ID: 1006804141

View in Genome Browser
Species Human (GRCh38)
Location 6:36777504-36777526
Sequence CGTCCACACAGGCCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 3, 3: 12, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006804141_1006804144 -5 Left 1006804141 6:36777504-36777526 CCTGGAGGGGGCCTGTGTGGACG 0: 1
1: 1
2: 3
3: 12
4: 187
Right 1006804144 6:36777522-36777544 GGACGCCCGGAACAATATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006804141 Original CRISPR CGTCCACACAGGCCCCCTCC AGG (reversed) Intronic
900169102 1:1257629-1257651 TGTCCACACACACCCCCACCAGG + Intronic
900309766 1:2028064-2028086 CGTCCACACAGGAAGCCTGCAGG - Intronic
900320556 1:2081474-2081496 TGGCCACACAGGCCCCTTCTGGG - Intronic
900564813 1:3327001-3327023 GGTCCACCCAGCCCCGCTCCAGG - Intronic
901231573 1:7644528-7644550 CGGCCACCCTGGCTCCCTCCGGG + Intronic
901665934 1:10826138-10826160 CCTCCTCACAGCCCCTCTCCTGG + Intergenic
901809812 1:11761428-11761450 CCTCCACCCAGACCCACTCCGGG - Intergenic
904681907 1:32235061-32235083 AGTCCCCACAGGCCTCCACCAGG + Intergenic
906375483 1:45293330-45293352 CAAACACACAGGCTCCCTCCTGG - Intronic
906535005 1:46546556-46546578 CCTCCACACCTGCACCCTCCAGG - Intronic
908340458 1:63173322-63173344 CTTCAACACAGGCCCCCTAAGGG + Intergenic
908651443 1:66337397-66337419 CGGCCACACAAGCCTCTTCCTGG + Intronic
910001739 1:82350116-82350138 CCCCCACACAGGGTCCCTCCTGG - Intergenic
914908110 1:151763239-151763261 CCCCCACATCGGCCCCCTCCAGG + Intronic
916618764 1:166472960-166472982 CCTCCACACAGAGTCCCTCCTGG - Intergenic
920445103 1:206010405-206010427 CCACCACACAGGCAGCCTCCAGG - Intronic
920771785 1:208893208-208893230 AGCCCACACAGGCCTCCTGCAGG + Intergenic
921001577 1:211049666-211049688 CCTCCATACTGGCCCCTTCCAGG - Intronic
1062855363 10:777406-777428 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855400 10:777503-777525 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855437 10:777603-777625 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855455 10:777652-777674 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855473 10:777701-777723 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855491 10:777750-777772 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855509 10:777799-777821 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855527 10:777848-777870 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855545 10:777897-777919 CGACCCCACAGGCCTCCCCCCGG + Intergenic
1062855563 10:777946-777968 CGACCCCACAGGCCTCCCCCTGG + Intergenic
1063002765 10:1940138-1940160 CGTCCACTCAGACCCCCTCCAGG + Intergenic
1063428351 10:5966702-5966724 CCTCCAGATAGGCCCCCTGCAGG + Intronic
1063464951 10:6237022-6237044 CGGCCACACTGGCCTCCTGCAGG + Intergenic
1063968056 10:11362230-11362252 CCTCCCCCCAGGCCCCTTCCTGG - Intergenic
1065916825 10:30359875-30359897 CTGCCCCACAGGCTCCCTCCAGG - Intronic
1067166368 10:43869235-43869257 TGTCCACACCTGCCCCCACCCGG + Intergenic
1070282885 10:75062647-75062669 GGTGCACACAGGCCGCCTTCAGG - Intergenic
1070741589 10:78907060-78907082 CCTCCACACAGCCACCATCCTGG + Intergenic
1070812420 10:79305210-79305232 CTTGCACACAGGACACCTCCAGG - Exonic
1076188497 10:128466907-128466929 CTTCCAGAGAGGCCCCCTCCAGG + Intergenic
1077328749 11:1974804-1974826 CCTCCCCACAGGCCCCCGCTGGG - Intronic
1081808859 11:45904254-45904276 CTTCCACTCAGCCCCCCACCTGG - Intronic
1082283701 11:50298450-50298472 CATCCGCACATGCGCCCTCCTGG + Intergenic
1083261897 11:61527683-61527705 CGCCCACACAGGCAACGTCCTGG - Intronic
1083271948 11:61577146-61577168 CATGGAGACAGGCCCCCTCCAGG - Intronic
1083617148 11:64031944-64031966 CTTCCCCACAGGCCCCAGCCTGG - Intronic
1085469187 11:76746009-76746031 CGCCCTCACAGTCCCTCTCCAGG - Intergenic
1085941806 11:81213973-81213995 CCCCCACACAGGGGCCCTCCTGG - Intergenic
1086425960 11:86682560-86682582 CCCCCAAACAGGCCCCCTCATGG - Intergenic
1088669683 11:112128952-112128974 CATCCACACAGCCCTCCTCGGGG + Intronic
1089200571 11:116722483-116722505 CCTCCATCCAGGCCTCCTCCAGG + Intergenic
1090900783 11:131028960-131028982 CCTCCACATTGGCCCACTCCTGG + Intergenic
1202811728 11_KI270721v1_random:29983-30005 CCTCCCCACAGGCCCCCGCTGGG - Intergenic
1103982767 12:124747217-124747239 TGTCCACACAGGCCCTTTGCGGG - Intergenic
1104719919 12:131039564-131039586 AGTCCACACAGCCAGCCTCCAGG - Intronic
1106136929 13:26980373-26980395 AGTCCACACAGGCCACCTCTGGG + Intergenic
1112426388 13:99305370-99305392 CCTCTACACAGGCCACGTCCAGG + Intronic
1113715295 13:112501420-112501442 TGTCCACACAGGGCACCTGCAGG + Intronic
1113896550 13:113768336-113768358 CCTCCACCCAGGGCCCGTCCTGG - Intronic
1113958670 13:114113202-114113224 CAGCCACACCGGCCTCCTCCTGG + Intronic
1114538374 14:23437125-23437147 CCCCCACAGAGGCCTCCTCCTGG - Intergenic
1114600960 14:23955065-23955087 CGACCACATGGGCCCCGTCCTGG - Exonic
1118328846 14:64800474-64800496 CATCCCCACAGGAACCCTCCAGG - Intronic
1119331530 14:73798175-73798197 CGTCCCCACCTGCCTCCTCCAGG - Intergenic
1122216861 14:100210417-100210439 CATTCACACAGGCCCCTTCATGG - Intergenic
1122704194 14:103609799-103609821 CTCCCACCCAGGCCTCCTCCTGG + Intronic
1122887586 14:104717284-104717306 CGTCCTCCCAGTCCCCCCCCCGG + Intronic
1123123535 14:105929061-105929083 CCTCCACACAGGCATCCTCAGGG + Intronic
1123136714 14:106034230-106034252 CTTCCACACAGCCCCACTCATGG + Intergenic
1123406178 15:20020562-20020584 CCTCCACACAGGCATCCTCAGGG + Intergenic
1123515508 15:21027210-21027232 CCTCCACACAGGCATCCTCAGGG + Intergenic
1124340964 15:28888930-28888952 CGGGCACACAGGCTGCCTCCTGG - Intronic
1127142600 15:55993275-55993297 GGTCCACACCCGCCCCTTCCCGG - Intronic
1128983995 15:72206226-72206248 GGTCCACAAGGGCCCCCTGCGGG + Intronic
1129592676 15:76931614-76931636 CGGCCATATAGGCCTCCTCCTGG + Intronic
1132693516 16:1192178-1192200 GGGGCACCCAGGCCCCCTCCTGG + Intronic
1132706992 16:1249088-1249110 CGGCTCCCCAGGCCCCCTCCCGG + Intergenic
1132753051 16:1467659-1467681 CGTCCAAACAGGCACCCTGTGGG + Intronic
1133045142 16:3083778-3083800 CCTCCACACAGGCTCTCTACTGG - Intergenic
1133219894 16:4315604-4315626 CGCCCCCCCAGGCCACCTCCCGG + Intronic
1133747974 16:8701895-8701917 CAGCCACACTGGCCCCCTCGTGG - Intronic
1136646573 16:31624343-31624365 TGTCCACACAGGGACCCTCAGGG + Intergenic
1136716938 16:32288897-32288919 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1136772609 16:32854969-32854991 CCTCCACACAGCCCCACTCATGG - Intergenic
1136835313 16:33495142-33495164 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1136898005 16:34006550-34006572 CCTCCACACAGCCCCACTCATGG + Intergenic
1137762321 16:50950578-50950600 CGGCCACACATGGCCCCTGCAGG + Intergenic
1139207685 16:65044972-65044994 TGCCCACACAAGCCCCCACCAGG - Intronic
1140835591 16:78791081-78791103 CCTCCACACAGGGCCCCTGAAGG + Intronic
1142379141 16:89721796-89721818 CGTCCCCGCAGGACCCCACCGGG - Exonic
1203009490 16_KI270728v1_random:228890-228912 CCTGCACACAGGGCTCCTCCTGG - Intergenic
1203075034 16_KI270728v1_random:1117079-1117101 CCTCCACACAGCCCCACTCATGG - Intergenic
1203145486 16_KI270728v1_random:1795463-1795485 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1142699430 17:1650095-1650117 CCTCCCCACAGGCCCAATCCAGG + Intergenic
1142978168 17:3657290-3657312 CCTGCACGCGGGCCCCCTCCTGG - Intronic
1143259245 17:5585808-5585830 AGCCCACACAGCCCTCCTCCAGG - Intronic
1143369319 17:6428572-6428594 CCTCCACTCAGAGCCCCTCCTGG + Intronic
1144504335 17:15817349-15817371 CGCCCACCCAGCGCCCCTCCTGG - Intergenic
1144620924 17:16818097-16818119 TGTCCACACAGGGGGCCTCCTGG + Intergenic
1147420473 17:40319811-40319833 CGCCCCCCCCGGCCCCCTCCAGG - Intronic
1148051663 17:44772648-44772670 CATCTACAGAGGCCCCATCCTGG + Intronic
1148348737 17:46923122-46923144 CGTCCTCACAGCCCCCCTTCCGG - Exonic
1151368417 17:73631627-73631649 CATCCACCCAGTCCCCCACCAGG - Intronic
1152558297 17:81065485-81065507 CGTCCACCCAGGCACCCACACGG - Intronic
1152563464 17:81089943-81089965 CGGCCTCCCAGGGCCCCTCCTGG + Intronic
1152609378 17:81308144-81308166 GGTCCTCACAGGCACCCTGCAGG + Intergenic
1154162964 18:11993680-11993702 CGGCCACACGGGCGACCTCCTGG + Intronic
1160346622 18:78137580-78137602 CATCCACACAGGCCCCGTCCAGG - Intergenic
1160591240 18:79945738-79945760 CCCCCACACCGGCCCCCTCCAGG + Intronic
1160715298 19:573561-573583 CTTCCACGCAGGGCCCCTCGAGG - Intronic
1160718816 19:588894-588916 CTTCCTCACCTGCCCCCTCCCGG + Intergenic
1160895645 19:1400771-1400793 GCCCCACACAGGCCCCGTCCAGG - Intronic
1161085862 19:2334595-2334617 CGTACTCACAGGCCACCTGCAGG - Exonic
1162312423 19:9914808-9914830 CCTGCACTCACGCCCCCTCCTGG + Intronic
1165069823 19:33248815-33248837 CGTCCAAACAGTCCCCTACCTGG - Intergenic
1165601932 19:37061016-37061038 CTCACGCACAGGCCCCCTCCTGG + Intronic
1165941406 19:39416443-39416465 CCTCTACAAAGGCCCCATCCAGG - Intronic
930661928 2:54063437-54063459 AGACCACAGAGGCCGCCTCCTGG - Intronic
933893067 2:86788997-86789019 CGGCCACAGCGGCCCCCTCCCGG + Intronic
934852539 2:97710659-97710681 GGTCCATCCAGGGCCCCTCCTGG - Intergenic
936091034 2:109501626-109501648 CGGCCGCACAGGCCTCTTCCCGG + Exonic
937008941 2:118544289-118544311 CCTCCACACAGAGTCCCTCCTGG + Intergenic
941978870 2:171433916-171433938 CCTCGACACAGCGCCCCTCCCGG + Intronic
944377090 2:199058096-199058118 TCTCCACACAGGCTCACTCCTGG - Intergenic
945291686 2:208133608-208133630 CATTCACACATCCCCCCTCCCGG - Intergenic
947376768 2:229504086-229504108 CGTCACCACAGGCCATCTCCTGG - Intronic
948540621 2:238689354-238689376 TGGCCACACGGGCCTCCTCCTGG - Intergenic
948772349 2:240258165-240258187 TCTCCTCACAGGCCTCCTCCAGG + Intergenic
948944190 2:241211175-241211197 CCTCCACAGGGCCCCCCTCCAGG + Intronic
1171428232 20:25061920-25061942 CGTCCCCACTGCCTCCCTCCTGG + Intergenic
1172883269 20:38215313-38215335 CCTCCACACAGGCCATCCCCAGG + Intronic
1174458999 20:50669705-50669727 TGGCCACACTGGTCCCCTCCGGG + Intronic
1175542016 20:59753933-59753955 CTTCCACACACGTCCCATCCTGG - Intronic
1175940891 20:62537054-62537076 CCTCCACACAGGCCTCCTCCTGG - Intergenic
1176122183 20:63458870-63458892 GACCCACACAGGCCCCCTCCCGG - Intronic
1176307398 21:5131043-5131065 CGTTCACACGGCCCCGCTCCTGG + Exonic
1179417226 21:41208493-41208515 GGACCACACAGGCCTCCCCCTGG - Intronic
1179417408 21:41209343-41209365 GGACCACACAGGCCTCCCCCTGG - Intronic
1179849662 21:44130987-44131009 CGTTCACACGGCCCCGCTCCTGG - Exonic
1180108668 21:45637407-45637429 GGCCCACACAGGCTCTCTCCTGG - Intergenic
1180154759 21:45972520-45972542 GCTCCACACAGGCCCTCCCCCGG - Intergenic
1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG + Exonic
1181673145 22:24435292-24435314 CCTGCAGACAGGGCCCCTCCTGG - Intronic
1182321293 22:29479968-29479990 GGTCCTCACTGGCCCACTCCGGG + Intergenic
1183946707 22:41330366-41330388 TGTCAACTCAGGCCACCTCCAGG - Intronic
1184473186 22:44707339-44707361 CCTCCACACAGGCCCTCCCTGGG - Intronic
1185272182 22:49934751-49934773 AGGCCACACACTCCCCCTCCAGG + Intergenic
952022494 3:29040416-29040438 TGTCCACACAGAGTCCCTCCTGG + Intergenic
953534820 3:43769680-43769702 AGCCCACTCAGGCCTCCTCCCGG + Intergenic
954033618 3:47837972-47837994 CGTCCCCACAGGCTCACTGCTGG - Intronic
954397910 3:50302806-50302828 CGTCCACACCGTGCCTCTCCAGG + Exonic
961674824 3:128558320-128558342 GGTTCCCACCGGCCCCCTCCTGG + Intergenic
966839792 3:184079178-184079200 CGTCAACACTGGCCCCATTCTGG - Intergenic
967890106 3:194358957-194358979 CCTGCGCCCAGGCCCCCTCCGGG - Exonic
967983135 3:195077518-195077540 CGTCCACCCAGCCAGCCTCCTGG + Intronic
968027101 3:195451574-195451596 AGTCCACACAGGGGCCATCCGGG - Intergenic
968515834 4:1015300-1015322 TCTCCCCAGAGGCCCCCTCCAGG + Intronic
969529953 4:7725143-7725165 GGTCCCCACAGCCCCCCTGCAGG + Exonic
971943899 4:33250174-33250196 CCTCTAGACAAGCCCCCTCCGGG - Intergenic
974269590 4:59633305-59633327 CCTCCACACAGAGTCCCTCCTGG - Intergenic
975395387 4:73869118-73869140 CTGCCACTCAGCCCCCCTCCAGG + Intergenic
975831383 4:78372794-78372816 GCTCCACGCAGGCCCCATCCTGG - Exonic
980339970 4:131532251-131532273 CTCCCACACAGCCCCACTCCGGG + Intergenic
984774296 4:183467267-183467289 CCTCCACACAGACTCCCTCCTGG + Intergenic
985557768 5:565776-565798 CGCCGACACAGGCCCCCGCAGGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985679181 5:1246978-1247000 GGTCTTCACAGGGCCCCTCCCGG - Intergenic
988195248 5:27996889-27996911 CTTGTACCCAGGCCCCCTCCAGG - Intergenic
997606580 5:135179321-135179343 CATCCACCCCAGCCCCCTCCTGG - Intronic
1001546803 5:172575335-172575357 CCTCCAGCCAGACCCCCTCCAGG + Intergenic
1002074496 5:176700045-176700067 GGGCCACCCAGGCCCCTTCCTGG - Intergenic
1002278210 5:178116399-178116421 CGTCCCCACTGTGCCCCTCCTGG - Intronic
1002706135 5:181161714-181161736 TGACCTCAGAGGCCCCCTCCAGG + Intergenic
1006445971 6:34079988-34080010 AGTCCCCACAGGCCCCCCCAGGG + Intronic
1006804141 6:36777504-36777526 CGTCCACACAGGCCCCCTCCAGG - Intronic
1012649583 6:101736309-101736331 CATCCACACAGAGCCCCTACTGG - Intronic
1019140159 6:169937778-169937800 CGTCCACACAGAACCCAACCTGG - Intergenic
1020111874 7:5452081-5452103 TCTCCACACAGCCTCCCTCCAGG - Intronic
1020586515 7:10077141-10077163 AGTCCAGCCAGGCCCCATCCCGG - Intergenic
1023621173 7:42074669-42074691 CGTCCACCCAGGGCCCTGCCAGG + Intronic
1025149902 7:56539807-56539829 TGTCCCCACAGACCCCCTTCGGG - Intergenic
1025711305 7:63912404-63912426 TGTCCACACAGGGACCCTCAGGG - Intergenic
1026828180 7:73596688-73596710 CGGCCACATTGGCCCCTTCCAGG - Exonic
1032916437 7:136495381-136495403 CTTCCAGACCGGCCCCCACCCGG + Intergenic
1034133086 7:148739028-148739050 CTTTCACACAGGCGCCCTTCAGG + Intronic
1034256499 7:149727535-149727557 CATCTATACATGCCCCCTCCAGG + Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1035126079 7:156608296-156608318 CGTCCAGCCAGGCTCCTTCCTGG + Intergenic
1035274116 7:157737276-157737298 CGTCCACACAGGCCCCAGTCTGG - Intronic
1035779431 8:2216268-2216290 CAGCCACCCAGGCCACCTCCTGG + Intergenic
1048872837 8:138813083-138813105 GTTTCACACAGGCCCCGTCCTGG + Intronic
1049225812 8:141449988-141450010 CATCCACACCAGCCCCCTCCTGG + Intergenic
1049428840 8:142549929-142549951 CGGCCACCCAGGCCCACTCCTGG + Intergenic
1049778201 8:144415944-144415966 CGTCCTCACAGGTGCCCTCGGGG + Exonic
1056760065 9:89408281-89408303 CTTCCACGCAGCCCCACTCCAGG - Intronic
1057279229 9:93698337-93698359 GGTCCACTCTGTCCCCCTCCCGG + Intergenic
1057873316 9:98734070-98734092 CCTCCACACATGCCCCCGCTGGG + Exonic
1060199927 9:121646430-121646452 CTGCCAGACAGGCCACCTCCTGG + Intronic
1061190332 9:129079061-129079083 CGGCCACACAGGCCAGCTCACGG + Intergenic
1061225945 9:129281050-129281072 TGTCCACACAGGCCCCAGCTGGG - Intergenic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1061871758 9:133524664-133524686 GTCCCACACAGGCCCCATCCTGG - Intronic
1203780291 EBV:96841-96863 CCACCGCGCAGGCCCCCTCCAGG + Intergenic
1198806704 X:140501568-140501590 CCTCCACCCAGTCCTCCTCCTGG - Intergenic
1200137472 X:153882127-153882149 AGGCCCCACGGGCCCCCTCCAGG + Intronic
1200235021 X:154463957-154463979 CGCCCAGACAGGCCCCTTCGCGG - Exonic