ID: 1006801544

View in Genome Browser
Species Human (GRCh38)
Location 6:36763052-36763074
Sequence GAAACGGATGTGTGCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006801544_1006801548 -1 Left 1006801544 6:36763052-36763074 CCAGCCTTGCACACATCCGTTTC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1006801548 6:36763074-36763096 CTTTGGCTCCCAATTCTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 128
1006801544_1006801549 0 Left 1006801544 6:36763052-36763074 CCAGCCTTGCACACATCCGTTTC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1006801549 6:36763075-36763097 TTTGGCTCCCAATTCTACCTGGG 0: 1
1: 0
2: 0
3: 15
4: 129
1006801544_1006801552 13 Left 1006801544 6:36763052-36763074 CCAGCCTTGCACACATCCGTTTC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1006801552 6:36763088-36763110 TCTACCTGGGACTCCACTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 154
1006801544_1006801554 15 Left 1006801544 6:36763052-36763074 CCAGCCTTGCACACATCCGTTTC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1006801554 6:36763090-36763112 TACCTGGGACTCCACTCCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 173
1006801544_1006801553 14 Left 1006801544 6:36763052-36763074 CCAGCCTTGCACACATCCGTTTC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1006801553 6:36763089-36763111 CTACCTGGGACTCCACTCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006801544 Original CRISPR GAAACGGATGTGTGCAAGGC TGG (reversed) Intronic
900204749 1:1427165-1427187 GAGACGGAGGGGTGCAGGGCGGG - Intronic
902289912 1:15429072-15429094 GACAGGGATGTGTGGAGGGCAGG - Exonic
904581211 1:31545582-31545604 TAAATGGATGTGTGCATGGATGG - Intergenic
905304706 1:37009569-37009591 GAAACGGCAGTGTGTATGGCTGG + Intronic
907414292 1:54303487-54303509 GAACGGGATGAGTGCAAGGAAGG - Intronic
914825274 1:151134882-151134904 AAAACGGAGGTGTGTGAGGCTGG + Intronic
915204048 1:154256105-154256127 GAAAAGAATCAGTGCAAGGCTGG + Intronic
918227112 1:182493937-182493959 GAAACGTATTTGAGAAAGGCAGG + Intronic
919311068 1:195909653-195909675 GAGAGGGATGTCTGGAAGGCTGG - Intergenic
1063392481 10:5659451-5659473 GACACGGCTGTGTGCATGACGGG - Intronic
1064125671 10:12658302-12658324 GAGACGAAGGTGTGCATGGCTGG + Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1069292883 10:66804834-66804856 TAAAGGCATGTTTGCAAGGCTGG + Intronic
1071423358 10:85524250-85524272 GAAAAGAATGTTTGTAAGGCTGG - Intergenic
1075777532 10:124998173-124998195 GAAAGGGATGAGGCCAAGGCCGG + Intronic
1075902022 10:126050842-126050864 GAAAAGGAGAGGTGCAAGGCTGG - Intronic
1076738932 10:132471601-132471623 GAAACGGAGGTCTGCCAGGCAGG + Intergenic
1076983876 11:221708-221730 GAAACCCATGTCTGTAAGGCTGG - Intronic
1077480863 11:2813878-2813900 GAAAGGGATGCGTGGAAGGATGG + Intronic
1077600207 11:3569429-3569451 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
1077765201 11:5151620-5151642 GACACAGATGTGAGCAATGCAGG + Exonic
1078095104 11:8291909-8291931 GAAACAGGTGTGGGCAAGGCAGG + Intergenic
1080434768 11:32229616-32229638 GATAGGTATGTTTGCAAGGCTGG - Intergenic
1080456235 11:32422101-32422123 GAAAAGGGTGTGTGGAAGTCTGG - Intronic
1080773453 11:35363884-35363906 GACACGGAGGTGTACAAGGCAGG + Intronic
1083470835 11:62882739-62882761 GAAACAGATGTGAGCAAGGAAGG - Intronic
1083479088 11:62932316-62932338 GGAAGGTATGTGTGCAGGGCAGG + Intergenic
1084256119 11:67944043-67944065 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
1084554135 11:69865684-69865706 TAAGTGGATGTGTGGAAGGCGGG + Intergenic
1084752760 11:71214920-71214942 GAGGAGGATGTGTGGAAGGCGGG - Intronic
1085113089 11:73905805-73905827 GAAAAGTATGTATTCAAGGCAGG - Intronic
1086581272 11:88402280-88402302 AAAACGGAAGTGTCCCAGGCTGG - Intergenic
1088818384 11:113436806-113436828 AAAACAGATGGGTGCAAGCCAGG + Intronic
1089563461 11:119357429-119357451 AAGACGCAGGTGTGCAAGGCCGG - Intronic
1090233289 11:125125989-125126011 GAGACGGATGTAGGCAGGGCTGG + Intergenic
1091565052 12:1642044-1642066 GAAAAGGGTGTGTGTAAGGTGGG + Intronic
1092089737 12:5794674-5794696 GAGACAAATGTGTGCAAGACCGG - Intronic
1092426352 12:8378789-8378811 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
1097958132 12:65507089-65507111 CAAACGGATGGATGCAATGCAGG - Intergenic
1100481599 12:94984584-94984606 GAAATGGCTGTCTCCAAGGCTGG + Intronic
1102454126 12:113061047-113061069 GAAAGGGGAGTGTGCAAGTCTGG - Intronic
1104635047 12:130433141-130433163 GAAAAGAGTGTGTGTAAGGCCGG - Intronic
1109572344 13:64209607-64209629 GAAACGTCTGTATGCAAAGCTGG - Intergenic
1113028956 13:105972938-105972960 GAAAAAGATATTTGCAAGGCAGG - Intergenic
1113133532 13:107063641-107063663 AAAAGGGATTTGTGCAAAGCAGG + Intergenic
1114651108 14:24285032-24285054 GAAGAGGATGGGTGCAGGGCTGG - Intergenic
1115577425 14:34724913-34724935 CAAACCGATGTGAGAAAGGCTGG - Intergenic
1116706195 14:48304751-48304773 GGAAAGGATTTTTGCAAGGCCGG + Intergenic
1117340581 14:54788298-54788320 GAAAGGGATGTGAGCTAGACAGG + Intronic
1117439545 14:55746715-55746737 GAAAAGAATGTCTGCAAGGCTGG - Intergenic
1118611943 14:67548073-67548095 GAAAATGATGTGAGCAAAGCAGG - Intronic
1119350356 14:73959595-73959617 GAAACGGATCCTTGCCAGGCTGG + Intronic
1120461255 14:84799159-84799181 GAAATGGATCTGTTCAAGGGTGG - Intergenic
1121332111 14:93056151-93056173 GAGACTGGTGTGTGCAAAGCAGG + Intronic
1123774233 15:23562403-23562425 GAATGGAATGAGTGCAAGGCTGG - Intergenic
1124610117 15:31202379-31202401 GCACTGGATGTGTGGAAGGCTGG - Intergenic
1126485437 15:49175273-49175295 GAAAAGAATGTTTGTAAGGCTGG + Intronic
1127619884 15:60723698-60723720 TAAATGGATGTGTGGATGGCAGG - Intronic
1128881336 15:71245865-71245887 GAAAGGCCTGTTTGCAAGGCTGG - Intronic
1129329693 15:74820688-74820710 GGAAGGGCTGTGGGCAAGGCTGG + Exonic
1130959563 15:88650692-88650714 GATAGTGATGTGTCCAAGGCAGG - Intronic
1132783314 16:1640803-1640825 GATAGGGATGAGTGGAAGGCCGG + Intronic
1135804164 16:25527083-25527105 GAAAGGGATGTGTGCAAAGAGGG + Intergenic
1137506971 16:49062661-49062683 GGAAGTGATGTGTGCATGGCAGG + Intergenic
1142006271 16:87690926-87690948 GAAACAGCTGGGGGCAAGGCTGG + Intronic
1142424273 16:89992664-89992686 TAGCCGGATGTGTGCATGGCAGG - Intergenic
1144452089 17:15389642-15389664 GTACCTGCTGTGTGCAAGGCAGG - Intergenic
1144664965 17:17096159-17096181 GAAACAGGTGGGTACAAGGCAGG - Intronic
1144957456 17:19026225-19026247 GATAAAGATGTGTTCAAGGCCGG + Intronic
1144977700 17:19148291-19148313 GATAAAGATGTGTTCAAGGCCGG - Intronic
1145267336 17:21386158-21386180 GAAACCGGTGTCTGCAGGGCTGG + Intronic
1150700069 17:67438897-67438919 GAAACGGATGGGAGCAAAGCAGG - Intronic
1158602118 18:58864081-58864103 GAAACGCATCTGTGCCCGGCCGG - Intronic
1161524088 19:4742870-4742892 GGAACGGAGGACTGCAAGGCTGG - Intergenic
1162218464 19:9156454-9156476 GAAACTGATGTGTGCAAGAGAGG + Intronic
1162311563 19:9910806-9910828 GAGATGGATGTGTGAAAGGATGG + Intronic
1167710310 19:51106461-51106483 GAAAGAGATGGGTGCTAGGCAGG - Intronic
926782838 2:16491056-16491078 GAGAAGGATGTGTGGGAGGCAGG - Intergenic
926860152 2:17300911-17300933 GCAGGGGATGTCTGCAAGGCTGG - Intergenic
932875950 2:75452167-75452189 GAAACAGTTGATTGCAAGGCTGG - Intergenic
933209136 2:79545971-79545993 GAGAAGGATGTGTGTAAGTCAGG + Intronic
937319871 2:120954755-120954777 GATAAGGATGTGTGCAGGCCAGG + Intronic
939064278 2:137463954-137463976 GAAAAGGATGTTTGTAAGGCTGG + Intronic
940299887 2:152165632-152165654 GAGATGGATGTAGGCAAGGCAGG - Intronic
940545298 2:155075704-155075726 GAAGGGGGTGTGTGAAAGGCTGG + Intergenic
942205213 2:173613160-173613182 GAAACGGGTGTCTTTAAGGCGGG - Intergenic
946229874 2:218284616-218284638 GAAACTGCTGTGTGCAGTGCAGG - Intronic
947871246 2:233440003-233440025 GAAATGGCTGTGGGCAGGGCAGG + Intronic
1171199223 20:23227625-23227647 CAAATGGAAGTGTACAAGGCAGG + Intergenic
1174152805 20:48497901-48497923 GAAACTGAAGTGGGCAGGGCAGG + Intergenic
1174379901 20:50149726-50149748 GAACAGCATGTGTGCAGGGCAGG - Intronic
1175665336 20:60853805-60853827 GAAATGGACTTGTCCAAGGCTGG + Intergenic
1175940480 20:62535454-62535476 GAGATGGATGAGTGCCAGGCTGG - Intergenic
1177834983 21:26177945-26177967 GAAAAGAATGTTTGTAAGGCTGG - Intergenic
1178794119 21:35727780-35727802 GAAAGGGATGTGTGCATGGGTGG - Intronic
1182984983 22:34707789-34707811 GAGACAGAGGTGCGCAAGGCAGG - Intergenic
950656865 3:14441900-14441922 GACACAGTTGTGAGCAAGGCAGG + Intronic
952957371 3:38565510-38565532 GAAACGGGTCGGTGCAGGGCAGG - Intronic
957782163 3:84833834-84833856 GAAGTGGCTGTGTGCAAGCCAGG - Intergenic
958430234 3:94031435-94031457 GAAATGGATGATTGCAAGTCTGG + Intronic
960322067 3:116248800-116248822 TAGACTGATGTGTGAAAGGCTGG + Intronic
961283082 3:125778644-125778666 GACAGGGAAGTGTGCAAGGGTGG + Intergenic
962409781 3:135130946-135130968 CAAACAGATGTGTCCAAGACAGG + Intronic
966415810 3:179688290-179688312 GAAAAGGGTGTGGGCAGGGCTGG - Intronic
968427786 4:534813-534835 GAAACGGGTGTGTGGATGGGGGG - Intronic
968869214 4:3233004-3233026 GAGAGGCCTGTGTGCAAGGCTGG - Intronic
968883548 4:3314845-3314867 GAGAGGCCTGTGTGCAAGGCTGG + Exonic
969014631 4:4095778-4095800 GACAGGGAAGTGTGCAAGGGTGG - Intergenic
969739309 4:9012663-9012685 GACAGGGAAGTGTGCAAGGGTGG + Intergenic
969798490 4:9544176-9544198 GACAGGGAAGTGTGCAAGGGTGG + Intergenic
974335613 4:60540741-60540763 GAAAAGGATTTGTGGAAGCCTGG - Intergenic
974631693 4:64499251-64499273 GAAATGGATGGTTGCAGGGCTGG - Intergenic
981652633 4:147076883-147076905 GAAAATGATGAGTGCAAAGCAGG - Intergenic
985183076 4:187286708-187286730 GAAAAGAATGTGTGTAACGCCGG + Intergenic
985934073 5:3081054-3081076 AAAACTGAAGTCTGCAAGGCAGG + Intergenic
987012821 5:13784521-13784543 GAAAAGCATTTCTGCAAGGCTGG - Intronic
988162640 5:27541011-27541033 GAAATGGCTGTTTGTAAGGCTGG + Intergenic
991938531 5:71827709-71827731 GCTAGGGATGTGTCCAAGGCGGG + Intergenic
992998582 5:82357172-82357194 GAAATGCATGTGTGGCAGGCGGG + Intronic
997637404 5:135424023-135424045 GAGACGCATGTGGGGAAGGCTGG - Intergenic
997835097 5:137185740-137185762 AAAACAGATGTGAGCCAGGCTGG + Intronic
998383522 5:141742664-141742686 GAAAAGAATGTGGGGAAGGCTGG + Intergenic
1000706839 5:164523128-164523150 GAAAAGGATGTGTGTGTGGCAGG + Intergenic
1002692812 5:181062263-181062285 GAAATGGTTGAGTCCAAGGCTGG + Intergenic
1003314718 6:5002065-5002087 GAAATGGCTGTGAACAAGGCTGG - Intronic
1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG + Intergenic
1005136176 6:22570946-22570968 CAAAAGGATTTGTGGAAGGCGGG - Exonic
1005601552 6:27431288-27431310 GCAAAGGATGTGTTCAAGACAGG + Intergenic
1006801544 6:36763052-36763074 GAAACGGATGTGTGCAAGGCTGG - Intronic
1015116016 6:129650312-129650334 GAAACGAATATGGGAAAGGCAGG + Intronic
1015325283 6:131917555-131917577 GAAAGGGAGGAGGGCAAGGCTGG + Intergenic
1021927276 7:25545786-25545808 GAAGCAGATGTGATCAAGGCTGG + Intergenic
1024636906 7:51298539-51298561 AAAGCAGATGTGAGCAAGGCAGG + Intronic
1026140137 7:67698757-67698779 GGAAAGAATGTTTGCAAGGCCGG + Intergenic
1034279676 7:149844334-149844356 GAAACGGGCGTGTGGGAGGCGGG + Intronic
1035446074 7:158944060-158944082 GAAACGGATGTTTGGAAGGAAGG + Intronic
1039709775 8:40043863-40043885 GAAAGGAATGTGAGCAGGGCAGG - Intergenic
1040913588 8:52545507-52545529 GAAAGGGGTGTGTGCAGGGAGGG - Intronic
1049219467 8:141422353-141422375 GAGACGGAGGTGTGGCAGGCAGG + Intronic
1049352187 8:142170316-142170338 GAAAGGGATGTGTGCCAGCGTGG + Intergenic
1055559501 9:77508727-77508749 GAAATGGCTGTGTCCAAGACTGG + Intronic
1055972559 9:81926360-81926382 GAAAAGAATGTTTGTAAGGCCGG + Intergenic
1055974312 9:81941432-81941454 GAAAAGAATGTTTGTAAGGCCGG + Intergenic
1055979338 9:81986673-81986695 GAAAAGAATGTTTGTAAGGCCGG + Intergenic
1057171226 9:92964457-92964479 GAGACGGATGTTTTCAAGGCAGG + Intronic
1057818444 9:98313251-98313273 GAAATGGTTGATTGCAAGGCTGG - Intronic
1061460827 9:130737137-130737159 GAAAAGGATTTTTGCAAGGAGGG + Intronic
1185535465 X:858101-858123 GAGCCGGGTGTGTGGAAGGCAGG + Intergenic
1186780140 X:12903901-12903923 GAAAGGGCTGTGTCCAGGGCTGG + Intergenic
1187159141 X:16748186-16748208 GAAAAGCATGTGTGCAGGGGAGG + Intronic
1188307184 X:28572575-28572597 AAAAAGGATGTTTGAAAGGCCGG + Intergenic
1188535729 X:31194727-31194749 GAATAGGTTGTGGGCAAGGCAGG + Intronic
1191636792 X:63387089-63387111 GGAGTGTATGTGTGCAAGGCTGG - Intergenic
1195005456 X:100681164-100681186 GCATAGGATCTGTGCAAGGCCGG - Intronic
1195429505 X:104772840-104772862 ATAATGGATGTGTGAAAGGCAGG - Intronic