ID: 1006802164

View in Genome Browser
Species Human (GRCh38)
Location 6:36766152-36766174
Sequence CAGGGTCAGGTTTGGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 835
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 760}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006802151_1006802164 9 Left 1006802151 6:36766120-36766142 CCAGGGACAGGGGAGCTGCCAGG 0: 1
1: 0
2: 8
3: 56
4: 548
Right 1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG 0: 1
1: 0
2: 3
3: 71
4: 760
1006802145_1006802164 22 Left 1006802145 6:36766107-36766129 CCTCCAGGGATGCCCAGGGACAG 0: 1
1: 0
2: 5
3: 47
4: 425
Right 1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG 0: 1
1: 0
2: 3
3: 71
4: 760
1006802150_1006802164 10 Left 1006802150 6:36766119-36766141 CCCAGGGACAGGGGAGCTGCCAG 0: 1
1: 0
2: 3
3: 42
4: 392
Right 1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG 0: 1
1: 0
2: 3
3: 71
4: 760
1006802156_1006802164 -9 Left 1006802156 6:36766138-36766160 CCAGGGTCCCACAGCAGGGTCAG 0: 1
1: 0
2: 6
3: 56
4: 422
Right 1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG 0: 1
1: 0
2: 3
3: 71
4: 760
1006802148_1006802164 19 Left 1006802148 6:36766110-36766132 CCAGGGATGCCCAGGGACAGGGG 0: 1
1: 0
2: 8
3: 52
4: 481
Right 1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG 0: 1
1: 0
2: 3
3: 71
4: 760

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006802164 Original CRISPR CAGGGTCAGGTTTGGGGAGG TGG Intronic
900105209 1:978167-978189 CAGGGTTAGGGTGGGGCAGGCGG - Intronic
900157404 1:1208782-1208804 GGGCGCCAGGTTTGGGGAGGAGG + Intergenic
900436675 1:2634337-2634359 CAGGGCCAGCCTTGGGGAGTCGG - Intergenic
900550096 1:3250302-3250324 CAAGTTCAGGTGTGGCGAGGTGG - Intronic
900581895 1:3413513-3413535 CAGGGCTAGGCTTGGGGAGGGGG + Intronic
900618618 1:3576869-3576891 CAGGGCCAGGTGTGCGGGGGTGG - Intronic
900647844 1:3717154-3717176 CACGGGCAGGTTTGGGCAGGAGG - Intronic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
901040568 1:6360577-6360599 CAGGGCCTGTTTTGGGGAGAAGG - Intronic
901216652 1:7558995-7559017 CAGGGTCACTTTGGGAGAGGAGG + Intronic
901295376 1:8157099-8157121 CAGAGGAAGGTGTGGGGAGGGGG - Intergenic
902309289 1:15568579-15568601 CAGGGCCGGGATTGGGGAAGGGG - Exonic
902580589 1:17405078-17405100 CAGGGGCAGGCTGGGGGAGCAGG + Intergenic
902822105 1:18949705-18949727 CACGGTCATGTGTGGGGACGTGG + Intronic
903007041 1:20305650-20305672 CAGGGGAAGGTTTGGAGAGGTGG + Intronic
903041357 1:20533166-20533188 CTGGGGCAGGAGTGGGGAGGTGG + Intergenic
903173912 1:21569611-21569633 CAGGGGCTGTTGTGGGGAGGAGG - Intronic
903390369 1:22959636-22959658 CATGGTCAGGGTTGGGGGGATGG + Intronic
903469114 1:23573084-23573106 GGGAGTCAGGGTTGGGGAGGGGG - Intergenic
904005928 1:27363257-27363279 CTGGGTCGGGGTGGGGGAGGTGG - Intronic
904229180 1:29053163-29053185 CAGGGTCAGGTTGCAGAAGGTGG + Exonic
904433381 1:30479331-30479353 AGGGGTCAGCTGTGGGGAGGTGG - Intergenic
904464041 1:30697642-30697664 TAGGGTGGGGGTTGGGGAGGAGG - Intergenic
904624017 1:31792185-31792207 CAGGGTCTGGTATGGGGACTAGG + Intronic
905296089 1:36955277-36955299 AAGGGGCAGGTGTGGGGCGGTGG + Intronic
905382448 1:37572623-37572645 CAGGGTAAGGTATGGGGGAGAGG - Intronic
905482502 1:38271288-38271310 CAGCCTCAGGTGTGGGGATGGGG - Intergenic
905809673 1:40902784-40902806 CAGGGATAGGTTTGGGGACAAGG + Intergenic
905819535 1:40979239-40979261 TCGGGGCAGGTGTGGGGAGGAGG + Intergenic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
906190127 1:43893558-43893580 AGGGGACAGGCTTGGGGAGGAGG - Intronic
906224950 1:44114026-44114048 CATTGTAAGGTTGGGGGAGGAGG + Intergenic
907305964 1:53513326-53513348 TGTGGTCAGGTTTGGGGATGAGG - Intronic
907310660 1:53537180-53537202 CAAGCTCTGGCTTGGGGAGGGGG + Intronic
907886009 1:58592980-58593002 CAGGGATAGGTATGGGAAGGGGG - Intergenic
908867222 1:68562589-68562611 CAGGGTCGGGTGTGGTGTGGTGG - Intergenic
910784631 1:90983087-90983109 TAGTTTCAGGTATGGGGAGGAGG - Intronic
912103600 1:106242362-106242384 CAGGGACTGTTTTGGGGTGGGGG + Intergenic
912495173 1:110087015-110087037 TCAGGTCAGGTTTGGGGAGGGGG - Intergenic
912529195 1:110307887-110307909 AAGGGCCAGGAGTGGGGAGGGGG - Intergenic
913133393 1:115863583-115863605 CAGGTAAAGGTTTGGGGATGTGG + Intergenic
913675930 1:121140083-121140105 CAGGGCGAGGTATGGGGAAGGGG - Intergenic
913688028 1:121252641-121252663 CAGGGTGTGGATTGGGGTGGTGG + Intronic
914027826 1:143928023-143928045 CAGGGCGAGGTATGGGGAAGGGG - Intergenic
914039885 1:144040281-144040303 CAGGGTGTGGATTGGGGTGGTGG + Intergenic
914149574 1:145027639-145027661 CAGGGTGTGGATTGGGGTGGTGG - Intronic
914848026 1:151293471-151293493 TAGGGGCAGGAATGGGGAGGAGG + Intronic
914928564 1:151909556-151909578 CAGGGCGGGGCTTGGGGAGGAGG + Exonic
914955663 1:152159807-152159829 CATGGTCAGTTTTGGGGATGAGG + Intergenic
915206102 1:154271577-154271599 CAAGGTCTGGCTTGGGGATGGGG + Intergenic
915493912 1:156267582-156267604 CAGGCTGAGGTTGGGTGAGGAGG + Exonic
915519225 1:156431488-156431510 GAGGAGCAGGTTTGGGGAAGAGG + Intergenic
916595593 1:166239727-166239749 CAGGGACAGTTGTGGGGTGGGGG - Intergenic
916720956 1:167484421-167484443 CAAGGTCAAGTTTCTGGAGGAGG + Intronic
919219365 1:194606692-194606714 CAGGGCCTGTTTTGGGGTGGTGG - Intergenic
919741273 1:200982897-200982919 CAGGAACAGGTCTGGAGAGGGGG + Intronic
919753124 1:201050564-201050586 CAGGGTTAGGGTGGGGGAGCTGG + Intronic
919847614 1:201651400-201651422 GAGGGGCAGGAGTGGGGAGGAGG + Intronic
920056023 1:203192415-203192437 CAGGGCGAGGTATGGGGAAGGGG + Intergenic
920192093 1:204200201-204200223 CAGGGCCAGGTGTGAGGATGTGG - Intronic
920313359 1:205061329-205061351 CAGCGTCAGCTTTGAGGATGAGG + Exonic
920435090 1:205942333-205942355 CAGGGCCAGGATGAGGGAGGTGG + Intronic
920463300 1:206158920-206158942 CAGGGCGAGGTATGGGGAAGGGG - Intergenic
920475350 1:206271140-206271162 CAGGGTGTGGATTGGGGTGGTGG + Intronic
921031603 1:211339526-211339548 CAGGCTCAGTTGTGGGGTGGGGG + Intronic
921076200 1:211702057-211702079 GAGGAGCAGGTCTGGGGAGGAGG + Intergenic
921292484 1:213671359-213671381 CAGGGGCTGGGGTGGGGAGGTGG + Intergenic
922482025 1:225945635-225945657 CAGGGTCGGGTCTGGGCAGGGGG + Intergenic
922706198 1:227791653-227791675 CAGGGTTAGGGTTGGGGCGGTGG - Intergenic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923890735 1:238212628-238212650 CATGGACAGGGTTGGGGTGGGGG - Intergenic
924057650 1:240139719-240139741 CAGGCTGAGGTTTGGAGACGAGG + Intronic
924836579 1:247654269-247654291 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1063267360 10:4468589-4468611 CATGGCCTGGTGTGGGGAGGTGG - Intergenic
1063664146 10:8051681-8051703 CAGGATCAGCTTTGTGGCGGTGG + Intergenic
1063830105 10:9942741-9942763 CAGGGTCTGCTTTGGGGAAATGG - Intergenic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1064179406 10:13101118-13101140 CAGGCCCAGTTTTGGGGCGGGGG + Intronic
1064417014 10:15158801-15158823 CAGGGTCAGGTTTTTGGTGAGGG + Intronic
1065828684 10:29595285-29595307 CAAGGACAGGGTTGGGCAGGTGG + Intronic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1067965715 10:50910424-50910446 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1068294742 10:55055513-55055535 CAGGGTGAGGTTGGGTGAGGTGG + Intronic
1068870546 10:61939027-61939049 AAAAGTCATGTTTGGGGAGGAGG + Intronic
1069510220 10:69036544-69036566 CATGGACATCTTTGGGGAGGTGG + Intergenic
1069536406 10:69256885-69256907 CAGGGTTAGGGTTGTGGAGGTGG + Intronic
1069623618 10:69853017-69853039 CGGGGGGAGGTATGGGGAGGGGG + Intronic
1069921926 10:71820666-71820688 CAGGGTTCATTTTGGGGAGGAGG + Intronic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1069952010 10:72025505-72025527 CAGGATCAGGGTTGCGAAGGAGG + Intergenic
1070630203 10:78079335-78079357 CAGGGGCAGGTGTGGGGGTGGGG + Intergenic
1071275416 10:84049729-84049751 AAGGTTCAGCTTAGGGGAGGAGG + Intergenic
1071516189 10:86299488-86299510 CAGGGCCTGTTGTGGGGAGGGGG - Intronic
1072246530 10:93548590-93548612 TAGGGTCAGGGTTGGGGAGAGGG - Intergenic
1072378956 10:94847230-94847252 CAGGGACTGTTTTGGGGTGGAGG - Intronic
1072857109 10:98959721-98959743 CATGGTCAGATTGGGGGTGGAGG + Intronic
1072887604 10:99292946-99292968 CAAGGAAGGGTTTGGGGAGGCGG - Intergenic
1073454709 10:103629547-103629569 CAAGGTCAGGCTGGAGGAGGTGG + Intronic
1073479479 10:103777436-103777458 GTGGGCCAGGGTTGGGGAGGAGG + Intronic
1074029928 10:109676952-109676974 CAGGGGCATGTCTGGGGAGCTGG + Intergenic
1074100797 10:110353719-110353741 GGGGGTGAGGTTGGGGGAGGGGG - Intergenic
1074185123 10:111094448-111094470 CAGGGTCATGTGTGGGATGGAGG + Intergenic
1074431749 10:113400683-113400705 CATGGTAGGCTTTGGGGAGGGGG - Intergenic
1074942622 10:118249734-118249756 CACAGTCAGGTTTGTGGAGTGGG - Intergenic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075663325 10:124213419-124213441 GAGGGTGAGCTTTGGAGAGGGGG + Intergenic
1075874927 10:125798209-125798231 GAGGGGCAGCTTTGGGAAGGGGG + Intronic
1076071583 10:127494319-127494341 CATGCTCAAGTTTGGGGGGGTGG - Intergenic
1076325123 10:129615270-129615292 CAGGGGCACGTCAGGGGAGGCGG - Intronic
1076402085 10:130190963-130190985 CCGGCCCAGGCTTGGGGAGGCGG - Intergenic
1076494131 10:130885673-130885695 CAAGGTCTTGTTTGGGGTGGAGG - Intergenic
1076572133 10:131439807-131439829 CTGTGTCTGGGTTGGGGAGGAGG + Intergenic
1076935853 10:133567250-133567272 CAGGGTCAAGTTTAGGGTTGGGG + Intronic
1077120183 11:903845-903867 CAGGGTCACGTTGGCGGGGGCGG - Intronic
1077197583 11:1289011-1289033 CAGGGCCAGGTCTGGGGCTGGGG + Intronic
1077681004 11:4239917-4239939 CAGGATCATGATTGGGGATGGGG - Intergenic
1077685290 11:4285358-4285380 CAGGATCATGATTGGGGATGGGG - Intergenic
1077689897 11:4332571-4332593 CAGGATCATGATTGGGGATGGGG + Intergenic
1077708073 11:4507522-4507544 CAGGGTCTGTTGTGGGGTGGGGG + Intergenic
1079460009 11:20670468-20670490 CAGGGTTCCGTGTGGGGAGGGGG + Intronic
1079784914 11:24659408-24659430 CAGGGTCTGTTGTGGGGTGGGGG + Intronic
1080552378 11:33383715-33383737 TTGGGTCAGGTTGGGGGATGTGG + Intergenic
1081753272 11:45527355-45527377 GAAGGTCAAGTATGGGGAGGGGG - Intergenic
1081756790 11:45550317-45550339 AAGGGTCAGATGTGGGGTGGAGG + Intergenic
1081981699 11:47270485-47270507 CGGGTTCAGGTTCGGGGCGGGGG + Intronic
1082618561 11:55393413-55393435 CAGGGTCTGCTGTGGGGTGGGGG - Intergenic
1082874399 11:57973103-57973125 CAGCGTCAGGGCTGGGGTGGAGG - Intergenic
1083025062 11:59543686-59543708 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1083365810 11:62140876-62140898 CAGGGTCAGAAGTGGGCAGGCGG - Intronic
1083696752 11:64448579-64448601 CAAGACCAGGTTGGGGGAGGGGG + Intergenic
1083726233 11:64630103-64630125 CAGGGTCCAGTTTGGGGGTGGGG - Intronic
1083767050 11:64846543-64846565 CAGGATCAGGTTGAGGGAGGAGG + Intergenic
1084177193 11:67429029-67429051 GAGGGTCGTGTTGGGGGAGGGGG + Intronic
1084184441 11:67464271-67464293 CAGGGTCAGTCCTTGGGAGGGGG + Exonic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084269349 11:68020832-68020854 CCGAGTCAGGTCTGGAGAGGAGG + Intronic
1084350008 11:68589965-68589987 CAGGGTCTGGTGTGAGGTGGTGG - Intronic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1085360314 11:75878893-75878915 CAGGGACAGGGAGGGGGAGGGGG + Intronic
1085399801 11:76229061-76229083 GGGGGTGTGGTTTGGGGAGGTGG + Intergenic
1085555866 11:77421139-77421161 CAGGGTGAGATGAGGGGAGGAGG - Intronic
1085698000 11:78722000-78722022 CAGGGTCAGGATGGGGAAAGAGG + Intronic
1087021898 11:93611361-93611383 CATGGACATCTTTGGGGAGGGGG + Intergenic
1087196421 11:95308541-95308563 CAGGGGCTGGGGTGGGGAGGGGG - Intergenic
1088585138 11:111354758-111354780 AAGGGTCAGGATTGGGGCTGCGG - Intronic
1089307640 11:117536508-117536530 CTTGGACAGGTTGGGGGAGGTGG + Intronic
1090121486 11:124033351-124033373 CAGGGCCTGTTTTGGGGTGGGGG + Intergenic
1090403393 11:126463123-126463145 CAGGGCTGGGTTGGGGGAGGGGG + Intronic
1091069485 11:132549853-132549875 TATAGTCAGGTTTGAGGAGGTGG - Intronic
1091452438 12:581634-581656 CAGGGTCTGCTCTGGGGAGAAGG + Intronic
1091934289 12:4423149-4423171 GAGGGTTAGGTTGGGGGTGGTGG - Intergenic
1092237102 12:6817172-6817194 CAGCATCAGCTTAGGGGAGGTGG - Exonic
1092863379 12:12739069-12739091 AAGGGACAGATTTGGGGAGGGGG + Intronic
1093703583 12:22250103-22250125 CAGGGTGGGGTTTTGGGAGTGGG - Intronic
1094155293 12:27332553-27332575 CGGGGCTAGGGTTGGGGAGGAGG - Intergenic
1094409448 12:30153398-30153420 AAGGGTCTGGATAGGGGAGGTGG - Intergenic
1095334277 12:41007611-41007633 TATAGTCAGGTTTGAGGAGGCGG + Intronic
1095334989 12:41013077-41013099 TATAGTCAGGTTTGAGGAGGTGG + Intronic
1095360548 12:41333350-41333372 CAGGTTCAAGTTGGGGGTGGCGG - Intronic
1096000682 12:48127410-48127432 CAGGTTTTGGTTTGGGCAGGTGG - Intronic
1096002592 12:48141874-48141896 CAAGGGCAGGATTGGGGAGAGGG - Intronic
1096393698 12:51249174-51249196 TAGGGTGAGGTGTGGGGAGGGGG - Intronic
1096477123 12:51915134-51915156 CAGGGTGGGGTTGGGGGAGAGGG - Intronic
1096477125 12:51915140-51915162 CAGGGTCAGGGTGGGGTTGGGGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1097145902 12:56939214-56939236 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097151463 12:56982752-56982774 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097182972 12:57181323-57181345 AGGGGTCAGGGTTGGGGAGCTGG - Intronic
1097191260 12:57220661-57220683 CAGGATCAGGCTGTGGGAGGGGG - Intronic
1097710312 12:62910416-62910438 CAGGGGCAGGTATTGGCAGGAGG + Intronic
1097739928 12:63229478-63229500 CATGGAGAGGTTTGGGGAGCAGG + Intergenic
1097831782 12:64232610-64232632 CAGGGGCAGGATTGGGCAGAGGG - Intergenic
1098572648 12:72006377-72006399 AAGGAACAGGGTTGGGGAGGTGG + Intronic
1098633765 12:72756387-72756409 CAGGGTCTGTTGTGGGGTGGGGG + Intergenic
1098723335 12:73929542-73929564 CAGGGCCTGTTTTGGGGTGGGGG + Intergenic
1099574454 12:84362381-84362403 CAAGGTCGGGGTTGGGGCGGGGG - Intergenic
1100109293 12:91218574-91218596 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1100371107 12:93969334-93969356 CATGGGCATATTTGGGGAGGGGG + Intergenic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101052805 12:100881122-100881144 CAGGGACTGTTTTGGGGTGGGGG + Intronic
1101276906 12:103212526-103212548 CAGGTTCAGATTTTGGGGGGAGG + Intergenic
1101898631 12:108774535-108774557 TATAGTCAGGTTTGAGGAGGCGG + Intergenic
1102207344 12:111099505-111099527 CAGGGCAAGTTGTGGGGAGGTGG + Intronic
1102465687 12:113129807-113129829 AAAGGTCAGGTTGGGGGAAGAGG - Intronic
1102627555 12:114247523-114247545 CAGGTTCAGGGCTGGGGATGGGG + Intergenic
1102893731 12:116581945-116581967 CAGGGTGAGGGTGGGGGTGGGGG - Intergenic
1103053769 12:117802661-117802683 AAGTGTCAGGGGTGGGGAGGGGG + Intronic
1103354674 12:120311020-120311042 CAGGGTCAGGCTGGGCGTGGTGG - Intronic
1103691778 12:122780914-122780936 CAGGGTCATGGTTGGGAACGCGG + Intronic
1103731238 12:123029075-123029097 CAGTGTCTAGATTGGGGAGGAGG - Intronic
1103913063 12:124362673-124362695 CTGGGCCAGGTTCTGGGAGGTGG - Intronic
1103913107 12:124362820-124362842 CTGGGCCAGGTTCTGGGAGGTGG - Intronic
1103917865 12:124385270-124385292 GAGGGACAGGTCTGGGGGGGCGG - Intronic
1103950108 12:124545789-124545811 CAGGGTGAGGGTGGGGGTGGGGG + Intronic
1104319215 12:127734796-127734818 CAACGTCTGGTTTGGGGTGGGGG + Intergenic
1104349178 12:128030025-128030047 TATAGTCAGGTTTGAGGAGGCGG - Intergenic
1106065463 13:26344030-26344052 GAGGGTGAGGTTGGGGGAAGGGG - Intronic
1106573091 13:30947892-30947914 CAGGGACAGTTGTGGGGTGGGGG - Intronic
1107442439 13:40440194-40440216 CAGGGTCAGTTATTTGGAGGTGG - Intergenic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1108130763 13:47297640-47297662 CAGGGCCAGTTTGGGGTAGGGGG + Intergenic
1108160171 13:47630980-47631002 CAGGGTCTGTTGTGGGGTGGGGG + Intergenic
1108458770 13:50644024-50644046 CAGGAGCAGGTTTTGGGAGTGGG - Intronic
1108601369 13:51998028-51998050 CAGGGTCAGGTGTGAGGAAAGGG - Intronic
1108696821 13:52909563-52909585 CAGGGGCAGGTTAGGGGAGATGG + Intergenic
1110529573 13:76580449-76580471 CAGGGGCTGTTTTGGGGAGATGG + Intergenic
1113400270 13:109985983-109986005 CAGGGTCAGGCAGTGGGAGGAGG - Intergenic
1113410833 13:110087880-110087902 CAGGGTACTGTTTGGGGTGGGGG - Intergenic
1113677281 13:112215388-112215410 GATGGTCAGGGTTGGAGAGGAGG + Intergenic
1113741548 13:112715405-112715427 GTGGGCCAGGTGTGGGGAGGTGG - Intronic
1113741556 13:112715424-112715446 GTGGGCCAGGTGTGGGGAGGTGG - Intronic
1113741564 13:112715443-112715465 ATGGGCCAGGTGTGGGGAGGTGG - Intronic
1113762547 13:112859601-112859623 AAGGGTCGGGCCTGGGGAGGGGG + Intronic
1113779344 13:112967164-112967186 GAGGGGCAGGGTTGGGGTGGGGG + Intronic
1115045358 14:28986045-28986067 CTGGATGAGGTTTGGGGAGGGGG + Intergenic
1116430037 14:44835952-44835974 CAAGGTGAGGTAGGGGGAGGGGG - Intergenic
1116436091 14:44897125-44897147 CAGGATCAGGTGTGGGGGGCGGG - Intergenic
1117397626 14:55326519-55326541 GAGGAGCAGGTTTGGTGAGGAGG + Intronic
1117844128 14:59893408-59893430 CAGGGTCTGTTGTGGGGTGGGGG + Intergenic
1118327355 14:64790704-64790726 CAGGCACAGGTGTGGGGAAGGGG + Intronic
1118720211 14:68588583-68588605 CAGGGTCAGTTCTGGGGACAGGG + Intronic
1119193952 14:72703156-72703178 CAGGGTGGGGTGGGGGGAGGTGG - Intronic
1120286201 14:82505188-82505210 CAGTGTGAAGTATGGGGAGGGGG - Intergenic
1120478380 14:85018559-85018581 CAGGGTCTGTTGTGGGGTGGGGG - Intergenic
1121429220 14:93874908-93874930 CAAGGTCAGGCTTGGGGACTTGG + Intergenic
1121458539 14:94055250-94055272 GAGGGTCTGGTTTGGGGATGTGG - Intronic
1121544996 14:94756647-94756669 CAGGGTGTGGGGTGGGGAGGCGG - Intergenic
1121594337 14:95148094-95148116 CAGGGTTAGGTATGGAGAAGGGG + Intronic
1121654206 14:95583454-95583476 CAAGTTGAGATTTGGGGAGGGGG + Intergenic
1121732001 14:96193702-96193724 CAGGGCCACGTTTAGGAAGGTGG + Intergenic
1121908888 14:97771117-97771139 CAGAACCAGGCTTGGGGAGGGGG + Intergenic
1122178244 14:99936772-99936794 CAGGGTCAGGTTGGGAGGGGAGG - Intronic
1122286570 14:100655879-100655901 CAGGGATGGGTTTGGAGAGGTGG + Intergenic
1122428061 14:101623172-101623194 CAGGGCCAGGTGCGGGGAGTGGG + Intergenic
1122601433 14:102923699-102923721 CTGGGTCAGTGCTGGGGAGGAGG - Exonic
1122913843 14:104846913-104846935 GAGGGACAGGTTGGGGGAGGAGG + Intergenic
1122955986 14:105071525-105071547 CAGGGCAAGGTATGGGGATGCGG + Intergenic
1123034503 14:105466436-105466458 CGGGGTCAGGCTTGGGGGGGCGG - Exonic
1202918067 14_KI270723v1_random:3295-3317 CAGGGGCAGGGCAGGGGAGGAGG - Intergenic
1202926558 14_KI270724v1_random:31291-31313 CAGGGGCAGGGCAGGGGAGGAGG + Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124257319 15:28154918-28154940 CAGGGCCTGTTTTGGGGTGGGGG - Intronic
1124721410 15:32114397-32114419 CTGGGTCAGGCATGTGGAGGTGG - Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125391319 15:39195895-39195917 CAGGGACAGATTTTGGGGGGTGG - Intergenic
1125548383 15:40525680-40525702 CAGGGTCAGCTCTGAGGAGCAGG - Intergenic
1125828189 15:42693268-42693290 AAGAGTGAGGATTGGGGAGGAGG - Exonic
1126078175 15:44933240-44933262 CAAGGTGAGGTGTTGGGAGGTGG - Intergenic
1126486937 15:49192024-49192046 CAGGGTCAGATTTGGGCAATGGG + Intronic
1126785416 15:52174561-52174583 AAGGGTCTGGCTTGGGGATGAGG + Intronic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1128328028 15:66737750-66737772 CAGCTTCAGGCCTGGGGAGGTGG + Intronic
1128345287 15:66849282-66849304 CAGGTTCAGGTGTGGGGCCGTGG - Intergenic
1128352191 15:66898642-66898664 CAGTGGCAGGTGTGGGGCGGGGG - Intergenic
1128370730 15:67037200-67037222 CTGGGTTAGGTGAGGGGAGGGGG + Intergenic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1129150274 15:73684173-73684195 CAGGGTCAGGCCTGGGGGCGGGG + Intronic
1129656834 15:77530027-77530049 CAGGGTGAGGGTAGGAGAGGTGG + Intergenic
1130049077 15:80468271-80468293 GAGGTTCAGGGTTGGGGAGGAGG - Intronic
1130553971 15:84910014-84910036 CAGGGTCAGGGGTAGGCAGGAGG - Intronic
1130627080 15:85526701-85526723 CAGGGCCAGGCTGGGGGATGGGG - Intronic
1130652891 15:85772380-85772402 CAGGGCCAGGGTGGGGCAGGGGG - Intronic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1131333183 15:91521589-91521611 TATAGTCAGGTTTGAGGAGGCGG + Intergenic
1132294668 15:100726352-100726374 CAGGGGCTGGGTTGGGGTGGGGG + Intergenic
1132372576 15:101308735-101308757 CAAGGGCAGGTGTGGGGAGGGGG - Intronic
1132392208 15:101447286-101447308 CAGGGTCACCTGTGGGGATGTGG + Intronic
1132574452 16:658103-658125 CAGGGTCAGGCTCGGGAGGGAGG - Intronic
1132605146 16:790522-790544 CAGTCTCAGGTCGGGGGAGGAGG + Exonic
1132645311 16:996810-996832 CAGGGTCAGGGCTGGGGCGGGGG + Intergenic
1132709175 16:1258887-1258909 CGGATTCAGGGTTGGGGAGGAGG - Exonic
1132942032 16:2513261-2513283 CAGAGACAGGTGCGGGGAGGGGG + Intronic
1133021943 16:2970553-2970575 CAGGGAGAGGTCTGGGGAGATGG + Intronic
1133129947 16:3670862-3670884 CAGGAGCAGGTCTGGGGAGATGG - Intronic
1134381283 16:13729055-13729077 CAAGGGCTGGTTTGGGGTGGGGG - Intergenic
1134389592 16:13807192-13807214 CAGGGAAAGCTTTGGGGATGAGG - Intergenic
1134755115 16:16660238-16660260 CAGGGCAAGGTATGGGGAGAGGG + Intergenic
1134990948 16:18698935-18698957 CAGGGCAAGGTATGGGGAGAGGG - Intergenic
1135157080 16:20061743-20061765 TAGGGTCAGGCGTGGGGAGGAGG - Intronic
1136071161 16:27788142-27788164 CAGGGTCAGCTTGGGGGATAGGG - Exonic
1136993735 16:35173535-35173557 CAGAGTCAGGTTCGGGAAGTTGG + Intergenic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137026952 16:35486303-35486325 CAGGGCCAGGGTAGGGGAGGAGG - Intergenic
1137269723 16:46895235-46895257 CAGGGTCAGGCCAGGCGAGGTGG + Intronic
1137343370 16:47632112-47632134 TAGGTTTGGGTTTGGGGAGGGGG - Intronic
1138364321 16:56461390-56461412 TAGGGTGAGGTATGGGGAAGGGG - Intronic
1138455414 16:57117894-57117916 CAGAGTGAGGTGCGGGGAGGAGG - Intronic
1138594403 16:58022150-58022172 CAGGGAAAGGTGTGGGGAGAGGG + Intergenic
1139372530 16:66477849-66477871 CTTGGTCAGGAGTGGGGAGGAGG - Intronic
1140112843 16:72018372-72018394 CAGTGTCAGATTTGGGGAATAGG + Intronic
1140387993 16:74559454-74559476 GAGGGTAAGGCTGGGGGAGGAGG + Intronic
1140529337 16:75650214-75650236 GAGTGTAAGGGTTGGGGAGGAGG + Intronic
1140926678 16:79590191-79590213 CCGGGCCAGGTTGGCGGAGGGGG + Intronic
1141028625 16:80569754-80569776 CAGAGTCAGGGTTGGGTCGGGGG + Intergenic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142034272 16:87854079-87854101 CAGGGTCAGGCTGGCGGTGGGGG - Intronic
1142363266 16:89637145-89637167 CAGGGTCGGGGCTGCGGAGGTGG - Intronic
1142433731 16:90044271-90044293 CAGGGTCAGGCTTTGTGGGGAGG - Exonic
1142594439 17:1022691-1022713 CAGGGTGAGGGCTGGAGAGGCGG - Intronic
1142715722 17:1745844-1745866 CAGGATGAGGTTGGGGCAGGTGG - Exonic
1142978576 17:3658986-3659008 GAGGGGAAGGTTTGGGGAAGTGG + Intronic
1143129157 17:4665243-4665265 CAAGGGCAGGGATGGGGAGGTGG - Intergenic
1143671998 17:8403327-8403349 CAGGGGCCGGTTGGGGGATGAGG + Intergenic
1144146199 17:12400602-12400624 CAGGTGCAATTTTGGGGAGGGGG + Intergenic
1144750127 17:17642734-17642756 CATGGCCAGGTTGGGGGTGGGGG - Intergenic
1144776075 17:17785268-17785290 CAGAGACAGGTTTGAGGATGAGG - Intronic
1144874561 17:18390624-18390646 CTGGGGCTGGTTTGGGGTGGAGG - Intergenic
1145061946 17:19739143-19739165 CAGGGTCGGGTTGGGGGCTGGGG - Intronic
1145157670 17:20553797-20553819 CTGGGGCTGGTTTGGGGTGGAGG + Intergenic
1145902114 17:28496067-28496089 CAGGGACTGGGGTGGGGAGGTGG - Intronic
1145910684 17:28540385-28540407 CAGGGCCAGGCTGGGGCAGGTGG - Intronic
1145914552 17:28563960-28563982 CAGTGTTAGGTCTGGGAAGGTGG - Intronic
1146138860 17:30347384-30347406 TAGGGTAAGGTTTGGGGGAGTGG - Intergenic
1146720598 17:35120902-35120924 CAGCTTCAGGGGTGGGGAGGGGG - Intronic
1146835136 17:36104700-36104722 GAGGGCCTGTTTTGGGGAGGGGG + Intronic
1147174743 17:38647851-38647873 TAGGGACAGGTTTGGGATGGGGG + Intergenic
1147186460 17:38715964-38715986 TGGGGGCAGGTTTGGAGAGGAGG - Intronic
1147191335 17:38739771-38739793 CAGGGACAGGGTGGAGGAGGAGG - Intronic
1147325989 17:39669847-39669869 GGGGGTGAGGGTTGGGGAGGAGG + Intronic
1147387089 17:40089127-40089149 GAGGGTGAGGTGTGGGGACGTGG - Intronic
1147580685 17:41625636-41625658 CAGGGCCGGGCTTGGGGTGGTGG - Intergenic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147673253 17:42189055-42189077 CAGGGTCTGCTTTGGGGAAACGG - Intronic
1148047750 17:44754210-44754232 CAGGGTCAGGTCTGATGAGGAGG + Intergenic
1148145930 17:45364870-45364892 CCAGGTCAGGTCTGGGGAGAAGG + Intergenic
1148436833 17:47692171-47692193 CAGGTCCAGATTGGGGGAGGGGG + Intergenic
1148574566 17:48700267-48700289 CAGGGTCTGTTGTGGGGTGGGGG + Intergenic
1148915085 17:50969760-50969782 AAGGGTCAGGTTGGGGAATGGGG - Intronic
1149230694 17:54530929-54530951 CAGGGACTGGTGTGGGGCGGGGG + Intergenic
1149292038 17:55226544-55226566 CAGGGACTGTTTTGGGGTGGGGG - Intergenic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1149572609 17:57684095-57684117 CAGGGGCATGATGGGGGAGGGGG + Exonic
1149772459 17:59332131-59332153 CGGGGCCAGGTTTGGGGCGGGGG + Intronic
1149848600 17:60021850-60021872 CTGGGGCTGGTTTGGGGTGGAGG + Intergenic
1149861569 17:60124674-60124696 CTGGGGCTGGTTTGGGGTGGAGG - Intergenic
1150007651 17:61479648-61479670 CTGGGGCAGGTCTGGGGAAGTGG - Intronic
1150219019 17:63485386-63485408 CATGCTCAGGTTTGGGGGTGGGG - Intronic
1151096276 17:71502953-71502975 CATGGTCAGGTGTGGGTAGAAGG - Intergenic
1151174578 17:72276572-72276594 CAGGGACAGGCTAGGGGATGTGG + Intergenic
1151199066 17:72454408-72454430 CAAGGTCAGGGTTGGGGGTGAGG - Intergenic
1151228463 17:72664389-72664411 CAGTGGCAGCTTTGGGGAAGAGG + Intronic
1151418904 17:73984812-73984834 GAGGGTGAGGTGGGGGGAGGTGG - Intergenic
1151551880 17:74826957-74826979 GGGGGTCAGGGATGGGGAGGAGG - Intronic
1151559270 17:74861850-74861872 GAGTGTCAGGTCTGGGGACGCGG - Intergenic
1151994804 17:77601779-77601801 CAGGGGCAGGATGGGGGCGGAGG + Intergenic
1152139414 17:78527628-78527650 CAGGGGCAGGATTGTGGTGGAGG - Intronic
1152141179 17:78537687-78537709 CAGGGGCAGGTTGGGGCAAGGGG + Intronic
1152862427 17:82703878-82703900 GGGGGTCAGGTTTGAGGTGGGGG - Intergenic
1153028221 18:690069-690091 CAGGGCAAGGTGTGAGGAGGGGG - Intronic
1153310933 18:3676320-3676342 TATAGTCAGGTTTGAGGAGGCGG - Intronic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1153704943 18:7735946-7735968 CAGGGTGGGGTGGGGGGAGGCGG - Intronic
1153875210 18:9364288-9364310 GAGGCTCAGTTTTTGGGAGGAGG + Intronic
1154124375 18:11676591-11676613 AAGGGTCGGGTTTGGCGTGGAGG + Intergenic
1156430199 18:37064538-37064560 CATGGTCATATTTGGGGGGGGGG - Intronic
1156718826 18:40045337-40045359 CCGGGACAGGGGTGGGGAGGGGG - Intergenic
1157289514 18:46399792-46399814 CAGGGCCTGGTGAGGGGAGGAGG - Intronic
1157488424 18:48106110-48106132 CAGGGTGGAGTTTGGGGAGCAGG - Intronic
1157678874 18:49588173-49588195 CCAGGTCAGGTTTGGGAATGGGG + Intronic
1157701604 18:49764365-49764387 CAGGGCCTGGAGTGGGGAGGGGG + Intergenic
1158559944 18:58505318-58505340 GAGGGTGCGGTTGGGGGAGGAGG - Intronic
1158648928 18:59269549-59269571 CCGGCTCAGGGTTGGGGACGCGG - Intronic
1159644520 18:70901593-70901615 GAGGGTGTGGTTGGGGGAGGTGG + Intergenic
1159958536 18:74537599-74537621 CTGGATGAGGTTTGGGGAGCTGG + Intronic
1160325328 18:77941686-77941708 GAGGGTGAGGGGTGGGGAGGTGG - Intergenic
1160749521 19:727345-727367 CAGGGTCAGGATTGAGGTTGGGG - Intronic
1160755446 19:754819-754841 GAGGGCGAGGTTTGGGGTGGAGG + Intronic
1160755462 19:754869-754891 GAGGGTCTGGTTTGGGTTGGAGG + Intronic
1160989317 19:1854115-1854137 CGGGGTGGGGTTTGGGGGGGTGG - Exonic
1161079827 19:2305271-2305293 GGGGGACAGTTTTGGGGAGGGGG - Intronic
1161115770 19:2495656-2495678 CAGGGCCAGGTGTGGGCAGAGGG - Intergenic
1161646164 19:5454778-5454800 CAGGGTCAGGGTGGGGCTGGTGG - Intergenic
1161942612 19:7415197-7415219 CAGGAGCAGGGTTAGGGAGGTGG - Intronic
1161998106 19:7726909-7726931 CAAGGTGAGATTTGGGGAGGCGG - Intergenic
1162099312 19:8330272-8330294 CAGGGGAAGGTCTGGAGAGGTGG + Intronic
1162145665 19:8611085-8611107 AAGGGAGAGGTTGGGGGAGGGGG + Intergenic
1162244892 19:9391612-9391634 CAGTTTCATTTTTGGGGAGGTGG - Intergenic
1162525559 19:11204165-11204187 GAGGGTGGGGTCTGGGGAGGGGG + Intronic
1162531605 19:11239424-11239446 CAGGGCCAGGTGTGGGTGGGGGG - Intronic
1162758545 19:12874650-12874672 CGGGGAGAGCTTTGGGGAGGCGG - Exonic
1162793060 19:13072894-13072916 CTGGGGCTGGTTTGGGGAGAGGG + Intronic
1163008409 19:14410386-14410408 CTGGGTCTGGTCTGGGGTGGGGG - Intronic
1163353499 19:16794594-16794616 CAGGATCAGGTTGGAGAAGGGGG + Intronic
1163578326 19:18123446-18123468 CAGGGTCAGGGCTGGGGTGAAGG - Intronic
1163678896 19:18669405-18669427 CAGGATCTGCTTTGGGAAGGAGG - Exonic
1163724645 19:18915675-18915697 CAGGGTACTGTTTGGGAAGGCGG + Intronic
1163728951 19:18938938-18938960 CAGGGCCAGGCTGGGGGAGGTGG + Intronic
1163733117 19:18961680-18961702 TAGGGGCAGGTTTTGGGACGAGG + Intergenic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1164617001 19:29673233-29673255 CAGAGTCAGGGTTGGGTTGGGGG + Intronic
1164726696 19:30470091-30470113 GAGGGAGGGGTTTGGGGAGGAGG + Intronic
1165124983 19:33587712-33587734 TAGGGTTAGGGTTGGGGAGCAGG + Intergenic
1165376743 19:35448422-35448444 CAGGATCAGGTTTGAGGGGAAGG + Intronic
1165396326 19:35565704-35565726 CAGTGTCAGGTTGGAGTAGGAGG - Intergenic
1165699502 19:37926590-37926612 GTGGCTCAGGCTTGGGGAGGGGG + Intronic
1165803057 19:38564800-38564822 CAGGGTCAGGCTGGGCGCGGTGG - Intronic
1166046624 19:40234108-40234130 GGGGCTCAGGTTTGGGGAGTGGG - Intronic
1166270450 19:41710315-41710337 CAGGGTCAGGTTTACGGGGAGGG - Intronic
1166304415 19:41929505-41929527 GAGGGTCAGGTTGGGCCAGGAGG - Intronic
1166339880 19:42131091-42131113 AAGGGTCAGGGCTGGGGTGGTGG - Intronic
1166353850 19:42215722-42215744 CAGTGGCTAGTTTGGGGAGGGGG - Intronic
1166361806 19:42255629-42255651 CAGGCTCAGGGTTGGGGGGTTGG - Intergenic
1166373992 19:42316788-42316810 CAGGGGCAGGGTTGGGGGGCTGG + Intronic
1166407493 19:42531508-42531530 CTGGCTCAGGTGTGTGGAGGAGG + Intronic
1166774372 19:45303360-45303382 TAGGGTCAGCATTGGGGAGGGGG - Exonic
1166874641 19:45890231-45890253 CAAAGTCTGGGTTGGGGAGGTGG + Exonic
1166956959 19:46471227-46471249 CGGGGCCTGGGTTGGGGAGGAGG - Intronic
1167050102 19:47072617-47072639 CAGGGGGCGGTTTGGGCAGGGGG + Exonic
1167098061 19:47385987-47386009 CAGCGTCAGCTTCTGGGAGGAGG + Intergenic
1167098876 19:47391790-47391812 CAGGGTCGGCTTCCGGGAGGAGG - Intergenic
1167158734 19:47754670-47754692 CAGTGTCAGGGGTGGGTAGGAGG - Intronic
1167476220 19:49702773-49702795 CAGGGTCAGCTTTGGTGTGGGGG + Intronic
1167565946 19:50257239-50257261 CAGGGTCAGTTTTAGGGACCTGG - Intronic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168316987 19:55488811-55488833 CAGGGTCAGGGCTGGGGGGCGGG - Intronic
1168333173 19:55581039-55581061 CAGGGTCCTGTGAGGGGAGGGGG + Intergenic
924958233 2:10487-10509 CGGGGTCGGGTTCGGGGTGGGGG - Intergenic
926121931 2:10245946-10245968 CAGTGGTAGGTTTGGAGAGGAGG + Intergenic
926322287 2:11757373-11757395 AATGGGCAGGTATGGGGAGGTGG + Intronic
926431393 2:12789615-12789637 CAGGGACTGTTGTGGGGAGGGGG - Intergenic
927360309 2:22224622-22224644 CAAGGTGAGATTTGGGCAGGGGG - Intergenic
927446779 2:23169503-23169525 GAGGGTGGGGTTTGGGGTGGTGG + Intergenic
927526128 2:23742542-23742564 CAGGGACAGTTGTGGGGTGGGGG + Intergenic
927714638 2:25343476-25343498 CAGGGTGGGGGTTGGGGAGACGG - Intergenic
927880726 2:26688297-26688319 CAGGGTCAGGCCTGAGAAGGGGG - Intergenic
927955874 2:27207075-27207097 TAGGGGCAGGATTGGAGAGGAGG - Intronic
928100747 2:28436228-28436250 CAAGATCAAGTTTGGGGTGGAGG + Intergenic
928309099 2:30195031-30195053 CAGGGTGAGGTTTGGGAACCTGG - Intergenic
928427795 2:31193080-31193102 CAGGGTGAGGTTGTGGGCGGGGG - Intronic
929553694 2:42910462-42910484 TAGAGTCATCTTTGGGGAGGAGG - Intergenic
929826559 2:45313451-45313473 AAGGGTTAGGATTTGGGAGGAGG + Intergenic
930618582 2:53620694-53620716 CAGGTTGAGGTTTTGGGAGTTGG + Intronic
931781027 2:65579623-65579645 CATGGTCAGGGCTGGGGCGGAGG - Intergenic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932496615 2:72148696-72148718 CGGGGTGGGGTTGGGGGAGGAGG + Intergenic
932534771 2:72581672-72581694 CAGGGGCAGGGTGCGGGAGGTGG - Intronic
932574046 2:72953112-72953134 CACGCGCAGGTTTGGGGTGGGGG + Intronic
932667295 2:73708037-73708059 CAGGGACAGGGATGGGGTGGGGG + Intergenic
932751805 2:74376024-74376046 CAGGGGCTGGTTTGAGGAAGTGG + Intronic
933331868 2:80902570-80902592 TATAGTCAGGTTTGAGGAGGTGG + Intergenic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
935054338 2:99552635-99552657 CTGGGGCAGGGATGGGGAGGTGG + Intronic
935389395 2:102534667-102534689 CAAGGTCAAATTTGGGGAGATGG - Intergenic
935422451 2:102883885-102883907 CTGAGTCAGTTTTGGGGAGTTGG + Intergenic
935949309 2:108314453-108314475 CAGGAGCAGGCTTGGTGAGGCGG + Intergenic
936493969 2:113001634-113001656 CAGGGTTGGGGCTGGGGAGGTGG - Intergenic
936750245 2:115633419-115633441 CAGGGTCTGTTGTGGGGTGGGGG + Intronic
937315240 2:120927992-120928014 CAGGGACAGGGTTAGGCAGGTGG - Intronic
937910749 2:127074399-127074421 CGGGCTCAGGTTTGGTGGGGTGG - Intronic
938807608 2:134821455-134821477 AAGGGTTAGCTTTGGAGAGGAGG - Intergenic
939487653 2:142835817-142835839 CAGGAACAGTTTTGGGGAGGCGG - Intergenic
939881927 2:147640868-147640890 CAAGGTCAGGGTTGGGAACGCGG + Intergenic
940478905 2:154203127-154203149 CAGTGTGAGGCATGGGGAGGAGG + Intronic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
942656303 2:178217604-178217626 TATAGTCAGGTTTGAGGAGGTGG + Intronic
943295092 2:186128307-186128329 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
944601267 2:201305922-201305944 CAGGGCCAGTTGTGGGGTGGGGG + Intronic
945555262 2:211267902-211267924 CAGAGTCTGGTGTGGGGCGGGGG - Intergenic
946024603 2:216664348-216664370 GGGGTACAGGTTTGGGGAGGGGG + Exonic
946043712 2:216803864-216803886 CAGGGTCGGGGTTGTGGCGGGGG + Intergenic
946302180 2:218830716-218830738 CAAGGCCAGTTCTGGGGAGGTGG - Intronic
946497904 2:220214500-220214522 GAGGGTAAGGGTTGGGGAAGAGG - Intergenic
946676161 2:222162077-222162099 TAGGTACAGGTTTGGGGAAGGGG - Intergenic
947152285 2:227128192-227128214 CAGGCTCAGGTAGGGGGAAGAGG - Intronic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
948201215 2:236130842-236130864 CAGGGGCTGGTCTGGGGAGTGGG + Exonic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948844100 2:240675006-240675028 AAGGGGCAGCTTCGGGGAGGAGG + Intergenic
948844119 2:240675076-240675098 AAGGGGCAGCTTCGGGGAGGAGG + Intergenic
948849741 2:240699803-240699825 AAGGGGCAGCTTCGGGGAGGAGG - Intergenic
1168779592 20:477526-477548 CAGGGGCAGGATTGAGGTGGTGG - Intronic
1168796250 20:611803-611825 CAGGCTGGGCTTTGGGGAGGAGG + Intergenic
1169664121 20:8015585-8015607 CAGGTTCAGTGTTGGGGAGCTGG - Intronic
1170665747 20:18384671-18384693 TGGGGAGAGGTTTGGGGAGGTGG - Intronic
1170964940 20:21059809-21059831 GAGGGTCAAATATGGGGAGGAGG - Intergenic
1171296493 20:24021643-24021665 CAGGGCCAGTGTTGGGCAGGGGG + Intergenic
1172191270 20:33063313-33063335 CAGGGGCTGGTTTGGGCATGCGG - Intronic
1172818639 20:37711876-37711898 AGGGGTCAGCTTCGGGGAGGAGG + Intronic
1173729103 20:45316539-45316561 CAAGGTGTGGTTTGGGGACGTGG + Exonic
1173846785 20:46193413-46193435 CAGGCTCAGCTTTGGGCTGGAGG - Intronic
1173852012 20:46224719-46224741 CAGGACTAGGTTGGGGGAGGAGG - Intronic
1174236451 20:49097170-49097192 CAGTGTGAGTTTTGGGTAGGTGG + Intergenic
1174354627 20:49989681-49989703 CAGAGTCAGGCTGGGGGTGGGGG + Intergenic
1174421403 20:50401360-50401382 CAGGGACAGGGATGGGAAGGAGG - Intergenic
1174498092 20:50963638-50963660 CAGGGTGAGGTTTGAGAAGCAGG + Exonic
1174503562 20:51002762-51002784 CAGTGCCAGGCGTGGGGAGGGGG - Intergenic
1174606940 20:51768165-51768187 CTGGGGCAGGGCTGGGGAGGCGG - Intronic
1174658790 20:52192703-52192725 CAGGGAGTGGTTGGGGGAGGAGG - Intronic
1174689089 20:52485140-52485162 CAGGGTCGGGTGTGGGGAATGGG + Intergenic
1176008125 20:62877182-62877204 CAGGGACAGGCTCGGGGAGCTGG - Intergenic
1176091748 20:63321356-63321378 CACTGTCAGGGTTGGGAAGGGGG + Intronic
1176123572 20:63465082-63465104 CAGGCGCAGGTTTGGGGCTGAGG + Intronic
1176666272 21:9690238-9690260 CAGCGCCAGGATTGGGCAGGAGG - Intergenic
1178220004 21:30645339-30645361 CAAGATGAGATTTGGGGAGGGGG + Intergenic
1178427136 21:32487775-32487797 CACGGCAAGGTTTGGGGACGGGG - Intronic
1178631216 21:34263148-34263170 GAGGGTCAGGTTTGAGGGGAAGG - Intergenic
1179117273 21:38505345-38505367 GAGGGTGAGGTGTGGAGAGGGGG - Intronic
1179299690 21:40095527-40095549 CAGGGGCAGGGTAGGGGAAGGGG + Intronic
1179419169 21:41222353-41222375 CAGGGTCAGCTTCGTGGAGAAGG + Intronic
1180161423 21:46000209-46000231 CAGGGCGGGGTTTGGGCAGGAGG - Intronic
1180184843 21:46134413-46134435 CAGGGTCAGGTTTAGGGTCAGGG + Intergenic
1180184848 21:46134431-46134453 CAGGGTCAGGTTTAGGGTCAGGG + Intergenic
1180184876 21:46134521-46134543 GAGGGTCAGGTTTAGGGTGAGGG + Intergenic
1180184887 21:46134557-46134579 GAGGGTCAGGTTTAGGGTGAGGG + Intergenic
1180184901 21:46134605-46134627 CAGGGTCAGGTTTAGGGTCAGGG + Intergenic
1180184925 21:46134683-46134705 GAGGGTCAGGTTTAGGGTGAGGG + Intergenic
1180372652 22:12057179-12057201 CAGGGCCGGTTTTGGGGTGGGGG - Intergenic
1180682621 22:17638878-17638900 CAGGGCCAGGTGAGGGGAGTGGG + Exonic
1180958462 22:19751541-19751563 TGGCGTGAGGTTTGGGGAGGGGG - Intergenic
1181236591 22:21450887-21450909 CAAGGTGAGGTAGGGGGAGGGGG - Exonic
1181466936 22:23115410-23115432 AAGGGTCAGGGTTTGGGAAGGGG + Intronic
1181468091 22:23121181-23121203 CAGCCTCAGGTCTGGGGATGGGG - Intronic
1181487519 22:23241153-23241175 CTGGGGCAGGTTAGGAGAGGAGG - Intronic
1181667810 22:24410508-24410530 TAGTGTCTGGTGTGGGGAGGTGG - Intronic
1181824562 22:25504649-25504671 CAGGAGCATGTTTGGGGAGAAGG - Intergenic
1181864392 22:25843900-25843922 TTGGGTCAGGGTTGGGGACGGGG + Intronic
1182315050 22:29440167-29440189 CACAGTCAGGTATGGGTAGGTGG - Intronic
1182336058 22:29584249-29584271 CAAAGTCAGGTTGGCGGAGGTGG - Intergenic
1182361111 22:29747077-29747099 CAGAGGCAGGTTTGGGGACTAGG - Intronic
1183090964 22:35521698-35521720 CAGGGTCAGGTGTGGTGCCGTGG - Intergenic
1183529852 22:38347450-38347472 CAGGGCCAGGGGTGAGGAGGAGG + Intronic
1183626380 22:39005176-39005198 CAGGGGCAGTTTTGGGGACTGGG + Intergenic
1183812157 22:40266412-40266434 AAGGATCAGGGGTGGGGAGGTGG + Exonic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1184085945 22:42264277-42264299 CGGGGGCAGGGTGGGGGAGGGGG + Intronic
1184098084 22:42327387-42327409 CATTGGCAGGTTGGGGGAGGGGG - Intronic
1184275018 22:43405175-43405197 CAGCATCCTGTTTGGGGAGGGGG - Intergenic
1184732509 22:46378515-46378537 GAGGTGCAGGTTTGGGGGGGAGG + Intronic
1184898412 22:47425963-47425985 CAGAGTCAGGTGGAGGGAGGTGG + Intergenic
1184921947 22:47612325-47612347 CAGGGTCACGTGTTCGGAGGAGG - Intergenic
1185150356 22:49160638-49160660 CAGGGTCATGTCTGGAGAGAGGG - Intergenic
1185260455 22:49858916-49858938 CAGGGGCACGTTTGGGGCGCAGG + Intronic
1185296323 22:50057057-50057079 GAGGGTCAGGTCTGGGGTTGGGG + Intergenic
1185296526 22:50057696-50057718 CGGGGTCAGGTCTGGGTTGGGGG + Intergenic
1185317794 22:50186281-50186303 CCGGGTCAGGTTTGGGGGCCGGG + Intronic
1185335536 22:50269593-50269615 CAGAGTCTGGGTGGGGGAGGGGG - Intronic
949773861 3:7609558-7609580 CAGGCACAGGTATGGGTAGGTGG + Intronic
949862207 3:8515998-8516020 CAGGGTCTGGTTTGGTGCGCTGG - Intronic
949874744 3:8618791-8618813 CCGAGTCAGCTTTGGAGAGGTGG - Intergenic
950019583 3:9777762-9777784 CAGAGACAGTTTTGTGGAGGAGG - Intronic
950522526 3:13505423-13505445 AAGGGGCAGGTTTTGGGGGGAGG + Exonic
950596647 3:13989866-13989888 CAGGGTCTGTTGTGGGGTGGGGG - Intronic
950660346 3:14463419-14463441 CAGGGACAGGGGTGTGGAGGTGG - Intronic
951503141 3:23413034-23413056 CGGGGACAGTTTTGGGGTGGGGG + Intronic
952653481 3:35755314-35755336 CAGACTTAGGTTTGGGAAGGTGG - Intronic
952881431 3:37988315-37988337 CACTGGAAGGTTTGGGGAGGGGG + Intronic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
953416660 3:42724419-42724441 CAGCCTCAGGTCTGGAGAGGGGG - Intronic
953781890 3:45878494-45878516 CAGGGTGAGGCTGGGGGATGGGG + Intronic
953864850 3:46575413-46575435 CTGGGCCAGGTTTTGGGATGGGG - Intronic
953865594 3:46580520-46580542 CATGGTAAGGTATGGGGAGGGGG - Intronic
953927050 3:46987922-46987944 CAGAGTCACGGTGGGGGAGGGGG - Intronic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954389662 3:50261956-50261978 TGGGGTCAGTTTTGGGGAGTGGG - Intergenic
954427349 3:50450340-50450362 CGGGGGCAGGGTAGGGGAGGCGG - Intronic
954632446 3:52054961-52054983 CAGGGGCAGGTTTTTGAAGGGGG + Intronic
954635368 3:52068236-52068258 CTGGCCCAGGCTTGGGGAGGGGG - Intergenic
955832272 3:63016693-63016715 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
956142661 3:66161392-66161414 CAGGGTCAAGATTGGTGAGAGGG - Intronic
957527920 3:81401026-81401048 CAGGGCCTGTTTTGGGGTGGGGG + Intergenic
959761089 3:109966203-109966225 CAGGGACAGTTGTGGGGTGGGGG - Intergenic
959766657 3:110039075-110039097 CAGGGAGAAGTTTGGGAAGGGGG - Intergenic
959902830 3:111679255-111679277 GAGGGTCAGGGTTGGGAAGGAGG + Intronic
961019127 3:123489311-123489333 CAGGGTCTGCGATGGGGAGGAGG + Intergenic
961043251 3:123692322-123692344 CAGGGTCAGCCGTGAGGAGGAGG - Intronic
961452312 3:127007932-127007954 GAGGGTCAGGTTTTCAGAGGTGG + Intronic
961464206 3:127071647-127071669 CAGGGACAGGGTGGGGCAGGTGG + Intergenic
961505304 3:127367050-127367072 AGGGGGAAGGTTTGGGGAGGGGG + Intergenic
961621572 3:128228566-128228588 GAGGGTCAGGGTTGGGGAGTCGG + Intronic
961649370 3:128409851-128409873 CAGGGCCAGGTAGGGTGAGGAGG - Intergenic
963004665 3:140715294-140715316 TATAGTCAGGTTTGAGGAGGCGG - Intergenic
963239015 3:142984415-142984437 AAGGGTCAGGTTCTGGGAGCTGG + Intronic
963972989 3:151450002-151450024 CAGGTTCAGGTTTAAGGGGGAGG + Intronic
964025815 3:152072717-152072739 CAGGTTCTGCTTTGGGGATGAGG - Intergenic
966283957 3:178270884-178270906 CTGGCTCAGGGTTGGGAAGGAGG + Intergenic
968393084 4:208858-208880 CATGATTAGGTTTGGGGAGGAGG + Intergenic
968403333 4:317157-317179 GAGGAGCAGGTCTGGGGAGGAGG + Intergenic
968564990 4:1307316-1307338 CAGGGGCTGGGGTGGGGAGGAGG - Intronic
968577383 4:1374239-1374261 CTGCAGCAGGTTTGGGGAGGTGG + Intronic
968661691 4:1801282-1801304 CAGGGGCAGCTCTGGGAAGGGGG + Intronic
968834012 4:2949620-2949642 GAGGGGCAGGGCTGGGGAGGTGG - Intronic
968858871 4:3150532-3150554 CAGGGGCAGATGTGGGGAGGAGG - Intronic
969029975 4:4204077-4204099 CAGGGTCAAGGTTGAGGATGCGG - Intronic
969214466 4:5711140-5711162 CAGGGGCAGGGCTGGGGCGGGGG + Intergenic
969415565 4:7055712-7055734 CAGGGTCAGCTTTGGGGTTTGGG - Exonic
969518542 4:7662228-7662250 CAGGGTGGGGGTGGGGGAGGGGG - Intronic
969561087 4:7948802-7948824 CTGGGACAGCTTTGGGGAAGAGG - Intergenic
969855375 4:9994907-9994929 CAGGGTCTGGCTTGGGCAGGAGG + Intronic
970127038 4:12826002-12826024 CAGAGGCAGGTTTGGGTATGGGG + Intergenic
970248664 4:14091479-14091501 AAGGGTCAGCTTTGGTGAGGTGG + Intergenic
970628221 4:17912990-17913012 TAGGGTCCGCTCTGGGGAGGAGG + Intronic
972200135 4:36704086-36704108 CAGAGTTAGGATTGGGAAGGAGG - Intergenic
972941259 4:44197408-44197430 CAGGAGCAGATCTGGGGAGGGGG + Intronic
975869272 4:78760187-78760209 CAGGGCCTGTTTTGGGGTGGGGG + Intergenic
976039499 4:80865907-80865929 CAGGGTCTGTTGTGGGGTGGGGG + Intronic
976837808 4:89395184-89395206 CAGGGCCTGTTTTGGGGTGGGGG + Intergenic
976891587 4:90054534-90054556 CATGGTCAAGTCTGGTGAGGGGG - Intergenic
976964644 4:91022154-91022176 CAGGGCCTGGTGTGGGGTGGGGG - Intronic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978659980 4:111114148-111114170 GATGGTAAGGTTTGGGGAGTTGG + Intergenic
981018885 4:140004525-140004547 AAGGGAGGGGTTTGGGGAGGGGG + Intronic
982798408 4:159672811-159672833 TAGGGCAAGGTATGGGGAGGTGG - Intergenic
983706177 4:170662454-170662476 TATAGTCAGGTTTGAGGAGGAGG - Intergenic
983847902 4:172542172-172542194 TATAGTCAGGTTTGAGGAGGCGG + Intronic
985408749 4:189662098-189662120 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
985847264 5:2359742-2359764 CAGGGTCAGGTTTGGGGACTTGG - Intergenic
985947691 5:3199792-3199814 CAGAGTTAGGTATGGGGAAGGGG - Intergenic
985984705 5:3504721-3504743 CAGGGTCACCTGTGGGGTGGTGG + Intergenic
986326856 5:6682213-6682235 AAGGGTCAGGTTAGGGGTGGGGG + Intergenic
986781091 5:11066456-11066478 AGGGGTCAGGGTGGGGGAGGAGG - Intronic
987191277 5:15480867-15480889 CAGGGACAGTGTTGAGGAGGAGG + Intergenic
988395814 5:30696901-30696923 CAGGGCCTGTTTTGGGGTGGGGG + Intergenic
989259595 5:39404232-39404254 CAGGGTCTGTTGTGGGGTGGGGG + Intronic
989625790 5:43428445-43428467 CCAGGTCAGCTATGGGGAGGAGG - Intergenic
992073419 5:73169631-73169653 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
992089864 5:73307288-73307310 CAGGGTCAGATTGGGAGAGGAGG - Intergenic
992980257 5:82162829-82162851 CAGGGGCGGGGGTGGGGAGGAGG + Intronic
993454170 5:88108213-88108235 CAGGGACTGTTGTGGGGAGGCGG + Intergenic
995766883 5:115628173-115628195 CAGGGGCAGGGTTGGGGGAGGGG + Intronic
996809248 5:127495939-127495961 CAGGGGCTGGTTTGGGGTGGGGG + Intergenic
997101670 5:130976058-130976080 CAAGGCCAGGTGTGGGGAGGTGG - Intergenic
997512282 5:134462004-134462026 CAGGGTCAGCTCTGGGGAAAGGG - Intergenic
998173197 5:139884320-139884342 CAGGGACAAGTGAGGGGAGGAGG + Intronic
998570605 5:143253534-143253556 TATAGTCAGGTTTGAGGAGGTGG + Intergenic
998800634 5:145865319-145865341 CAGTGTGAGGTTGGGGGTGGAGG - Intronic
999278221 5:150346655-150346677 CAGGAACAGGTTTGGAGGGGAGG - Intergenic
999325579 5:150641432-150641454 CAGGGTCAGGTGGGGCGGGGTGG - Intronic
999906253 5:156143890-156143912 CGGGGTCTGTTTTGGGGTGGGGG - Intronic
1001054612 5:168438689-168438711 CCTGGTCAGGTTTGGGAAGGTGG - Intronic
1001424195 5:171612820-171612842 CAGGGTCTGGGCTGGGGTGGGGG - Intergenic
1001450077 5:171817848-171817870 CAGGGCCCCGATTGGGGAGGAGG + Intergenic
1001824593 5:174734902-174734924 CAGGGACAGGGATGGGGTGGGGG + Intergenic
1002104495 5:176873466-176873488 CTGGGGCAGGTCTGGGGAGGGGG - Intronic
1002581335 5:180211062-180211084 AAGGGTCAGGTGTGGGGAAAGGG + Intergenic
1002710690 5:181193020-181193042 GAGGGTCAGGTCTGGGGACTGGG - Intergenic
1003491063 6:6621951-6621973 GAGGGTGGGGTTGGGGGAGGAGG + Intronic
1003540290 6:7012610-7012632 CAGAGGCAGGTTTGGAGAGATGG + Intergenic
1003578833 6:7321085-7321107 CAGGGTCAGAATAGGGGAGAGGG + Intronic
1003738661 6:8908392-8908414 CGGGGTCTGTTTTGGGGTGGGGG - Intergenic
1004647261 6:17574224-17574246 CAGGTCCAGGTTTGAGGATGGGG + Intergenic
1004979593 6:21008398-21008420 CAGGGTCAGGCCCGTGGAGGTGG + Intronic
1004988549 6:21110859-21110881 CGGGGACAGGTTTAGGCAGGAGG + Intronic
1005049095 6:21667001-21667023 CAGGGTCAGGGCTAGGGTGGGGG - Intergenic
1005690869 6:28304193-28304215 TGGAGACAGGTTTGGGGAGGGGG - Intergenic
1005885989 6:30098199-30098221 CAGGATCAGGTCTGGGAAGGGGG + Intergenic
1005892279 6:30149818-30149840 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1006269184 6:32950816-32950838 CAGGGTGAGGTTCAGGGAGGTGG + Intronic
1006391076 6:33759026-33759048 CAGAGGCAGGATGGGGGAGGAGG + Intergenic
1006457952 6:34142797-34142819 CAGACGCAGGTTGGGGGAGGAGG + Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1007341575 6:41194200-41194222 GAGGGTCGGGGGTGGGGAGGAGG - Intronic
1007397462 6:41585918-41585940 CAGGCTGAGGTAAGGGGAGGTGG - Intronic
1007516459 6:42416995-42417017 CCTGGTAAGGTTTGGGGTGGAGG - Intronic
1007987444 6:46220993-46221015 CTAGGTTGGGTTTGGGGAGGGGG - Exonic
1008562087 6:52733457-52733479 GGGGGTCAGGTTTAGGGAAGGGG + Intergenic
1009183047 6:60541342-60541364 CAGGGCCTGTTTTGGGGGGGTGG + Intergenic
1009649582 6:66457195-66457217 CTGGGGCATGTTTGGGGTGGGGG + Intergenic
1009721814 6:67481145-67481167 CAGGGACAGTTGTGGGGTGGGGG + Intergenic
1010226109 6:73490850-73490872 CTGGGTCAAGTTGGGGGTGGGGG + Intronic
1011296261 6:85829528-85829550 CAGGGACAGTTGTGGGGTGGGGG - Intergenic
1011464510 6:87641496-87641518 TAGTGTCAGGATGGGGGAGGAGG - Intronic
1012445078 6:99298917-99298939 CAGGGTTGGGGTTGGGGATGGGG - Intronic
1012719879 6:102727608-102727630 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1012971612 6:105737569-105737591 CTGGGTGGAGTTTGGGGAGGGGG + Intergenic
1013293504 6:108738701-108738723 CATAGTCAGGCTTGAGGAGGTGG + Intergenic
1013301134 6:108805727-108805749 CAGGGTCAGGTCAGGTGTGGTGG + Intergenic
1013763002 6:113540067-113540089 CAGGAGCTGGTGTGGGGAGGTGG - Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015185306 6:130408933-130408955 CAGGGTCAGGGAGGGGGTGGTGG - Intronic
1016350556 6:143162786-143162808 CGGGGTCAGACTGGGGGAGGAGG + Intronic
1016758357 6:147711322-147711344 CAGGGTCAGGTTGGGGGATCAGG - Intronic
1016812357 6:148273579-148273601 CAGGGTCAGGCTGGGTGTGGTGG - Intronic
1017643474 6:156516728-156516750 CAGGGGCAGGGTGGGGAAGGAGG - Intergenic
1017690307 6:156957378-156957400 CAGGGTCAGCTTCAGGTAGGAGG + Intronic
1018048778 6:159989288-159989310 CTAGTTCAGGGTTGGGGAGGAGG + Intronic
1018388855 6:163328063-163328085 TATAGTCAGGTTTGAGGAGGCGG + Intergenic
1018673434 6:166198206-166198228 CAGAGTCAGGATGGTGGAGGAGG - Intergenic
1018834600 6:167473536-167473558 CTGGGTCTGGTTTGGGAAAGAGG + Intergenic
1019429281 7:991249-991271 CGGGGTCAGGGTTGGGGTTGGGG - Intergenic
1019599634 7:1874815-1874837 GAGGGGCAGGTATAGGGAGGAGG + Intronic
1020622790 7:10537972-10537994 CAGGCTTTGATTTGGGGAGGAGG + Intergenic
1020686200 7:11298434-11298456 TAGAGTCAGGTTTGAGGAGGCGG - Intergenic
1020706701 7:11552896-11552918 TATAGTCAGGTTTGAGGAGGCGG - Intronic
1022506131 7:30909641-30909663 CAGGGACAGGTGAGGGGAGGAGG + Intergenic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1023405202 7:39826545-39826567 CAGGGCCAGGTTTGGGGAAGGGG - Intergenic
1024297268 7:47855163-47855185 GATGGTCGAGTTTGGGGAGGAGG - Exonic
1024788156 7:52931916-52931938 CAGGGTCTGCTTTTGGGAGGAGG - Intergenic
1025249423 7:57342104-57342126 CAGGGACAGGGATGGGAAGGAGG + Intergenic
1025264504 7:57443593-57443615 CAGGGTCAGGTTTTGGTATCAGG + Intergenic
1025741303 7:64198529-64198551 CAGGGTCAGGTTTTGGTATCAGG + Intronic
1026910171 7:74086952-74086974 TAGGGTCAGGGTTGTGGCGGAGG + Intronic
1027197386 7:76040051-76040073 CAGGCTTAGGTTTGGGGACATGG - Intronic
1028065788 7:86381454-86381476 CAGGGTCTGTTGTGGGGTGGAGG + Intergenic
1028747139 7:94340005-94340027 CAGGGTGAGATTTGGGGGCGGGG - Intergenic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1029168125 7:98610395-98610417 CAGGGTAAGCTTTGTGGAGGGGG + Intergenic
1029254650 7:99261415-99261437 CAGGGTGATGTTAGAGGAGGTGG - Intergenic
1030139460 7:106290209-106290231 TGGGGTCTGGATTGGGGAGGGGG + Intergenic
1030296644 7:107935396-107935418 AATGGTAAGGTTTGGGGATGTGG - Exonic
1030809243 7:113955339-113955361 CAGTGTCAGCTTGGGGCAGGGGG + Intronic
1031971963 7:128071682-128071704 CAGGCTGAGGTTTGTGGAGAAGG + Intronic
1031997507 7:128242238-128242260 AAGGGTGATCTTTGGGGAGGTGG + Intronic
1032091638 7:128914446-128914468 CTGGGAGAGCTTTGGGGAGGAGG + Intergenic
1032189322 7:129754544-129754566 CTGGGGAAGGGTTGGGGAGGGGG + Intronic
1032205492 7:129861411-129861433 CTGGTTCAGGTGTGGTGAGGTGG - Intronic
1032398965 7:131610465-131610487 CAAGCTCAGGTTTGGGGGTGGGG + Intergenic
1032720912 7:134550291-134550313 CAGGGTAAGGGATGGGGATGAGG - Intronic
1032839773 7:135704497-135704519 GAGGGTGCGGTTAGGGGAGGAGG + Intronic
1033430818 7:141288106-141288128 CAGGGACAAATGTGGGGAGGAGG - Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034224689 7:149473633-149473655 CAGCGTTAGGTCTGGGGAGATGG - Exonic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1034493892 7:151409226-151409248 CAGGGTGAGGTCTGGGGGTGGGG - Intronic
1034736437 7:153433258-153433280 TATAGTCAGGTTTGAGGAGGTGG + Intergenic
1035069148 7:156128117-156128139 CAGGGTCAGGTGGGTGGGGGAGG + Intergenic
1035096465 7:156360103-156360125 CAGGGTGAGATAAGGGGAGGTGG - Intergenic
1035212329 7:157337328-157337350 CTGGGTCAGGTCTGGGGCCGGGG + Intronic
1035458253 7:159023480-159023502 CAGGGGCGGGTGTGGTGAGGTGG - Intergenic
1035458337 7:159023804-159023826 CAGGGGCAGGCGTGGTGAGGTGG - Intergenic
1036191386 8:6673838-6673860 CAGGGTGGGGTTGGGGGTGGGGG + Intergenic
1036561371 8:9902881-9902903 CTGCTTGAGGTTTGGGGAGGAGG - Intergenic
1037272367 8:17144062-17144084 CAGTGTCAGGCTGAGGGAGGTGG + Intergenic
1038082450 8:24154332-24154354 CAGGGGCTGGCGTGGGGAGGGGG + Intergenic
1038356011 8:26830141-26830163 CAGGGTCAGCTCTGGGTGGGAGG - Intronic
1038480556 8:27898960-27898982 GAGGGCCAGGTATGGGGATGGGG - Intronic
1038699357 8:29835526-29835548 CAGGGGATGGTGTGGGGAGGAGG - Intergenic
1039333713 8:36567115-36567137 CATGGACATGTGTGGGGAGGGGG - Intergenic
1039385984 8:37135899-37135921 GAGGGTGAGGTTTGGGGATAGGG - Intergenic
1039595356 8:38786645-38786667 CCGAGTGCGGTTTGGGGAGGGGG + Intronic
1040421111 8:47241303-47241325 CAGGGTCAGAGTGGGGGGGGGGG + Intergenic
1040658809 8:49544778-49544800 TAGGGTGAGGTATGGGGAAGGGG - Intronic
1040987614 8:53313714-53313736 GAGGGGCAGGCTTTGGGAGGTGG + Intergenic
1041250532 8:55930100-55930122 CGGGGTCAGGTGGGGGGTGGTGG - Intronic
1041300606 8:56407643-56407665 CAGGGTCAGGGTTGAGGTGGAGG - Intergenic
1041518660 8:58730631-58730653 CAGGGCCTGTTGTGGGGAGGGGG + Intergenic
1042175746 8:66035783-66035805 CAGCCTCATGTTTGGGCAGGAGG + Intronic
1042939756 8:74095849-74095871 CAGGGACAGGTGTGGGCTGGAGG - Intergenic
1043052804 8:75404352-75404374 CAGGGTGAGGGTGGGGGCGGAGG - Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1044039904 8:87354559-87354581 CAGGGACAGTTGTGGGGTGGGGG - Intronic
1044353275 8:91191678-91191700 GAGGTTCTGGTTTGTGGAGGAGG + Intronic
1044457383 8:92403855-92403877 GAAGGTCAGGGTTGGGGAGAGGG + Intergenic
1044820180 8:96150758-96150780 CAGGGTCCTGTTTTGGCAGGGGG + Intronic
1044850835 8:96425853-96425875 CAGGGTAGTGTTGGGGGAGGGGG - Intergenic
1045431902 8:102122954-102122976 CAAGGACAGATCTGGGGAGGAGG - Intronic
1045554990 8:103207102-103207124 CAGGGTCAGGTGTGTGGATCTGG + Intronic
1045585238 8:103527543-103527565 CAGGGCCTGTTGTGGGGAGGGGG - Intronic
1045866787 8:106875536-106875558 CAGGGTCGGTTGTGGGGTGGGGG + Intergenic
1046424591 8:114030307-114030329 CAGGGTCTGTTGTGGGGTGGAGG - Intergenic
1046468736 8:114640270-114640292 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1046728789 8:117703283-117703305 CAGGGTGTGGTGTGGGGAGAGGG - Intergenic
1048052030 8:130827498-130827520 TATAGTCAGGTTTGAGGAGGTGG - Intronic
1048375474 8:133818928-133818950 CAGGGTCAGCTTGGGGTGGGGGG + Intergenic
1048787279 8:138063556-138063578 CAGGGTAGGGTTTGGGGCAGGGG + Intergenic
1048953849 8:139517814-139517836 CAGGGTCAGGTCTCGGGCTGGGG - Intergenic
1049171911 8:141166825-141166847 CAGGGCCAGGGATGGGGAGGGGG + Intronic
1049367690 8:142248668-142248690 CTGGGTCTGGTTTACGGAGGTGG + Intronic
1049419300 8:142509973-142509995 CAGGGCCAGGTCTGTGAAGGAGG + Intronic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049686533 8:143941419-143941441 CAGGGTCAGGAATGGGGCAGGGG + Intronic
1049720113 8:144111797-144111819 CAGGGTCAGGGCTGGGCTGGGGG - Intronic
1051699803 9:19809781-19809803 TATAGTCAGGTTTGAGGAGGTGG - Intergenic
1051925755 9:22322921-22322943 CAGGGTCTGTTGTGGGGTGGGGG + Intergenic
1052796129 9:32925085-32925107 CATGATCAGGTTTTGAGAGGAGG + Intergenic
1053266103 9:36714579-36714601 CAGGCTCAGGGTGGGGGAAGTGG + Intergenic
1053418367 9:37961103-37961125 CAGGGTAAGCTTTGTGGAGGAGG - Intronic
1054827737 9:69590016-69590038 AAGGGTGAGTTTTGGGAAGGAGG - Intronic
1054908508 9:70431862-70431884 AAGGGTAAGGGTGGGGGAGGAGG - Intergenic
1055108933 9:72540522-72540544 TAGTGCCAGGTTTGGAGAGGAGG - Intronic
1055744441 9:79427224-79427246 CAGAGTCCAGTTTGGGGAGTGGG - Intergenic
1055838621 9:80475597-80475619 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1057303379 9:93899183-93899205 CAGAGCCAGGCTGGGGGAGGAGG + Intergenic
1057307164 9:93919212-93919234 AGGGGTCAGGTTAGGGGTGGTGG - Intergenic
1057366564 9:94427585-94427607 GAGGGTGAGGTTTGAGGTGGGGG + Intronic
1057656770 9:96960479-96960501 GAGGGTGAGGTTTGAGGTGGGGG - Intronic
1057797493 9:98169336-98169358 CAGTGTCAGATGTGGGGAGGAGG - Intronic
1057805211 9:98215038-98215060 CAGGGACAGGATTGGATAGGGGG - Intronic
1058703509 9:107620199-107620221 CAGGGCCAGGTCTGGTGAGATGG - Intergenic
1059561379 9:115338215-115338237 TACAGTCAGGTTTGAGGAGGTGG + Intronic
1060664312 9:125423809-125423831 CAGGGCCCTGTTGGGGGAGGTGG + Intergenic
1060726857 9:126011895-126011917 CATGGTCAGGATTGGGGTGGGGG - Intergenic
1060964406 9:127704711-127704733 CAAGGTCAGTGATGGGGAGGGGG - Intronic
1061055949 9:128223013-128223035 CAGGCTCCAGCTTGGGGAGGTGG + Intronic
1061139011 9:128753117-128753139 CAGGGTGGGGTTTGGGGGGCAGG - Intronic
1061349774 9:130054903-130054925 TAGAGACAGGTTTGGGGAGGGGG - Intronic
1061407119 9:130398569-130398591 CAGGGTCAGGTTGGAGGGGCTGG - Intronic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061562866 9:131417614-131417636 CAGGGACAGTTTTGGCAAGGAGG - Intronic
1061836911 9:133335617-133335639 CATGGTGCGGTGTGGGGAGGAGG - Intronic
1061932487 9:133840412-133840434 CAGGGGCAGGAGTGGGGAGTGGG - Intronic
1062137210 9:134935544-134935566 CAGGGTCGGTTTTGGAGAAGGGG + Intergenic
1062182715 9:135199326-135199348 CATGGTCTGGGTGGGGGAGGGGG - Intergenic
1062276335 9:135733276-135733298 CAGGGGCAGGTGTGGGGGGCAGG - Intronic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1203659827 Un_KI270753v1:31523-31545 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
1186110157 X:6246965-6246987 CAGGGCCTGTTTTGGGGTGGGGG - Intergenic
1186334509 X:8572287-8572309 CAGGGCCTGCTTGGGGGAGGTGG - Intronic
1187152854 X:16697155-16697177 CAAGGTCACTTATGGGGAGGAGG - Intronic
1187456436 X:19445229-19445251 CAGGGGCTGTTTTGGGGTGGGGG + Intronic
1188533686 X:31170733-31170755 TAGGGGCAGGTTTGGGGAAGTGG - Intronic
1189694450 X:43649794-43649816 CAGGGACAGTTGTGGGGTGGGGG - Intergenic
1191017047 X:55819809-55819831 TATAGTCCGGTTTGGGGAGGTGG + Intergenic
1191702429 X:64057654-64057676 CAGGGCCCGTTTTGGGGTGGGGG - Intergenic
1192074792 X:67982479-67982501 CAGGGGCATGATGGGGGAGGTGG + Intergenic
1192626330 X:72732569-72732591 CAGGTTCTGGTTTGGGTAAGTGG - Intergenic
1193394766 X:80970481-80970503 CAGGGCCAGTTGTGGGGTGGGGG - Intergenic
1193487708 X:82107452-82107474 CAGGCCCAGGTGTGGAGAGGGGG - Intergenic
1193791442 X:85820065-85820087 TATAGTCAGGTTTGAGGAGGTGG - Intergenic
1193972729 X:88076468-88076490 CAGGATTGTGTTTGGGGAGGGGG + Intergenic
1194371110 X:93073077-93073099 CAGGGTCTGTTTTGGGGTGGGGG - Intergenic
1194432555 X:93827801-93827823 AAGGGTGAGTTTTGGGGAGAAGG - Intergenic
1195094989 X:101493576-101493598 GAGGATCAGGCTTGTGGAGGAGG + Exonic
1195103293 X:101577293-101577315 CAGGGCCTGTTGTGGGGAGGGGG - Intergenic
1195300894 X:103528793-103528815 CAGGGTCAGGAATGGGGCTGGGG + Intergenic
1195450756 X:105009587-105009609 CAGGGCCTGTTTTGGGGTGGGGG + Intronic
1195515890 X:105775302-105775324 TAAGCTCAGGTTTGGGGAGTTGG + Intergenic
1195613756 X:106896522-106896544 CAGGCACAGTTTTGAGGAGGGGG + Intronic
1196794270 X:119489686-119489708 CAGGATTGGGTGTGGGGAGGTGG + Intergenic
1197355323 X:125432235-125432257 TATAGTCAGGTTTGAGGAGGTGG + Intergenic
1198809321 X:140519512-140519534 CATGGTCAGGTTTGTGGATTGGG + Intergenic
1199067185 X:143433290-143433312 AGGGGTAAGGTATGGGGAGGCGG - Intergenic
1199269321 X:145864410-145864432 CAGGATCAGGTTGAGAGAGGTGG + Intergenic
1199824686 X:151487496-151487518 CAGGGTCTGTTGTGGGGTGGGGG - Intergenic
1199834262 X:151573077-151573099 CAGGGGAAGTTTTGGGGTGGGGG + Intronic
1199946105 X:152669479-152669501 TAGGGTCTGCTTTGGAGAGGAGG - Intergenic
1200212287 X:154352115-154352137 CAGGGTGGGGTTGGGGGTGGAGG - Intronic
1200391537 X:155951089-155951111 CAGGGTTGGGTTTGGGGTTGGGG + Intergenic
1200678907 Y:6184971-6184993 CAGGGTCTGTTTTGGGGTGGGGG - Intergenic
1201241868 Y:11965126-11965148 CACAGACAGGGTTGGGGAGGGGG + Intergenic
1201305673 Y:12548363-12548385 CAGGGTCTGTTGTGGGGTGGGGG - Intergenic