ID: 1006797205

View in Genome Browser
Species Human (GRCh38)
Location 6:36739353-36739375
Sequence GGTGAGGTGACATGAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006797201_1006797205 -10 Left 1006797201 6:36739340-36739362 CCACGGCCCCTGTGGTGAGGTGA No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797195_1006797205 7 Left 1006797195 6:36739323-36739345 CCTCTCCTGACACTTTCCCACGG No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797189_1006797205 26 Left 1006797189 6:36739304-36739326 CCCCCTGCCAGGCAAGCACCCTC No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797193_1006797205 19 Left 1006797193 6:36739311-36739333 CCAGGCAAGCACCCTCTCCTGAC No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797190_1006797205 25 Left 1006797190 6:36739305-36739327 CCCCTGCCAGGCAAGCACCCTCT No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797192_1006797205 23 Left 1006797192 6:36739307-36739329 CCTGCCAGGCAAGCACCCTCTCC No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797200_1006797205 -9 Left 1006797200 6:36739339-36739361 CCCACGGCCCCTGTGGTGAGGTG No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797197_1006797205 2 Left 1006797197 6:36739328-36739350 CCTGACACTTTCCCACGGCCCCT No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797194_1006797205 8 Left 1006797194 6:36739322-36739344 CCCTCTCCTGACACTTTCCCACG No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data
1006797191_1006797205 24 Left 1006797191 6:36739306-36739328 CCCTGCCAGGCAAGCACCCTCTC No data
Right 1006797205 6:36739353-36739375 GGTGAGGTGACATGAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006797205 Original CRISPR GGTGAGGTGACATGAGCTGC TGG Intergenic