ID: 1006801839

View in Genome Browser
Species Human (GRCh38)
Location 6:36764799-36764821
Sequence GGAGCTGTTTGCAGAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 508}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006801839_1006801844 2 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801844 6:36764824-36764846 TGATGAGCCGAGGGCTGTACGGG No data
1006801839_1006801840 -8 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801840 6:36764814-36764836 ACAGCTCCTCTGATGAGCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 87
1006801839_1006801847 24 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801847 6:36764846-36764868 GTACAATTGGCCTCCCTGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 98
1006801839_1006801843 1 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801843 6:36764823-36764845 CTGATGAGCCGAGGGCTGTACGG 0: 1
1: 0
2: 0
3: 8
4: 76
1006801839_1006801846 11 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801846 6:36764833-36764855 GAGGGCTGTACGGGTACAATTGG 0: 1
1: 0
2: 0
3: 0
4: 22
1006801839_1006801841 -7 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801841 6:36764815-36764837 CAGCTCCTCTGATGAGCCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 92
1006801839_1006801848 30 Left 1006801839 6:36764799-36764821 CCTGGCTCTCTGCAAACAGCTCC 0: 1
1: 0
2: 2
3: 45
4: 508
Right 1006801848 6:36764852-36764874 TTGGCCTCCCTGCTAGGTTGTGG 0: 1
1: 3
2: 13
3: 39
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006801839 Original CRISPR GGAGCTGTTTGCAGAGAGCC AGG (reversed) Intronic