ID: 1006803030

View in Genome Browser
Species Human (GRCh38)
Location 6:36771509-36771531
Sequence GGCCCATGGTTAAGTGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006803024_1006803030 7 Left 1006803024 6:36771479-36771501 CCTATACATAAAGCACTTAGAGC 0: 1
1: 1
2: 0
3: 15
4: 117
Right 1006803030 6:36771509-36771531 GGCCCATGGTTAAGTGCTATAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006803030 Original CRISPR GGCCCATGGTTAAGTGCTAT AGG Intronic
904649154 1:31991362-31991384 AGCTCATGGTTAAGTGCCAATGG - Intergenic
909648168 1:77940161-77940183 GGTACATGTTTAAGTGCTACAGG - Intronic
911988947 1:104666432-104666454 GGCCCATGGTCATATGTTATGGG + Intergenic
915328646 1:155094521-155094543 GGCCTCTGCTTAAGTGCTTTTGG - Intergenic
916047087 1:161007991-161008013 GGCCCAAGGTTAAGTGCAAAAGG - Intronic
917796743 1:178538293-178538315 GGCCCATGGTTAAGTATTTGGGG - Intronic
921748325 1:218763610-218763632 GGCCCATGATTAAATGCTGATGG - Intergenic
923764681 1:236882195-236882217 GGTCCATGGCTGAGTGCTGTGGG + Intronic
1062895152 10:1097607-1097629 TGCCCATGGTCCAGTGCTGTGGG + Intronic
1080820114 11:35797622-35797644 AGCCCATGGTTATGGGCTTTTGG - Intronic
1089007364 11:115103514-115103536 GGCCCATGGTTACGTACTCAGGG - Intergenic
1091031126 11:132188824-132188846 AGCCCAGGGTGCAGTGCTATAGG - Intronic
1091994561 12:4982955-4982977 GGCCCATGGTTTGATGCTCTAGG + Intergenic
1092762296 12:11821030-11821052 GGTCCATTGGTAAGTGTTATTGG - Intronic
1099027826 12:77488117-77488139 TGCTCATGGTTATGTGCCATGGG + Intergenic
1106824832 13:33509318-33509340 GGCCAATGGTTATCTGCTGTTGG - Intergenic
1111756247 13:92399316-92399338 AGACCATTATTAAGTGCTATTGG + Intronic
1119378574 14:74214417-74214439 GGCCCATGGCTGAGCGCTGTGGG - Intergenic
1120482389 14:85067532-85067554 GGCTCATGCTGAAGTGATATAGG + Intergenic
1121416783 14:93784874-93784896 GGCCCTTTGTTAAGTGCAAGGGG - Intronic
1121917964 14:97853637-97853659 AGCTCTTGGTTAAGTGCTATAGG + Intergenic
1128138375 15:65281209-65281231 GGCCAATGGTTAAGGGGTACAGG + Intronic
1134352831 16:13453737-13453759 TGCCCATTGTTAAATGATATAGG + Intergenic
1140266519 16:73426036-73426058 GGCCCAAGGGTGAGTGCTATGGG - Intergenic
1140297124 16:73719668-73719690 TGCCCATGGTGGAGTGCAATGGG + Intergenic
1141784630 16:86190881-86190903 GGCCCCTGCTTAACTGTTATTGG + Intergenic
1141792840 16:86248452-86248474 GTCCCAGGGTTAAGGGCTCTGGG + Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1147040343 17:37713588-37713610 AGCCCCTGGTTAAGTGATAGAGG + Intronic
1151554433 17:74839446-74839468 GACCCATGGTTAAGGGCCACTGG + Exonic
1153755784 18:8281415-8281437 GGGCCATGCTTAAGTGATTTTGG - Intronic
1159015655 18:63100018-63100040 GGCCCATGGTGCAGAGCTACAGG - Intergenic
1164404912 19:27936248-27936270 GGCCCCTTGTGCAGTGCTATTGG - Intergenic
930016777 2:46976076-46976098 GGCCCTTGGTTCAATGCTAAGGG + Intronic
947153183 2:227135197-227135219 AGCCCATGGTTCTGTGATATGGG - Intronic
1171402138 20:24880677-24880699 GTCTCATGGTTAAGAGGTATGGG + Intergenic
1173978517 20:47205431-47205453 CGCCCAGGCTTGAGTGCTATAGG - Intergenic
1174077339 20:47947107-47947129 TGCCCATGGTTAAGTGAGAGAGG - Intergenic
1174251581 20:49223838-49223860 GGCCCAGGGTTAAGTTCAGTGGG - Intronic
1177058310 21:16337336-16337358 GGTCCAAGAATAAGTGCTATAGG + Intergenic
1177916337 21:27092588-27092610 GGCTCATGGACAAATGCTATTGG - Intergenic
1178544480 21:33481206-33481228 AGCCCATGTATAAGAGCTATAGG - Intergenic
1183714364 22:39525153-39525175 GGCCCATGGGCAGGTGGTATAGG + Intergenic
952044923 3:29306933-29306955 GGCTTTTGGTTATGTGCTATGGG - Intronic
955333916 3:58069537-58069559 GGCCCATAGTTCAGTTCTTTAGG + Intronic
955350347 3:58188985-58189007 GGCCCATGGGCAAGTGACATGGG + Intergenic
956665651 3:71639706-71639728 GGCCCAGGCTGAAGTGCAATGGG + Intergenic
971468034 4:26986475-26986497 GGCATATGGCTAAGTGCTTTGGG + Intronic
976781423 4:88762624-88762646 GGCCCATGGTGAAGTTCTTTAGG + Intronic
978000564 4:103552876-103552898 GGCTCATGGTTGACTGCTTTGGG - Intergenic
980102720 4:128557699-128557721 GGCCTATGGCTAAGTGGTAGAGG - Intergenic
990271884 5:54150956-54150978 GGCCCTGGGTAAAGTGCTGTAGG + Intronic
991249686 5:64545886-64545908 GGACCTTGGTAAAGTGCTCTGGG + Intronic
999796324 5:154992944-154992966 TGCCCATGGCTAAGTGTTGTGGG + Intergenic
1004916211 6:20334500-20334522 GGTCCTTGGTTCATTGCTATTGG + Intergenic
1006803030 6:36771509-36771531 GGCCCATGGTTAAGTGCTATAGG + Intronic
1007460312 6:42013321-42013343 GAACCATGGTTAACTGCCATTGG + Intronic
1008126544 6:47675293-47675315 GGCCTATGTTCAAGTGCAATAGG - Intronic
1016376134 6:143422374-143422396 GGCCCATGGTCCAGCACTATGGG + Intergenic
1017724732 6:157268962-157268984 GGCCCATGGTCAAGGGGTCTTGG - Intergenic
1018635597 6:165856392-165856414 GACCCAGGGTTAAATGCTAATGG - Intronic
1022199091 7:28098447-28098469 GGCACTTGGCTAAGTGCTAAAGG - Intronic
1022962740 7:35445118-35445140 AGACCATGGTTAAGTGCCAGGGG - Intergenic
1030493533 7:110268418-110268440 GGCCCATGGTTAATGGAAATGGG - Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1032168700 7:129566268-129566290 TGCCCAGGGTGGAGTGCTATGGG - Intergenic
1043497635 8:80820338-80820360 GTCCTTTGGTTCAGTGCTATTGG + Intronic
1051754139 9:20377160-20377182 GGCCCATAATTAAGTGTTATTGG + Intronic
1059147421 9:111912994-111913016 AGCCCATGGCTAAGTGGTCTGGG + Intronic
1061817005 9:133203618-133203640 GTCCCATGGTTATGAGCCATGGG + Intergenic
1194607478 X:95998789-95998811 GGCCTATGGTTAAAAACTATTGG + Intergenic
1196330398 X:114466235-114466257 TGCCCATGCTTAAGTGACATGGG - Intergenic
1201320773 Y:12695981-12696003 GGCCCATGGGGAAGTTCTGTGGG - Intergenic