ID: 1006799899

View in Genome Browser
Species Human (GRCh38)
Location 6:36753096-36753118
Sequence CTTCAAAACAAAAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006799895_1006799899 2 Left 1006799895 6:36753071-36753093 CCACAGCAAAGGAAAGCAGGGTG 0: 1
1: 0
2: 1
3: 35
4: 392
Right 1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG 0: 1
1: 0
2: 2
3: 26
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006799899 Original CRISPR CTTCAAAACAAAAGGGAGCT TGG Intronic
900170267 1:1264474-1264496 CTTTAAAACTAATGGGGGCTGGG + Intronic
900582719 1:3416952-3416974 CTTCAAAGAGAAGGGGAGCTGGG + Intronic
904655218 1:32040490-32040512 CTTCAAGCCAACAAGGAGCTTGG - Intronic
904789606 1:33009195-33009217 TCCCAAAACAAGAGGGAGCTGGG - Intronic
905191306 1:36237159-36237181 TCTCAAAACAAAAAGCAGCTAGG + Intronic
906315387 1:44783907-44783929 CTTCACAGCAACAGGGAGCTAGG - Exonic
906672136 1:47664120-47664142 TTTCAAAACCAGAGGGAGATAGG - Intergenic
907299709 1:53478952-53478974 CCTTAAAAGAAAAGGCAGCTGGG + Intergenic
907733453 1:57089464-57089486 TTGCAAAACAAAAGGGAGATGGG + Intronic
908278085 1:62497965-62497987 TTTAAAAAAAAAAGGGGGCTGGG + Intronic
910427586 1:87132197-87132219 CTTAATAACAACAGGGTGCTGGG - Intronic
910750574 1:90625890-90625912 CTTTAAAATAAAAGAGAGTTGGG - Intergenic
910905571 1:92174062-92174084 CTTCAAAATAAAATGGGGGTGGG + Intronic
911011329 1:93284181-93284203 CTACAAAACAAAAGGTAGAGGGG + Intergenic
911614943 1:99999802-99999824 CTAAAAAAAAAAAGGGAGCGGGG - Intronic
912347481 1:108977821-108977843 CTCAAAAACAAAAACGAGCTGGG + Intronic
912764410 1:112396049-112396071 TTCCCAAACAAAAGGGATCTTGG + Intergenic
912836907 1:113004767-113004789 TTACAAAGCAAAAGGAAGCTGGG + Intergenic
913006558 1:114638461-114638483 CTTAAAAATTAAATGGAGCTGGG + Intronic
913420463 1:118661750-118661772 CTTAAAAGCAAAATGAAGCTAGG + Intergenic
913540216 1:119812527-119812549 TTTCCAAACAACAGTGAGCTGGG - Intergenic
914247698 1:145898043-145898065 CTTCAAGAGAAAAGGGAGGGAGG - Intronic
914363020 1:146952393-146952415 CTTCAAAACATAATTGAGCGAGG + Intronic
915312430 1:155011296-155011318 CTTGGAAAGAAAAGGGAGATGGG - Intronic
916033527 1:160900379-160900401 CTTCAAAAAAAAAGTGGGCAAGG + Intergenic
917171645 1:172183036-172183058 CTTTTTAACTAAAGGGAGCTAGG + Intronic
918878364 1:190081427-190081449 CATCTAAACACAAGGGAGGTTGG - Intergenic
919417268 1:197326691-197326713 TTGCAAAAAACAAGGGAGCTGGG + Intronic
919874537 1:201853897-201853919 CTGCAAAACAAAAATTAGCTGGG - Intronic
920004107 1:202820278-202820300 CAGAAAAACAAAAAGGAGCTGGG - Exonic
920149679 1:203894925-203894947 CTTGAAAACAAAGGTGAGCCAGG + Intergenic
920842779 1:209568790-209568812 CTTCAAAAATAAAGTTAGCTGGG - Intergenic
922054938 1:222032764-222032786 AGTCAAAAAATAAGGGAGCTGGG + Intergenic
923774634 1:236967413-236967435 CTACAAAAGATGAGGGAGCTTGG + Intergenic
924192184 1:241565720-241565742 TTTCAAAAAAAAAGAGAGCATGG + Intronic
1063757361 10:9028365-9028387 CTTTAAAAAAAAAAGGAGATTGG - Intergenic
1064271467 10:13870060-13870082 CTTACAAAGGAAAGGGAGCTGGG + Intronic
1064971421 10:21071010-21071032 CTACAAAAAAAAAAGGAGCCAGG + Intronic
1066002705 10:31119393-31119415 CCTCAAAATCAAAGGGAGTTTGG + Intergenic
1068079939 10:52308108-52308130 TTAAAAAATAAAAGGGAGCTGGG - Intergenic
1070357465 10:75654436-75654458 CTTCAATACAAATGGGAGGATGG + Intronic
1070467981 10:76744024-76744046 TCTCAAAACAAAAGAAAGCTTGG + Intergenic
1070682938 10:78461959-78461981 TGTCAAGACAAAAGGGAGCAAGG + Intergenic
1071185418 10:83038286-83038308 CTTCATAACAACAGTGAGGTAGG + Intergenic
1071728661 10:88225417-88225439 GTTTAAAACAACTGGGAGCTGGG + Intergenic
1071795633 10:89002103-89002125 CTTCAAAACAAATGGATACTGGG - Intronic
1071966969 10:90861214-90861236 GTTCTATAAAAAAGGGAGCTTGG - Intergenic
1072364399 10:94694634-94694656 CTTCAAAATAACAGGCATCTTGG + Intronic
1073218611 10:101851323-101851345 CATCAAATCAGAAGTGAGCTAGG + Intronic
1073370729 10:102986617-102986639 CTTAAAAAAAAAAGTCAGCTGGG + Intronic
1074379502 10:112967539-112967561 TTTCAAAACCAAGGGGAGCTAGG - Intronic
1076463333 10:130661179-130661201 CTTCAAAACAGAAAGGAGAGGGG + Intergenic
1079316355 11:19411017-19411039 ATGCAAAAGAAAAGGGAGATAGG - Intronic
1079605026 11:22354510-22354532 CTTCAAAACATAAGAGAGATGGG + Intronic
1079959428 11:26904772-26904794 CTTCAAAAAAGAAGTTAGCTTGG + Intergenic
1080772848 11:35358141-35358163 CTAAAAAAAAAAAGGGAGGTGGG + Intronic
1081795277 11:45814450-45814472 CTTAAAAAAAAAAAAGAGCTGGG - Intergenic
1082083739 11:48032201-48032223 TTTCACAAAAAAAGGGAACTAGG - Intronic
1082288443 11:50341752-50341774 CTTCAAAGGAAAAGGAATCTGGG + Intergenic
1083562683 11:63685742-63685764 CTCCAAAACCAAGAGGAGCTTGG - Intronic
1084104406 11:66971673-66971695 GGTTAAAACAAAAAGGAGCTGGG + Intergenic
1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG + Intronic
1084787211 11:71449228-71449250 TTTCAAAACAAAAAGGTGCAGGG - Intronic
1086093816 11:83030634-83030656 CTAAAAAACAAAAGTTAGCTAGG + Intronic
1086475842 11:87172118-87172140 CTTCAAAACTATAGGTACCTGGG + Intronic
1087361640 11:97167485-97167507 CTTGAAAAAAAAAGTCAGCTGGG - Intergenic
1088325715 11:108598811-108598833 CCTGATAACATAAGGGAGCTAGG + Intergenic
1088436452 11:109818374-109818396 CTTGAAAAAAAAAAGGAGGTGGG + Intergenic
1088489020 11:110369072-110369094 CTTTAAAACAAATGCGGGCTGGG + Intergenic
1088687520 11:112297594-112297616 CTTCAAAACCAAAGGAAGTGAGG - Intergenic
1091018782 11:132079767-132079789 ATACAAAACAAAAGAGAGCAAGG - Intronic
1091171404 11:133522821-133522843 CTTGGAATCAAAAGGGACCTTGG - Intronic
1091690974 12:2597207-2597229 CTGCAAAACAAAAAGGAACAGGG - Intronic
1092490822 12:8943353-8943375 CTTAAAAACAAAAGGAAGGAAGG + Intronic
1093662120 12:21768920-21768942 CTTCAAAACAGAAAAGTGCTAGG + Intronic
1094222453 12:28008994-28009016 CTTCAAATCCAAAGCCAGCTTGG - Intergenic
1095348008 12:41175469-41175491 CTTCAAAACAAAATGGTGTATGG + Intergenic
1098153965 12:67577901-67577923 CTTCAACACATTAGGAAGCTTGG - Intergenic
1098407097 12:70138372-70138394 CTACAAAAAAAAAGGGCCCTAGG - Intergenic
1098575963 12:72042697-72042719 CTTCAAAAGGAATGAGAGCTGGG + Intronic
1098972124 12:76867845-76867867 CTTAAAATCAAAAGGGATGTGGG + Intronic
1100218683 12:92480483-92480505 ATACAAAAAAAAAGGTAGCTGGG + Intergenic
1100556188 12:95696111-95696133 CTCCAAAGGAAAAAGGAGCTAGG - Intronic
1100650269 12:96579712-96579734 CTACAGAGAAAAAGGGAGCTAGG - Intronic
1100701596 12:97154502-97154524 CTGAAAAACAAAAGGGGGCAGGG - Intergenic
1100836903 12:98574945-98574967 CATCAAAACAAAAGTAGGCTGGG + Intergenic
1101644431 12:106616501-106616523 CTTCAAAACAATAGAGACATAGG - Intronic
1102344803 12:112152742-112152764 CTTCCAAGCAACAGGGAGCTGGG + Exonic
1102486143 12:113258780-113258802 CTTAAAAAAAGCAGGGAGCTGGG + Intronic
1102514469 12:113437110-113437132 CATCAAACCAATAGGGAGCAGGG - Intronic
1102782494 12:115577395-115577417 CTATAAAGCAAAAGAGAGCTGGG - Intergenic
1103124044 12:118406012-118406034 TTTCAAAATGAAAGGGAGCTTGG - Intronic
1103291742 12:119851870-119851892 CTACAATACAAAAAGTAGCTGGG + Intronic
1103453844 12:121049329-121049351 CTAAAATACAAAAGTGAGCTGGG + Intergenic
1104505628 12:129329616-129329638 CTTCAAAACTGCAGGGAGATAGG + Intronic
1106455089 13:29919853-29919875 CTTAAAAAAAAAAGGGGGTTGGG + Intergenic
1108185659 13:47886050-47886072 CTTTAAAAAAAAATGGAGTTAGG + Intergenic
1108444654 13:50495348-50495370 CTTCAAAACATTAAGGTGCTTGG - Intronic
1108529421 13:51315070-51315092 TGTTAAAACAAAAAGGAGCTGGG - Intergenic
1108535953 13:51378902-51378924 CTACAAATCAAAAGGCAGTTTGG - Intronic
1109400536 13:61821839-61821861 CTTTAAAACAAAAGTTATCTTGG + Intergenic
1109959088 13:69607231-69607253 CTTAAAAAGAAAAGTTAGCTGGG + Intergenic
1110213646 13:73002685-73002707 CATTAAAACAAAAAAGAGCTTGG + Intronic
1112431668 13:99355703-99355725 TTTCAAAACAAACGAGAGCCAGG + Intronic
1113097913 13:106686026-106686048 CTTCAAAACAAAAGAGTTTTAGG - Intergenic
1115033351 14:28826504-28826526 CTTCAAAACTAAAGGGAAAATGG - Intergenic
1115486286 14:33914217-33914239 ATACAAAAAAAAAGTGAGCTGGG + Intergenic
1118637876 14:67764512-67764534 CTTAAAAACAAAACTCAGCTGGG - Intronic
1119066304 14:71530589-71530611 CTGCTAATCAAAAAGGAGCTGGG - Intronic
1120518451 14:85498033-85498055 TTTATAAACAAAAGGGTGCTTGG - Intergenic
1120630845 14:86888184-86888206 CTTTACAACAAAATGGTGCTGGG + Intergenic
1121225902 14:92322162-92322184 CTCTAAATCAAAAGGGAGCAAGG - Intergenic
1121931398 14:97975764-97975786 TTTTAAAACCAAAGGGAGTTGGG - Intronic
1122229091 14:100296266-100296288 CTTCAAAAAAAACATGAGCTAGG + Intronic
1122785000 14:104159536-104159558 CTCCCAAACAAAAGGCAGCCAGG - Intronic
1123840128 15:24239731-24239753 CTCCAAAACAAAAGACTGCTGGG - Intergenic
1124554544 15:30712280-30712302 CAACAAAACAAAAGGGAGGGGGG - Intronic
1124676705 15:31693397-31693419 CAACAAAACAAAAGGGAGGGGGG + Intronic
1125551612 15:40549338-40549360 CCTAAAAGCAAAAGGGAACTTGG - Intronic
1126102456 15:45128078-45128100 CTTCAGTACATAAGGGAGCCTGG - Intronic
1127481870 15:59385155-59385177 CTCAAAAACAAAAGGAGGCTGGG - Intronic
1128167200 15:65476045-65476067 CATAAAAACAAATGGGTGCTGGG - Intronic
1128263052 15:66245963-66245985 CCTAAAAACAAAAGGCAGCCAGG + Intronic
1130570832 15:85041952-85041974 GTTCAAAAGAAAACGGAACTTGG - Intronic
1131485927 15:92820536-92820558 CTTGGAAACAAAAGGGCCCTGGG - Intergenic
1133103733 16:3494085-3494107 CTTGAAAACAGAAGGGAGGAGGG + Intronic
1134541584 16:15071409-15071431 ATTAAAAACAAAAGGCACCTCGG + Intronic
1135055521 16:19228861-19228883 CTTCATAACAAAAGTAAGGTTGG + Intronic
1135578013 16:23600996-23601018 CTTAAATACAAAAAGTAGCTGGG - Intergenic
1135824791 16:25717052-25717074 CTTAAAAAAAAAAGGGAGGCAGG + Intronic
1135899878 16:26447528-26447550 TTTCAGAAAAAATGGGAGCTTGG - Intergenic
1135915962 16:26605707-26605729 TCTCCAAACAAAAGGGAGATTGG + Intergenic
1136263224 16:29095951-29095973 ATTAAAAACAAAAGGCACCTCGG - Intergenic
1137609819 16:49810828-49810850 CTTCAACACAAATGGGACCTGGG + Intronic
1138539879 16:57681563-57681585 ATACAAAACAAAAGTTAGCTGGG + Intronic
1138683388 16:58703835-58703857 CTTAAAAAAAAGGGGGAGCTGGG - Intergenic
1139790637 16:69431474-69431496 CTTAAAAACAAAACAAAGCTGGG + Intronic
1139838183 16:69856845-69856867 ACACAAAACAAAAGGAAGCTGGG - Intronic
1140296389 16:73713065-73713087 TTTCTAAACAAAAGAGAGCATGG - Intergenic
1142138460 16:88462040-88462062 CCCCAAAACACAAGGCAGCTGGG - Intronic
1143191665 17:5044468-5044490 CTTAAAAAGAAAGGGGGGCTGGG - Intronic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1146330148 17:31920233-31920255 CTTCTAAACAATAGTGTGCTAGG + Intergenic
1146781605 17:35679136-35679158 CTTCTATAGAAAAGGAAGCTAGG + Intronic
1146861332 17:36302091-36302113 CATAAAAACAAAAGGTAACTTGG + Intronic
1147091664 17:38106195-38106217 CATAAAAACAAAAGGTAACTTGG + Intergenic
1147105548 17:38214310-38214332 CATAAAAACAAAAGGTAACTTGG - Intergenic
1147648669 17:42049731-42049753 CTGCAGAACAAAAGGCAGGTAGG + Intronic
1148274243 17:46289336-46289358 CTACAAAAAAAAAAGTAGCTGGG - Intronic
1148490275 17:48019014-48019036 CTTCCAAACACAAGGCTGCTAGG + Intergenic
1148542815 17:48493487-48493509 CTTCGCAGGAAAAGGGAGCTCGG + Intergenic
1148711492 17:49684581-49684603 TAATAAAACAAAAGGGAGCTGGG + Intergenic
1150452217 17:65278647-65278669 CTTCTAAGTAAAACGGAGCTGGG - Intergenic
1150922224 17:69495656-69495678 CTTCAAAAAAAAAGGCAGAGTGG - Intronic
1152399398 17:80056316-80056338 CCTCAAAACAAAAAGCACCTCGG + Intronic
1153177098 18:2388811-2388833 CATCAAAAGAAATGGAAGCTGGG + Intergenic
1153627500 18:7035710-7035732 ATTTAAAAAGAAAGGGAGCTGGG - Intronic
1157023930 18:43820070-43820092 CATCAAAACAAAAGGAGGATGGG + Intergenic
1157206793 18:45707479-45707501 CTCAAAAAAAAAAAGGAGCTGGG + Intergenic
1157525615 18:48378135-48378157 TTTCAAAAAAAAAGGAAGGTTGG + Intronic
1157561288 18:48648245-48648267 ATTCAAAGAAAAAGGGAGCATGG + Intronic
1160888844 19:1366256-1366278 CGTCAAAACAAAAGAGATCGTGG - Intronic
1161437353 19:4271733-4271755 CTTAAAAACAACATAGAGCTGGG + Intergenic
1162426139 19:10597264-10597286 GTTCAAAAAAAAAAGGTGCTTGG + Intergenic
1162962169 19:14134880-14134902 CATCAAAAGCAACGGGAGCTTGG + Intronic
1163472742 19:17506812-17506834 CTGCAAGACCAAAGGGACCTTGG + Intergenic
1164144396 19:22502677-22502699 GCTCAAAACAAGATGGAGCTTGG - Intronic
1164714033 19:30378699-30378721 CTTTAGAGCAAAAGGGACCTCGG - Intronic
1164809140 19:31142260-31142282 CTCCAAACCAAAACTGAGCTAGG + Intergenic
1165010396 19:32841903-32841925 CCTCAAAACAAATGAGAGCCAGG + Intronic
1165414295 19:35682630-35682652 CTCTAAAGGAAAAGGGAGCTAGG - Intergenic
1165590753 19:36967400-36967422 CTTAAATACAAAAGTTAGCTGGG + Intronic
1166058270 19:40307254-40307276 CTTAAATACAAAAGTTAGCTGGG - Intergenic
1166767718 19:45262335-45262357 CTCCAAAAGAAAAGGGGGCGGGG + Intronic
1167401942 19:49278694-49278716 CCTCTGGACAAAAGGGAGCTTGG + Intergenic
1167470678 19:49674334-49674356 CTCCAAAAAAAAAGGGAGAGTGG - Intergenic
1167864861 19:52316523-52316545 CTGAAAAACAAAAAGAAGCTGGG - Intronic
925209932 2:2036821-2036843 CTGCAAAACAAAAGGCTGCCAGG - Intronic
928496451 2:31837846-31837868 CTTTAAAGAAAAAGGGGGCTGGG - Intergenic
930295937 2:49553612-49553634 TTTCAAATCAAAAGGGGGCAGGG - Intergenic
930542909 2:52730025-52730047 CTTCAAGGAGAAAGGGAGCTAGG + Intergenic
931994448 2:67826500-67826522 CTTCATAACAAAACTGACCTTGG - Intergenic
932261888 2:70333893-70333915 ATTCACAATAAAAGGGAGTTGGG + Intergenic
932389842 2:71377227-71377249 TATCTCAACAAAAGGGAGCTGGG + Intronic
932570145 2:72934228-72934250 CATCAAAACAAAAGGGAGATTGG - Exonic
933125373 2:78598068-78598090 ATTCCAAACAAAATGGAGGTGGG + Intergenic
933508678 2:83212396-83212418 TTTCAAAAGAAAAAGGAGATAGG - Intergenic
933986863 2:87599392-87599414 CTTAAAAACCAAAGTGACCTGGG - Intergenic
934965297 2:98716320-98716342 TTTCAAAAAACAAGGTAGCTGGG + Intronic
934995443 2:98953978-98954000 CTGCAAAAAAAAAGTGAGCTGGG - Intergenic
935712860 2:105914428-105914450 CTTGAAGACAAATGGGAGTTAGG - Intergenic
936141535 2:109946259-109946281 CTTTAAAAAAAAAAAGAGCTGGG - Intergenic
936178224 2:110244207-110244229 CTTTAAAAAAAAAAAGAGCTGGG - Intergenic
936306981 2:111351416-111351438 CTTAAAAACCAAAGTGACCTGGG + Intergenic
937496187 2:122422655-122422677 CTCCAATTCAAAAGGAAGCTTGG - Intergenic
939001647 2:136742814-136742836 CTACAAAGCAAAAGGGAACTGGG + Intergenic
939541522 2:143500156-143500178 TTTGAAAACAGAAAGGAGCTAGG - Intronic
940982826 2:160022636-160022658 CTTTTAAACCAAAGGCAGCTGGG + Intronic
940990805 2:160094405-160094427 CTTCAAAAATAAATGGTGCTGGG + Intergenic
941012259 2:160313823-160313845 CTTCAAAATAAAGAAGAGCTGGG + Intronic
941101032 2:161295502-161295524 CTTCAAAACATAATTGGGCTGGG - Intergenic
943589422 2:189779412-189779434 CTTAAAAACAAAAGAGTACTTGG + Intronic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
945137573 2:206644658-206644680 TTTCAAAAGACATGGGAGCTGGG - Intergenic
945138585 2:206658529-206658551 CTTAAAAACAAAAGGCAGCTGGG - Intronic
946524962 2:220508388-220508410 CTTCTAAACATAAGAGATCTGGG - Intergenic
946546073 2:220745320-220745342 CTTGAAATCAATAGGCAGCTAGG + Intergenic
947020119 2:225665565-225665587 TCTCAAAAAAAAAAGGAGCTAGG - Intergenic
947525875 2:230876480-230876502 CTCCAAAAAAAAAAGCAGCTTGG - Intronic
948495494 2:238346055-238346077 CTTCAAAACACCAGGGTGTTAGG - Intronic
1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG + Intronic
1169245127 20:4018945-4018967 CCTCAAAACAGCAGGCAGCTAGG + Intergenic
1169422584 20:5471831-5471853 CTTAAAAACAAAACAGAGCAGGG - Intergenic
1169426886 20:5503951-5503973 CTTAAAAACAAAACAGAGCAGGG + Intergenic
1170967273 20:21084758-21084780 GTGCAAAAAAAATGGGAGCTGGG - Intergenic
1173057313 20:39627926-39627948 CTACAAAAGAAAAGGGACTTTGG + Intergenic
1173806791 20:45931300-45931322 CTTCTAAAAAAAAGGGGGGTAGG + Intergenic
1174034130 20:47656486-47656508 CTGCAAATAAAAAGGGAACTGGG - Intronic
1174789312 20:53462954-53462976 CCCCACAACAAAAGGGAGATGGG - Intronic
1176843751 21:13860765-13860787 CAGCAAAACAAAAGGCACCTTGG + Intergenic
1176846425 21:13880085-13880107 CAGCAAAACAAAAGGCACCTTGG + Intergenic
1177656596 21:24024244-24024266 CTGCAAAATAAAAGGGTCCTTGG + Intergenic
1178459602 21:32790740-32790762 CTCCAACAAAAAAGGGAGGTGGG - Exonic
1179604313 21:42503543-42503565 CTTAAAAACAAAATGGAGGCTGG - Intronic
1181533371 22:23529706-23529728 TTTCAATAGAAAAGGGAGCAGGG - Intergenic
1181801984 22:25353778-25353800 CTTTAAAATACGAGGGAGCTGGG - Intronic
1182841740 22:33396234-33396256 CTTCAAAGCAGAAGGGAGGAAGG - Intronic
1182873183 22:33666543-33666565 CTACAAAACAGAAAGGAGGTGGG + Intronic
1183628906 22:39021472-39021494 CTTCAAAAAAAGAGGGAGACTGG + Exonic
1183667282 22:39253250-39253272 CATCAAAACAGGAAGGAGCTGGG - Intergenic
949650682 3:6155565-6155587 CTTTAGAGCTAAAGGGAGCTTGG - Intergenic
949747037 3:7307143-7307165 AGTGAAAACAAAAGGGACCTAGG - Intronic
950364528 3:12473751-12473773 GTTCAAATCAAAATGGTGCTTGG + Intergenic
950658018 3:14449311-14449333 CTTACAAACAAAAGGGACATTGG + Intronic
951416385 3:22428191-22428213 ATTAAAAACAAAAAGGAGTTGGG + Intergenic
951854141 3:27176242-27176264 CTTCAACAAAACAAGGAGCTTGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952711698 3:36438365-36438387 ATTATAAACAAAATGGAGCTGGG + Intronic
952961881 3:38597457-38597479 CTAGAAAACAAAAGTGAGCTGGG - Intronic
953670105 3:44955279-44955301 CTTGAAAAGAAAAGGGAAGTGGG - Intronic
954170586 3:48798955-48798977 GTTCAAAAGAAAAGGGAGGCTGG - Intronic
954309072 3:49750537-49750559 ATACAAAAAAAAAGGTAGCTGGG + Intronic
954393720 3:50281214-50281236 ATTCAAAACAAAAATTAGCTGGG - Intronic
955125114 3:56103485-56103507 TTACACAACAAAGGGGAGCTTGG - Intronic
955413674 3:58672664-58672686 CTTGATAACAAAAGGAAGCCAGG + Intergenic
955805707 3:62731876-62731898 GCTGAAAACAAAAGGGCGCTGGG + Intronic
956212413 3:66815242-66815264 CTTAATAACAAAAGGAGGCTGGG + Intergenic
956479996 3:69663800-69663822 CTTCAGAACAAAAGGCAACTAGG - Intergenic
956643349 3:71435109-71435131 CTTCAAGACAAAAGGGAAGGTGG + Intronic
957127169 3:76176460-76176482 CTTCTACACTAAAGGGAGCCAGG + Intronic
957425055 3:80026935-80026957 CTTAAAAACAAACTTGAGCTGGG - Intergenic
957893172 3:86386375-86386397 TTTCAAAAAGAATGGGAGCTTGG + Intergenic
958796402 3:98710830-98710852 CTTCACATCAGAAGGGTGCTTGG + Intergenic
958985884 3:100779025-100779047 GCTCAAAATAAAAGGCAGCTGGG - Intronic
962132706 3:132698891-132698913 CTCCAAAAAAAAAGGGATTTGGG - Intronic
962683674 3:137825511-137825533 TTTCAAAGAAAAAGGGAGCATGG - Intergenic
962733749 3:138305701-138305723 CTTGGAGACAAAAGGAAGCTAGG - Intronic
962829205 3:139124779-139124801 CTTTAAAATAATAGGGAGGTTGG + Intronic
963106174 3:141649046-141649068 CTTCAAAACAAACCAGGGCTGGG + Intergenic
964002138 3:151787785-151787807 CTGCAAAACAGAAGGGAGGTTGG - Intergenic
964358227 3:155870050-155870072 TTTCCAAAGAAAAGGGAGTTTGG - Intergenic
964873645 3:161341103-161341125 ATTAAAAACAAAAGGAAGCAAGG + Intergenic
965167877 3:165220198-165220220 CCTTTAAGCAAAAGGGAGCTGGG - Intergenic
966662829 3:182433542-182433564 CTTTAAAAAAAATGGGAGGTGGG + Intergenic
966737960 3:183205083-183205105 CTTTAAAACAAAAAACAGCTGGG + Intronic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
967986182 3:195097076-195097098 CTTCAAGACAACAGGGACATGGG - Intronic
968149153 3:196323391-196323413 CAACAAAACAACAGGGAGATAGG + Intronic
968356389 3:198110841-198110863 CTGCAGAACAGAAGAGAGCTGGG + Intergenic
969065739 4:4479065-4479087 CTTCACTACAAAAGGGAATTGGG + Intronic
970533994 4:17010654-17010676 CTTCAAAAGAAATGGCAGCTTGG - Intergenic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
972035386 4:34513439-34513461 CTTCAAGAAAACAGGGGGCTCGG + Intergenic
972126571 4:35774310-35774332 CTTAAAAAAAAAAAGGAACTTGG - Intergenic
972401525 4:38708736-38708758 TTTCAAAACAAAAGACTGCTGGG + Intergenic
972625113 4:40789554-40789576 ATTCAAAATAATAGGGGGCTGGG + Intronic
973686459 4:53375453-53375475 CATAAAAAGATAAGGGAGCTGGG + Intergenic
975961251 4:79908543-79908565 CATAAAAACAAAACAGAGCTAGG + Intronic
976084493 4:81393674-81393696 ATTCAAACCTAAAGGCAGCTGGG + Intergenic
976488070 4:85632727-85632749 TTGCAAAGCAAAATGGAGCTTGG - Intronic
976991587 4:91374096-91374118 CTTCATAACATAAAGGAGCAAGG + Intronic
981110428 4:140928236-140928258 CATTAGAATAAAAGGGAGCTTGG + Intronic
981651881 4:147069531-147069553 CTTCAAAAAATAAGGGATCCAGG - Intergenic
982216734 4:153088755-153088777 AGTAAAAACAAAATGGAGCTGGG - Intergenic
985995135 5:3593510-3593532 CCTCAAAACACCAGGGAGCTGGG - Intergenic
986356783 5:6936533-6936555 CATCAAAACAAGAGGGCCCTTGG - Intergenic
987274748 5:16350532-16350554 AATCCTAACAAAAGGGAGCTGGG - Intergenic
987420874 5:17718808-17718830 CTTAAAAACAATAGTGAGATCGG - Intergenic
987711264 5:21502586-21502608 TTTAAAAAAAAAAAGGAGCTGGG + Intergenic
987913453 5:24180640-24180662 ATTCAAAGGAAAAGGGAGTTTGG + Intergenic
988162272 5:27534148-27534170 CTTTCAAATAAAATGGAGCTTGG + Intergenic
988895961 5:35675313-35675335 CTCCAAAATAGAAAGGAGCTGGG + Intronic
989019454 5:36985318-36985340 CTCCAAAACAAAAGAGTGATGGG + Exonic
991169774 5:63608775-63608797 CTTGATAACAAAAGGGAAATTGG - Intergenic
991454495 5:66788164-66788186 CTTCAGAGAAAAAAGGAGCTGGG + Intronic
991456063 5:66805927-66805949 CTGCAAATTAAAAGGAAGCTTGG - Intronic
991878166 5:71196864-71196886 TTTTAAAAAAAAAAGGAGCTGGG - Intergenic
992936083 5:81706767-81706789 GCTCAAAACAAAACAGAGCTAGG + Intronic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
993706194 5:91173648-91173670 CTTAAAAACAAAAGGTAAATTGG + Intergenic
994706289 5:103210601-103210623 CTATGAAAGAAAAGGGAGCTAGG - Intronic
995140557 5:108730771-108730793 CTTCTAAACAAATGCCAGCTGGG - Intergenic
995214863 5:109583536-109583558 CCTTAAAATAAAGGGGAGCTTGG - Intergenic
995463286 5:112424797-112424819 TTTTAAAAGAAAGGGGAGCTAGG - Intergenic
995941704 5:117593580-117593602 CTTCAAAACAAAAGGAAACAAGG + Intergenic
996093960 5:119378776-119378798 CTTTAAAGCAAAAGGTGGCTGGG + Intronic
998069613 5:139186883-139186905 CTTCAAAAACAAAGGGCTCTGGG + Intronic
998124308 5:139606036-139606058 GTTCAAAAGAAAAGAAAGCTGGG - Intronic
998827913 5:146123607-146123629 CTGCAAATCAAAAGGGAGGGGGG + Intronic
999614146 5:153404538-153404560 CTTCAAGACCCAAAGGAGCTAGG + Intergenic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1000837314 5:166171814-166171836 ATTTAAAAAAAAAAGGAGCTAGG - Intergenic
1001316931 5:170649916-170649938 CTTCATAACAAAAAGAAGTTGGG + Intronic
1002284989 5:178156379-178156401 CTTAAAAAAAAAAGGGGGCCGGG - Intergenic
1003501834 6:6709474-6709496 CTTTAAAACAAAAGAGAGCAAGG - Intergenic
1003685472 6:8298050-8298072 CTTTAAAAAAAAAAGGAGTTGGG - Intergenic
1003864419 6:10350052-10350074 GTTTAAAACAAACGGGAGCTGGG - Intergenic
1004277051 6:14246117-14246139 CTGCAAAACTAAAAGGATCTGGG - Intergenic
1006093122 6:31639863-31639885 CTTCAAAACGAAAGGCAGAAGGG + Intronic
1006656807 6:35602054-35602076 CTTCAAAACAAAATTGCTCTAGG - Intronic
1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG + Intronic
1008151721 6:47960943-47960965 TTTAAAAAAAAAAGGCAGCTAGG - Intronic
1008789581 6:55214060-55214082 ATTGAGAACAAAAGAGAGCTAGG + Intronic
1009017185 6:57919002-57919024 TTTAAAAAAAAAAAGGAGCTGGG - Intergenic
1009892075 6:69697259-69697281 CTTAAAAACATAAAGGAGTTTGG - Intronic
1010373166 6:75135145-75135167 CTTCAAAAAAAAAGGGGGCGGGG + Intronic
1011087607 6:83559969-83559991 CTTCAGAAGTAAAGGGAGCTTGG - Intronic
1011628756 6:89304426-89304448 CTACTAAACAAAAGTTAGCTGGG + Intronic
1011826308 6:91309450-91309472 GTTTAAAACAAAAGAGAGCATGG + Intergenic
1013351327 6:109308649-109308671 CTTCAAAACAATATGGAGGTGGG + Intergenic
1013788522 6:113809945-113809967 GTTCAAAGCTAAAGTGAGCTAGG - Intergenic
1015960803 6:138647367-138647389 CTACAAAACAAAAGCTTGCTCGG + Intronic
1016512304 6:144856934-144856956 CTTCAAAATAAAGGAGAGGTTGG - Intergenic
1017139304 6:151175986-151176008 TTTCAAATCCAAAGGGTGCTGGG + Intergenic
1017680919 6:156862912-156862934 TTTAAAAACAAAAGGCAGGTGGG + Intronic
1018542898 6:164902198-164902220 CTTGAAAACAAAAGCAGGCTGGG + Intergenic
1018569087 6:165188105-165188127 CTTGAAAACGGAGGGGAGCTGGG - Intergenic
1019778602 7:2926792-2926814 CTGCAAGACACAAGGGAGGTGGG + Intronic
1020280719 7:6648701-6648723 CTTCACCTCAAAAGGCAGCTGGG - Intronic
1020352865 7:7241389-7241411 GTTCAAAACAATATGGTGCTGGG - Intronic
1020886164 7:13821256-13821278 CTTCAATACAAAATGGAAATAGG - Intergenic
1021042447 7:15879137-15879159 CTTCAAAGCAAAAGGAGGCCTGG - Intergenic
1023515636 7:40998365-40998387 CTGAAAAAAAAAAAGGAGCTAGG + Intergenic
1023814977 7:43942803-43942825 CTACAAAACAAAAGAGAGACGGG - Intronic
1024092560 7:45956972-45956994 CTTCACAACACAAGGGAGTCAGG - Intergenic
1026224323 7:68427337-68427359 CTCCACAAAAAAAGGGAACTTGG - Intergenic
1026299455 7:69084378-69084400 CTTATAAAAAAAAAGGAGCTGGG - Intergenic
1026636623 7:72088396-72088418 CTTCAAAAGAAAAGGGTTATGGG + Intronic
1027910851 7:84248411-84248433 CTTCACAGCAAAAGGGAACTGGG + Intronic
1029636980 7:101791155-101791177 TTTAAAAACAAGAGGGAGCTGGG - Intergenic
1030413771 7:109214117-109214139 TTTCAAAACAAAAGGAAACATGG + Intergenic
1032129962 7:129219817-129219839 CTTAAAAACAAAAGTAGGCTGGG - Intergenic
1032806523 7:135360419-135360441 CTACAAAACAAAAATTAGCTGGG - Intergenic
1033927304 7:146479153-146479175 ATTCAAAACTAAAGGTAGGTAGG - Intronic
1034142265 7:148832241-148832263 CCTCAAAACAAAAGTTAGCTGGG - Intronic
1034523922 7:151642362-151642384 AAACAAAACAAAAGGTAGCTGGG + Intronic
1034704880 7:153132314-153132336 CTATAAAAAAAAAGGCAGCTAGG + Intergenic
1036084202 8:5595590-5595612 CCTCAGGACAAAAGGGAGATGGG + Intergenic
1036446708 8:8827970-8827992 GTTAGAAAAAAAAGGGAGCTGGG - Intronic
1038444084 8:27591274-27591296 CTTCACAACAACACGGAGATGGG - Intergenic
1039513447 8:38110507-38110529 CTGGAAAAGAAAAGGGATCTGGG + Intronic
1039913813 8:41845020-41845042 TTTCAAAACAAACAGGAACTTGG - Intronic
1040103290 8:43523822-43523844 CGGCAAAACAAAAGTGACCTTGG - Intergenic
1042606395 8:70550811-70550833 CAACAAGACAAAAGGGAGCTTGG - Intergenic
1044325329 8:90851944-90851966 CTTAAAAACAAAATGGGGTTGGG - Intronic
1045514765 8:102849011-102849033 CTTCAACACCACAGGGGGCTGGG + Intronic
1045574474 8:103405110-103405132 CTTCAAAAGACAAGGAAACTGGG + Intronic
1048193346 8:132310328-132310350 CTGCAATGGAAAAGGGAGCTGGG - Intronic
1050664827 9:7923890-7923912 ATTGAAGACAAAAGGGATCTGGG + Intergenic
1050794002 9:9513865-9513887 CCTCAAATAAAAAGGGAGCGTGG + Intronic
1051161720 9:14216119-14216141 CTTCATAACAAAAGATAGGTTGG + Intronic
1055389638 9:75806217-75806239 CAACAAAGCAAAATGGAGCTTGG - Intergenic
1056255292 9:84793211-84793233 TTTCAAAACAAAAGAGAAATTGG + Intronic
1056290765 9:85141563-85141585 CTTCAAGTCCAAAGGCAGCTGGG - Intergenic
1057891474 9:98873257-98873279 CTCAAAAAAAAAAGGCAGCTTGG - Intergenic
1057983477 9:99685797-99685819 CTTCAACACAAAAGTCAACTTGG + Intergenic
1058954573 9:109933627-109933649 CTTCAAAGATAAAGGGAGCTGGG - Intronic
1059206422 9:112471297-112471319 ATTCAAAAGAAATGGGAGTTAGG - Exonic
1060229574 9:121816917-121816939 CATCAAACCAAATGGGAGATTGG + Intergenic
1060525134 9:124316134-124316156 CTACAAAACAAAAGGAAACGTGG + Intronic
1062011863 9:134271607-134271629 CTTCAAAGCAGCAGGGAGGTCGG - Intergenic
1062141634 9:134962237-134962259 CTTCATAATAAATGGGAGGTTGG + Intergenic
1185981613 X:4785908-4785930 TTTAAAAGCAAAATGGAGCTGGG + Intergenic
1186514819 X:10159003-10159025 TTTCAAAGCAAAAGCGGGCTGGG + Intronic
1187187955 X:17005471-17005493 CTTCAAAATAAAAGGGGGAAGGG - Intronic
1187636560 X:21235649-21235671 CTTGTAAACAAAATGGAGTTGGG - Intergenic
1190223747 X:48530048-48530070 CTTAAAAAAAAAAAGGAGGTGGG + Intergenic
1190762212 X:53446152-53446174 CTGGAACTCAAAAGGGAGCTGGG + Intergenic
1191725837 X:64279893-64279915 CTTTCAAACAAATGGGTGCTGGG + Intronic
1192782949 X:74312633-74312655 CTAAAAAACAAAATGGAGCCAGG - Intergenic
1193686665 X:84584874-84584896 CATGAAAACAAATGGGAGGTAGG + Intergenic
1194755394 X:97733165-97733187 CTGTAAAACAAAATGGAGCCAGG + Intergenic
1196127914 X:112119154-112119176 TTTCTAAAGAAAAAGGAGCTGGG + Intergenic
1196206805 X:112949134-112949156 CTTGAAAAAAAATAGGAGCTGGG + Intergenic
1196222402 X:113126593-113126615 CTTCATAAGGAAAGGGAGATTGG + Intergenic
1196616932 X:117776982-117777004 TTTCAAAATAAATGGAAGCTTGG - Intergenic
1196767171 X:119257223-119257245 CTTCAAAACATATGGAATCTGGG + Intergenic
1198982950 X:142420024-142420046 CTTCATAGCAGAAGGGAGATGGG - Intergenic
1199712314 X:150478051-150478073 GTTCAAACCAAAAGGAATCTTGG - Intronic
1202277881 Y:23144648-23144670 CTTGAAAAAAAAAGGGGGGTGGG + Intronic
1202287322 Y:23264119-23264141 CTTGAAAAAAAAAGGGGGGTGGG - Intronic
1202430707 Y:24775987-24776009 CTTGAAAAAAAAAGGGGGGTGGG + Intronic
1202439262 Y:24882176-24882198 CTTGAAAAAAAAAGGGGGGTGGG - Intronic