ID: 1006801020

View in Genome Browser
Species Human (GRCh38)
Location 6:36759694-36759716
Sequence GGTCCACGGAGCCTCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006801020_1006801030 17 Left 1006801020 6:36759694-36759716 CCCACAGGGAGGCTCCGTGGACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1006801030 6:36759734-36759756 AGAAGACAAGAGGGAGTCTCAGG 0: 1
1: 0
2: 2
3: 28
4: 316
1006801020_1006801031 20 Left 1006801020 6:36759694-36759716 CCCACAGGGAGGCTCCGTGGACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1006801031 6:36759737-36759759 AGACAAGAGGGAGTCTCAGGTGG No data
1006801020_1006801027 8 Left 1006801020 6:36759694-36759716 CCCACAGGGAGGCTCCGTGGACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1006801027 6:36759725-36759747 CTACCCAGGAGAAGACAAGAGGG No data
1006801020_1006801026 7 Left 1006801020 6:36759694-36759716 CCCACAGGGAGGCTCCGTGGACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1006801026 6:36759724-36759746 CCTACCCAGGAGAAGACAAGAGG 0: 1
1: 0
2: 1
3: 29
4: 244
1006801020_1006801023 -6 Left 1006801020 6:36759694-36759716 CCCACAGGGAGGCTCCGTGGACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1006801023 6:36759711-36759733 TGGACCAATAGCTCCTACCCAGG No data
1006801020_1006801032 23 Left 1006801020 6:36759694-36759716 CCCACAGGGAGGCTCCGTGGACC 0: 1
1: 0
2: 1
3: 5
4: 138
Right 1006801032 6:36759740-36759762 CAAGAGGGAGTCTCAGGTGGAGG 0: 1
1: 0
2: 0
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006801020 Original CRISPR GGTCCACGGAGCCTCCCTGT GGG (reversed) Intronic
901081277 1:6585657-6585679 GGTCAGCTGGGCCTCCCTGTCGG + Intronic
903445351 1:23419124-23419146 GGTCCAGGGCCCCTTCCTGTGGG + Exonic
904492132 1:30867790-30867812 GGTGCCCGGGGCCTCACTGTGGG - Intergenic
908655427 1:66383110-66383132 GGTCCAGGGTTCCTCTCTGTGGG + Intergenic
915287843 1:154864184-154864206 TTTCCATGGACCCTCCCTGTGGG - Intronic
919924902 1:202187164-202187186 GGAGCAGGGAGCCTGCCTGTGGG - Intergenic
920350676 1:205335973-205335995 GGTCCAGGGAGCCTCCTGGAGGG - Intergenic
1067096905 10:43307496-43307518 GGGCCACGGAGCCTCCCCACTGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067296421 10:44977567-44977589 GCTTCACAGAGCCTCCCTCTGGG + Exonic
1069386122 10:67884780-67884802 GGACGACGCGGCCTCCCTGTCGG - Exonic
1074130184 10:110567377-110567399 GGCCCTCGGAGTCTCCCTCTTGG + Intergenic
1074536052 10:114329301-114329323 GGGCCACGGAGAGTCCCTGCGGG - Intronic
1074825910 10:117215897-117215919 GCTCCCTGCAGCCTCCCTGTGGG + Intergenic
1076010353 10:126983107-126983129 GGTCCAAGGTGCCCCACTGTGGG + Intronic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1079103503 11:17556315-17556337 GGTCCTCCAAGCATCCCTGTTGG - Intronic
1083618527 11:64037730-64037752 GGGCTACGGAGCCTCCATGCTGG - Intronic
1083658602 11:64241890-64241912 GCTCCTCGGAGCCACCCAGTGGG + Exonic
1084154052 11:67303963-67303985 GCTCCACGGGGCCTCCCGGTGGG + Intronic
1084539369 11:69776458-69776480 GGTCCCAGGAATCTCCCTGTGGG - Intergenic
1087166665 11:95012060-95012082 GGTCAACTGGGCCTCCCTCTAGG - Intergenic
1087239362 11:95757707-95757729 GGTCCAGGGTGCCCCACTGTGGG + Intergenic
1088969381 11:114759232-114759254 GGTCCTCGGAGCCTCCTTTAGGG + Intergenic
1090796242 11:130137924-130137946 AGTCCACTGAACGTCCCTGTAGG + Intronic
1091223272 11:133943440-133943462 GGTCCTCGGGGTCTCCCTGGAGG - Intronic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1095709849 12:45276558-45276580 GGTCACAGGAGCCTCCCTGAGGG - Intronic
1096182253 12:49557436-49557458 AGGGCACGGACCCTCCCTGTGGG - Exonic
1103948374 12:124539373-124539395 GGCCCACGGAGCCGGCCAGTGGG - Intronic
1104556107 12:129801065-129801087 GGCCCACAGAGTCTCCCTGATGG + Intronic
1105209675 13:18250343-18250365 GGTCAACGGAGCCCCTCAGTGGG - Intergenic
1112260778 13:97876116-97876138 GGAAGACGGAGCCTCCATGTTGG - Intergenic
1113090266 13:106610624-106610646 GGTGCAGTGAGCCTCCCTGCAGG + Intergenic
1113457936 13:110462216-110462238 GGGGCACTGAGCCTTCCTGTGGG + Intronic
1113468364 13:110527560-110527582 GGGCGACAGAGCCACCCTGTTGG + Intronic
1113790027 13:113023361-113023383 GGGCCCCCGAGGCTCCCTGTGGG - Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1119843503 14:77810893-77810915 GATCCAGGGACCCTTCCTGTGGG - Intronic
1122576565 14:102746725-102746747 GGTCCAGGGAGCCTGCTTCTGGG + Intergenic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1202872663 14_GL000225v1_random:178000-178022 GGTCCCTGGAGCCCCCCTGACGG + Intergenic
1202947478 14_KI270726v1_random:41920-41942 GGTCCCCTCAGCCTCCCTGCAGG - Intergenic
1125373193 15:39000217-39000239 GGTGGGCGGGGCCTCCCTGTGGG + Intergenic
1129543061 15:76366980-76367002 GGTCCACAGAGGAACCCTGTAGG + Intronic
1131932019 15:97453403-97453425 GGTCCAGGGACCCTCCCATTGGG + Intergenic
1136626725 16:31466241-31466263 GGTCCATGGGGACTGCCTGTGGG - Exonic
1139965943 16:70745449-70745471 GGGCCACGGACCTGCCCTGTTGG + Intronic
1140868302 16:79083400-79083422 AGTCAACAGAGCTTCCCTGTTGG + Intronic
1141044402 16:80703587-80703609 AGGCCACAGGGCCTCCCTGTGGG + Intronic
1142123198 16:88397120-88397142 GGGCCACTTAGCCTCCCTGCAGG - Intergenic
1144676080 17:17162563-17162585 GGTGAACAGGGCCTCCCTGTGGG + Intronic
1147978893 17:44262801-44262823 GGTCCCCAGAGCCTCCAGGTGGG + Intronic
1151365540 17:73614058-73614080 GGCCCACTGGGCCTCCCTGCCGG + Intronic
1151460220 17:74249863-74249885 GGGAGACGGAGCCTCACTGTGGG + Intronic
1151460228 17:74249892-74249914 GGGAGACGGAGCCTCACTGTGGG + Intronic
1151814294 17:76463629-76463651 GGTCATCGGAGCCTCCCTGTTGG + Intronic
1152095336 17:78268963-78268985 GGTCCAGGGAATCTCCCTCTTGG - Intergenic
1152339377 17:79715927-79715949 GCTGCACGGAGCCGCACTGTGGG - Intergenic
1159619415 18:70620168-70620190 GGTCCACAGACCCACCCTGCTGG - Intergenic
1160821175 19:1058889-1058911 GGTCCAAGGAGCCACCCAGGGGG + Exonic
1161013530 19:1971350-1971372 GGGCCACGAAGCCTCACTGCCGG + Intronic
1161067956 19:2247806-2247828 GCTCCACCCAGCCTCCCTGCTGG + Exonic
1162016976 19:7851333-7851355 GGTCCAGGAAGGCTCCCTGGAGG + Intronic
1162032635 19:7924072-7924094 GGTCGTCGGAGCCTCCCTCCAGG + Intergenic
1162042351 19:7978483-7978505 GCTCCACGGAGCCTCCTGGCAGG + Intronic
1165132316 19:33640804-33640826 GCTCCACGACGCCTCCCTGCTGG + Intronic
1166016029 19:39980070-39980092 GATCCTCTGAACCTCCCTGTCGG - Exonic
1166808162 19:45499182-45499204 CCTCCCCGGAGCCTCCTTGTAGG - Exonic
927202074 2:20584127-20584149 TGTCCCCAGAGACTCCCTGTAGG + Intronic
928197068 2:29223597-29223619 GATCCAGGGAGGCTTCCTGTAGG - Intronic
931240959 2:60452318-60452340 GGTCCACGGGCCCTCTCTATGGG + Intronic
933157947 2:78994777-78994799 GCTCCATGGAGCCTCACTGGAGG - Intergenic
935717498 2:105952181-105952203 GACCCAGGGATCCTCCCTGTGGG - Intergenic
937358333 2:121212254-121212276 GATCCTCTGCGCCTCCCTGTAGG - Intergenic
940761739 2:157746088-157746110 TGTCCACAGAGCCTTCCTGTGGG + Intronic
946186975 2:217986539-217986561 AGTCCACATAGCCTCCCTCTGGG + Intronic
947965957 2:234281725-234281747 GGACCCCGGAGCCTCCAAGTGGG - Intergenic
948537094 2:238654421-238654443 GGGCCAGGCAGCCTCCCTGCAGG - Intergenic
1171065096 20:22007555-22007577 GGCCCACGGAGCTCCCCAGTTGG - Intergenic
1171169745 20:23005201-23005223 GGTCCACTGGGCTTCCATGTGGG + Intergenic
1173724417 20:45287275-45287297 GGTCAAGGGAGACTCCCTGAGGG - Intergenic
1175466042 20:59191840-59191862 GTCCCAAGGAGCCTCTCTGTCGG - Exonic
1177776650 21:25575445-25575467 GCTCCACGGAGCTCCCATGTAGG + Intergenic
1180243049 21:46524561-46524583 GGTCCAAGGAGCCTCTCTTGGGG - Intronic
1180766591 22:18349056-18349078 GGTCAACGGAGCCCCTCAGTGGG + Intergenic
1180779723 22:18513322-18513344 GGTCAACGGAGCCCCTCAGTGGG - Intergenic
1180812438 22:18770643-18770665 GGTCAACGGAGCCCCTCAGTGGG - Intergenic
1181198596 22:21204890-21204912 GGTCAACGGAGCCCCTCAGTGGG - Intergenic
1181401142 22:22650910-22650932 GGTCAACGGAGCCCCTCAGTGGG + Intergenic
1182439776 22:30356518-30356540 GGTCCGCGGAGCAGCCCCGTCGG - Intronic
1182772862 22:32808405-32808427 GGTCCACCCAGCCTCCCTCTCGG - Intronic
1183275491 22:36894541-36894563 GCTCCAGTGAGCCTCACTGTAGG + Intergenic
1183315534 22:37135066-37135088 GTTCCACAGGGCCCCCCTGTGGG + Intronic
1184423742 22:44396811-44396833 GGACCATGGAGCCTCTTTGTAGG - Intergenic
1184887323 22:47354374-47354396 GGCCCCCAGAGCCTCCCTGATGG + Intergenic
1203228209 22_KI270731v1_random:89947-89969 GGTCAACGGAGCCCCTCAGTGGG + Intergenic
950089830 3:10287746-10287768 CGTCCTCAGTGCCTCCCTGTGGG + Intronic
957021820 3:75136659-75136681 GCCCCATGGAGCATCCCTGTGGG + Intergenic
960144892 3:114190547-114190569 GGTCCACATGGCTTCCCTGTTGG - Intronic
967095412 3:186173645-186173667 GCTCCTCTGAGCCTCCCAGTTGG + Intronic
967319776 3:188184037-188184059 GGACCACGGTACCTCCTTGTGGG + Intronic
969520530 4:7675477-7675499 AATCCACGGTGCCTCCCTGCAGG + Intronic
971360655 4:25935291-25935313 GGTCCACGGACCGTGCCTGGCGG + Intergenic
972762643 4:42122006-42122028 GGCCCACCCAGCCTCCCTGAGGG - Intronic
974402395 4:61424386-61424408 GGTCCAGGGTGCCACCGTGTGGG - Intronic
978195513 4:105967357-105967379 TGCCCACGGAGCAGCCCTGTGGG + Exonic
986200518 5:5574315-5574337 AATCCCCGCAGCCTCCCTGTGGG - Intergenic
986236278 5:5913888-5913910 GGTCCCTGGGGCCTCCCAGTGGG + Intergenic
986685506 5:10272475-10272497 GGTCCACAGACCATCGCTGTGGG - Intergenic
989446951 5:41541432-41541454 GGTCCTCCCAGACTCCCTGTAGG - Intergenic
994788099 5:104188809-104188831 GGTCCAGGGTTCTTCCCTGTGGG + Intergenic
1001530802 5:172460135-172460157 GATCCACAGAGCTTCCCTTTAGG - Intergenic
1004111379 6:12721917-12721939 GGTCCTCGGAGCCTTGCCGTTGG - Intronic
1005992809 6:30914111-30914133 GGTCCCGGGCGCCTCCCCGTGGG + Intronic
1006499860 6:34451212-34451234 GGACCAGGGAGCCTCCCAGAAGG - Intergenic
1006801020 6:36759694-36759716 GGTCCACGGAGCCTCCCTGTGGG - Intronic
1009866270 6:69401457-69401479 GGTCCAAGAAGCCTACCTATGGG - Intergenic
1012373328 6:98531884-98531906 GGTCCAGGGTTCCACCCTGTGGG + Intergenic
1013630849 6:111984433-111984455 GGTCCACTGAGCATCCCTGAAGG + Intergenic
1015004533 6:128263089-128263111 GGCCCAGGGAGCGTTCCTGTGGG - Intronic
1017520661 6:155198940-155198962 AGTCCACGGAGCCTAGCTGCTGG + Intronic
1018812673 6:167308830-167308852 GGTCCAAGGTGCGGCCCTGTGGG + Intronic
1019984926 7:4648593-4648615 ACGCCACGGAGGCTCCCTGTGGG + Intergenic
1021717022 7:23469854-23469876 GGCCCGCGGAGCCACCCGGTGGG + Intronic
1024360139 7:48459636-48459658 GCTCCAGGAAGTCTCCCTGTAGG - Intronic
1026942161 7:74293444-74293466 AGTCCACGGGACCTCCCAGTGGG + Intronic
1031885943 7:127246513-127246535 GTTCCACGGCCTCTCCCTGTGGG - Intronic
1032751051 7:134842006-134842028 GGTCCACTGAGGGTCCCTGGAGG - Intronic
1035648904 8:1249266-1249288 GGGCCACTGGGCCTCTCTGTGGG + Intergenic
1038032005 8:23650834-23650856 TGCCCACGGAGTCTCCCTGATGG - Intergenic
1039471481 8:37815976-37815998 GGGCCAAGGGCCCTCCCTGTCGG - Intronic
1049239707 8:141530988-141531010 GCTCCACGGAGCCTCGTGGTTGG + Intergenic
1049566969 8:143345331-143345353 GGTCCACAGGGCATCCCTGGTGG + Intronic
1049998708 9:1053330-1053352 GGTCCTGGGAGCCCACCTGTCGG - Intronic
1057075523 9:92136345-92136367 GGAGCAGGGAGCCTGCCTGTGGG - Intergenic
1057820075 9:98323508-98323530 TGGCCAAGGAGCCTCTCTGTGGG + Intronic
1060114307 9:120928675-120928697 GGCCCACGGAGACTTCCCGTGGG - Exonic
1060559383 9:124530240-124530262 GGTCCACGGTGGCTGCCTGTTGG - Intronic
1062254086 9:135612965-135612987 GGGCTTCGGAGCCTCCCTGATGG + Intergenic
1203731796 Un_GL000216v2:98543-98565 GGTCCCTGGAGCCCCCCTGACGG - Intergenic
1185822061 X:3215117-3215139 GGAGCACAGAGACTCCCTGTTGG - Intergenic
1187412466 X:19063134-19063156 GGTCCACGGGCTCTCTCTGTTGG + Intronic
1195669488 X:107457608-107457630 GGTCCACACAGCCTCCATATTGG - Intergenic
1201681086 Y:16644213-16644235 GCTCTATGGAGCATCCCTGTGGG - Intergenic