ID: 1006806701

View in Genome Browser
Species Human (GRCh38)
Location 6:36793720-36793742
Sequence AGCATCCCCGGGCCCGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006806692_1006806701 14 Left 1006806692 6:36793683-36793705 CCAGGTGAATTAGCATCCATGCT 0: 1
1: 0
2: 1
3: 1
4: 95
Right 1006806701 6:36793720-36793742 AGCATCCCCGGGCCCGCCGGAGG No data
1006806695_1006806701 -2 Left 1006806695 6:36793699-36793721 CCATGCTCTCCCTGGGCTGTGAG No data
Right 1006806701 6:36793720-36793742 AGCATCCCCGGGCCCGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006806701 Original CRISPR AGCATCCCCGGGCCCGCCGG AGG Intronic