ID: 1006794405

View in Genome Browser
Species Human (GRCh38)
Location 6:36722502-36722524
Sequence GCCCTTGGTTCCCTGGAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006794405_1006794409 1 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794409 6:36722526-36722548 GAGAGCAGGCTTGAAGATCCAGG 0: 1
1: 0
2: 1
3: 10
4: 162
1006794405_1006794410 6 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794410 6:36722531-36722553 CAGGCTTGAAGATCCAGGAATGG 0: 1
1: 0
2: 0
3: 33
4: 370
1006794405_1006794412 15 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794412 6:36722540-36722562 AGATCCAGGAATGGACTCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 230
1006794405_1006794415 23 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794415 6:36722548-36722570 GAATGGACTCCAGGGAAGCTGGG 0: 1
1: 1
2: 0
3: 22
4: 223
1006794405_1006794411 14 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794411 6:36722539-36722561 AAGATCCAGGAATGGACTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 252
1006794405_1006794414 22 Left 1006794405 6:36722502-36722524 CCTCACTCCAGGGAACCAAGGGC 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1006794414 6:36722547-36722569 GGAATGGACTCCAGGGAAGCTGG 0: 1
1: 0
2: 1
3: 33
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006794405 Original CRISPR GCCCTTGGTTCCCTGGAGTG AGG (reversed) Exonic