCCATGGTTACCTGGGCTGTGG - Intronic
1134464189 16:14458759-14458781 GCCCTGGCTTCCCTGGGGTAGGG - Intronic
1139313321 16:66045241-66045263 GCCCTTGTTTTCCTGGTCTGTGG - Intergenic
1140115204 16:72035864-72035886 GCCCTGGGTTCCCTTCACTGTGG + Intergenic
1140563423 16:76010964-76010986 GCCCTTTGATACCTGGAGGGTGG - Intergenic
1141000050 16:80299516-80299538 GCTCTTGGTTCCCTGTCTTGGGG - Intergenic
1141028579 16:80569571-80569593 GCCCCTGGTCCCCAGGAGTGCGG - Intergenic
1141411038 16:83833379-83833401 GCACTTTGTCCCTTGGAGTGGGG - Intergenic
1142407273 16:89897429-89897451 GCCCTGGGTTGTCTGCAGTGTGG + Intronic
1142759700 17:2035371-2035393 GCCCTTGGTGCCCAGGATGGGGG - Intronic
1143269102 17:5662541-5662563 GCTCTTGGTTCCCTGGAGTTAGG + Intergenic
1144058603 17:11561883-11561905 GCCCTTGGCTCCGTGCACTGGGG - Exonic
1144698094 17:17319266-17319288 GCCCCTGGTTCCCCGGGCTGTGG + Intronic
1146660864 17:34664480-34664502 GTGCTTGGTGTCCTGGAGTGCGG - Intergenic
1147264242 17:39225410-39225432 TACCTTGGTTTCCTGGAGGGCGG + Exonic
1148759325 17:49991369-49991391 GCGCTTGGGTCCCTGGAGGAAGG + Exonic
1151034223 17:70779671-70779693 TCCCTAGGGTCCCAGGAGTGTGG - Intergenic
1151343060 17:73484275-73484297 CCCCTTGGTTCCCTGAAGCCTGG - Intronic
1152526411 17:80890517-80890539 GCCCTTGGTGCCCAGCAGGGTGG + Intronic
1152951477 17:83236417-83236439 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1158602580 18:58867487-58867509 GCCCAGGCCTCCCTGGAGTGGGG + Intronic
1159106211 18:64003797-64003819 GCCTTTGGTTGACTGGAGGGGGG + Intronic
1159142546 18:64414962-64414984 GCCCTTCGTTCCTTAGAGAGGGG + Intergenic
1159724730 18:71942627-71942649 GTACCTGGTTCCCTGGACTGTGG - Intergenic
1159806417 18:72963019-72963041 TCGCTTGGCTCCCTGGGGTGAGG - Intergenic
1160371670 18:78377465-78377487 GATGTTGGTTCCCTGGAGCGTGG + Intergenic
1160632985 18:80259246-80259268 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1160670255 19:359023-359045 GCGCTTGCCTCCCTGGTGTGGGG - Intergenic
1161162536 19:2769133-2769155 GGCCTGGGGTGCCTGGAGTGGGG - Intronic
1161628991 19:5342066-5342088 TCCCCTGCTTCCCTGGAGTCAGG + Intergenic
1162751280 19:12830727-12830749 GCCTTTGGTCAGCTGGAGTGTGG - Intronic
1163223037 19:15935346-15935368 GCCCTGGGTTGCCTGGAGGCAGG - Intergenic
1163577353 19:18118433-18118455 GCCCCTCGTTCCCTGGACTGGGG + Intronic
1163602426 19:18257157-18257179 GACCCTGGCTCCCTGCAGTGGGG - Exonic
1164898458 19:31897656-31897678 TCCCTTGGTTCCTAGGTGTGTGG + Intergenic
1164902744 19:31941797-31941819 GCTCTGCTTTCCCTGGAGTGGGG - Intergenic
1165080558 19:33303657-33303679 GCCCTGGGGCCCCTTGAGTGCGG + Intergenic
1166288850 19:41848868-41848890 GCCCTTGGGTCCCTGGACACTGG + Exonic
1166555957 19:43700000-43700022 GCCTTTGGGACCCTGGTGTGAGG - Intergenic
1167618300 19:50548224-50548246 GCCCTGGAGTCCCTGGGGTGTGG - Intronic
1168727507 19:58595455-58595477 GCCATTGGCTCCATGGGGTGGGG - Intergenic
924958640 2:13136-13158 GCCATTGGCTCCATGGGGTGGGG + Intergenic
925402094 2:3582077-3582099 GCCCTGGTTTCTCTGGAATGAGG + Intergenic
925920320 2:8633577-8633599 GTCCTTGGCTCCCTGGTGCGTGG - Intergenic
926720716 2:15958192-15958214 GACCTTGTTTCCCTGGGTTGAGG + Intergenic
927086569 2:19678526-19678548 GCCTTAGGTTAGCTGGAGTGGGG - Intergenic
927954262 2:27197619-27197641 GCCCTTGGGTCCCAGGAGGAGGG + Intergenic
928084502 2:28337351-28337373 GCCATTGGTGCCCTGATGTGGGG + Intronic
929787750 2:45004392-45004414 GCCCTCGCTTTCCCGGAGTGAGG - Intergenic
930020693 2:47000416-47000438 GCCCTTGGTTCAGTGGAGGTGGG + Intronic
932937343 2:76120359-76120381 GCCCTTGGTGTCCTGCAGTCTGG - Intergenic
933521896 2:83384360-83384382 CCCTTAGGGTCCCTGGAGTGAGG - Intergenic
935286317 2:101566779-101566801 GCCCTTGGCGCACTGGGGTGAGG - Intergenic
936571046 2:113615739-113615761 GCCATTGGCTCCATGGGGTGGGG + Intergenic
941993572 2:171579893-171579915 GCCCCTGCCTCTCTGGAGTGGGG + Intergenic
948337718 2:237223699-237223721 GCCCTTGGCTGCCTTGTGTGTGG - Intergenic
949087968 2:242173436-242173458 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1168968270 20:1913329-1913351 GCCCTGGGCTTCCTGCAGTGAGG + Intronic
1172130519 20:32651831-32651853 AGCCTTGGATCCCTTGAGTGAGG + Intergenic
1176109567 20:63405249-63405271 GGCCTGGGCTCCCTGGAGAGTGG - Intergenic
1176165757 20:63672722-63672744 GCCCTAGGTGCCCAGGACTGGGG + Intronic
1176383173 21:6123890-6123912 GCCATTAGTTCCCTGCAGTGAGG - Intergenic
1178345896 21:31827828-31827850 GCCCTAGGTTCCATGCCGTGGGG + Intergenic
1179740294 21:43414349-43414371 GCCATTAGTTCCCTGCAGTGAGG + Intergenic
1179997512 21:44980836-44980858 GCCCTTGGTTTCCTGGCTTGTGG + Intergenic
1180262947 21:46687257-46687279 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1180592614 22:16954118-16954140 GCCCTTGGTTCTCTGCATTATGG + Intergenic
1180972872 22:19824735-19824757 GCCCCTGCCTCCCTTGAGTGGGG - Intronic
1181339338 22:22165789-22165811 GCTCCTGGTGCCCTGGAGGGAGG + Intergenic
1182626330 22:31649392-31649414 GCCCTTAGTTGGCTGGAGAGAGG + Intronic
1182761416 22:32725264-32725286 GCCCTGGTTTCCTGGGAGTGGGG + Intronic
1183373551 22:37449266-37449288 CCCCTTTGTACCTTGGAGTGAGG - Intergenic
1185101164 22:48841649-48841671 GCCCTGGTGTTCCTGGAGTGTGG - Intronic
1185109590 22:48893670-48893692 GCCCATGTGTCCCAGGAGTGAGG + Intergenic
1185109602 22:48893711-48893733 GCCCATGTGTCCCAGGAGTGAGG + Intergenic
1185109616 22:48893752-48893774 GCCCATGTGTCCCAGGAGTGAGG + Intergenic
1185109630 22:48893793-48893815 GCCCATGTGTCCCAGGAGTGAGG + Intergenic
1185429149 22:50795131-50795153 GCCATTGGCTCCATGGGGTGGGG - Intergenic
951766774 3:26208408-26208430 GTCCTGGGTTCCCTTGACTGTGG - Intergenic
952448971 3:33412972-33412994 GCCCTTGGATACCTGGATTACGG + Intronic
953870991 3:46627566-46627588 GGCCTTGGTGCCCTGGAGGGTGG + Intergenic
955008347 3:54990678-54990700 CACCTTGCTTCCCTGGAGAGAGG - Intronic
957079928 3:75628639-75628661 GCCATTGGCTCCATGGGGTGGGG + Intergenic
961059502 3:123816527-123816549 CAGGTTGGTTCCCTGGAGTGTGG - Intronic
962199578 3:133390357-133390379 GACCTGGTTTCCCTGCAGTGGGG - Intronic
966592079 3:181695176-181695198 GATCGTGGTTCCCTGGAGAGCGG - Intergenic
968481476 4:834964-834986 TCTTGTGGTTCCCTGGAGTGGGG + Intergenic
968562300 4:1290356-1290378 GCCCTGGGCTCCCGGGAGGGCGG - Intronic
968694845 4:2019094-2019116 GCCCTTGGTGCCCTTGAGACAGG - Intronic
969289325 4:6228551-6228573 GCCCCTGCTGTCCTGGAGTGAGG + Intergenic
969529011 4:7719580-7719602 GCCCCTGGCTCCGAGGAGTGTGG - Intronic
972177228 4:36422932-36422954 GGTCTTGGGTACCTGGAGTGTGG + Intergenic
976133712 4:81912311-81912333 GCCCTTGGGTCCCTGGTGGTAGG - Intronic
980440525 4:132838410-132838432 GGCCATGCTTCCCTGGAGAGTGG + Intergenic
981474941 4:145179417-145179439 ACACTTGGTTTACTGGAGTGGGG + Intronic
981920198 4:150078420-150078442 CCCCTTCCTTCCCTGGAGCGCGG - Intronic
982292322 4:153791774-153791796 GCCCATAGGTCCCTGGAGAGGGG + Intergenic
983077509 4:163343954-163343976 GCCCTGGGCTCCCGGGAGCGCGG - Intronic
985461821 4:190114506-190114528 GCCATTGGCTCCATGGGGTGGGG - Intergenic
985465596 4:190192231-190192253 GCCATTGGCTCCATGGGGTGGGG - Intergenic
985468000 5:15819-15841 GCCATTGGCTCCATGGGGTGGGG + Intergenic
986310477 5:6547294-6547316 GCCCCAGGTGGCCTGGAGTGGGG - Intergenic
988135066 5:27159558-27159580 GCACTGGGATCCCTGGAGTTGGG + Intergenic
997045602 5:130313153-130313175 GATCTTGGTTCCCTGAGGTGAGG - Intergenic
1001763361 5:174225405-174225427 GACCCTGCTTCTCTGGAGTGGGG - Intronic
1002556932 5:180049243-180049265 GCTCATGTTTCCCTCGAGTGAGG - Intronic
1002745704 5:181470230-181470252 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1002906522 6:1453543-1453565 GTCCTGGGTTCCCTTGACTGTGG - Intergenic
1003171769 6:3726091-3726113 GCCCTTGGCACCCTGGAATGAGG - Intronic
1003370842 6:5524350-5524372 GCCCTTGGTTTCCTGGGCAGAGG + Intronic
1004704612 6:18112745-18112767 GCCTTTGGTTACAAGGAGTGTGG - Intergenic
1005861723 6:29907531-29907553 GGCCTTGGTGCCCTGCTGTGAGG + Intergenic
1006794405 6:36722502-36722524 GCCCTTGGTTCCCTGGAGTGAGG - Exonic
1007244897 6:40454017-40454039 ACTCTGGGTTCCCTGAAGTGGGG + Intronic
1007343610 6:41209719-41209741 GCACTTGATTTCCTGCAGTGAGG + Intergenic
1007502981 6:42312814-42312836 GCCCTTGTGTTCCTGGAGAGTGG - Intronic
1007821299 6:44562271-44562293 GGCCTTGGTTTCCTTGTGTGTGG - Intergenic
1013447997 6:110250637-110250659 GCCCTTGGATCTCTGGAGTAGGG - Intronic
1015125227 6:129746825-129746847 TCCCTTCGTTCCCTGAAGTATGG - Intergenic
1015933097 6:138382489-138382511 CCCCTGGGTGCCCTGGAGTTAGG - Exonic
1017021532 6:150143596-150143618 GCACTTGGTCCCCGGGAGTCAGG - Intronic
1017034191 6:150252287-150252309 TCCCTCAGTTCCCAGGAGTGAGG - Intergenic
1018055653 6:160050049-160050071 GCATTTGGTTCCCTGTAGGGAGG + Intronic
1018660841 6:166086071-166086093 GCCCCTGATTCCCTGAAATGTGG - Intergenic
1019250621 6:170743785-170743807 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1019481814 7:1270388-1270410 GCCCTGGTTGTCCTGGAGTGGGG - Intergenic
1021590074 7:22251469-22251491 GTCCTTGGTTCCCTGGTTAGTGG - Intronic
1022088611 7:27092951-27092973 GCTCTTGGTTCACTGATGTGAGG + Intergenic
1023056042 7:36290833-36290855 TCCCTTGATTCCCAGCAGTGAGG - Intronic
1023106087 7:36764463-36764485 CCCAGTGGTTCCATGGAGTGTGG + Intergenic
1023220641 7:37917362-37917384 GCCCTTAGTTGTGTGGAGTGTGG + Intronic
1023578682 7:41657918-41657940 GGCTTTGGTTCCATGGAATGGGG - Intergenic
1034447917 7:151122893-151122915 TCCCGTGGGTCTCTGGAGTGGGG - Intronic
1035067941 7:156121692-156121714 GCCCTTCCTCCCCTGGACTGGGG - Intergenic
1035375145 7:158402730-158402752 GCCCTTGGATCCCTCTAGGGCGG - Intronic
1037592420 8:20324199-20324221 GCACTTTGTTCACTGGAGAGAGG - Intergenic
1037986435 8:23293428-23293450 ACCCTTGGTTCCCTGGGTAGAGG + Intronic
1039554644 8:38467608-38467630 GCCCGCGGTTTCCTGGACTGGGG - Intronic
1042219720 8:66461425-66461447 GCCCTTGCCTACTTGGAGTGGGG - Intronic
1042808778 8:72801085-72801107 GCATTATGTTCCCTGGAGTGGGG - Intronic
1043166470 8:76909070-76909092 CCCCTTGGTTTTCTGGACTGAGG + Intergenic
1044621459 8:94194552-94194574 GCCATTCTTTCCCTGGTGTGGGG + Intronic
1045801877 8:106111269-106111291 GTCCTTGGTTCCCTTGACTGTGG + Intergenic
1047303385 8:123634153-123634175 TCCCAAGGATCCCTGGAGTGAGG + Intergenic
1049463753 8:142741759-142741781 GCCCTGGGTGCACTGGAGTCAGG - Intronic
1053157282 9:35790523-35790545 GCTCCTGGAGCCCTGGAGTGGGG - Intergenic
1056773517 9:89496400-89496422 GCCCTGGGGTCCCAGGAGGGTGG - Intronic
1056823546 9:89861022-89861044 GGCTTTGCTTCCCTGGGGTGGGG + Intergenic
1060677662 9:125530111-125530133 GCCCTTGGTTTCCTGTGGTGGGG + Intronic
1060823433 9:126674170-126674192 GTCCTTGGCTCCCTGGTGCGGGG - Intronic
1060967633 9:127720752-127720774 GCCCTGGGTGCCCTGGTGTGTGG - Intronic
1061039410 9:128131260-128131282 GGCTTTGCTTCCCTGGGGTGGGG - Intergenic
1061395676 9:130342266-130342288 GCCCTGGGTTCCTTGGAGGCAGG + Intronic
1061779531 9:132987496-132987518 CCCCTTGGGGCCCTGGAGTCAGG + Intronic
1062269797 9:135703179-135703201 GCCCAGGGTTCCCTGGAGTCTGG - Intronic
1062397028 9:136356730-136356752 GCCCGGGGTTCCCAGGAGTAGGG - Intronic
1062458827 9:136654348-136654370 GCCCTGGCTTCCCTGGGATGAGG - Intergenic
1062698057 9:137885399-137885421 GCCCTTGGCTCACAGGGGTGAGG - Intronic
1203580176 Un_KI270745v1:36382-36404 GCCATTGGCTCCATGGGGTGGGG - Intergenic
1191184256 X:57592622-57592644 GCCCCTGGCTCCCAGGCGTGTGG - Exonic
1191213137 X:57909837-57909859 GCCCCTGGCTCCCAGGCGTGTGG + Exonic
1195963937 X:110413346-110413368 GCCCTAGGGTGCCTGTAGTGTGG - Intronic
1198075695 X:133190975-133190997 GCCCTTTCTTCCCACGAGTGAGG + Intergenic
1200096260 X:153665378-153665400 AGACTTGGTTCCCTGGGGTGAGG + Intergenic