ID: 1006807209

View in Genome Browser
Species Human (GRCh38)
Location 6:36796451-36796473
Sequence ATGGAGATGCCCTATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006807209_1006807223 9 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807223 6:36796483-36796505 CCAGGTAAAGCCACGGGTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 156
1006807209_1006807216 2 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807216 6:36796476-36796498 TGGCAACCCAGGTAAAGCCACGG 0: 1
1: 0
2: 2
3: 17
4: 153
1006807209_1006807221 8 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807221 6:36796482-36796504 CCCAGGTAAAGCCACGGGTGGGG No data
1006807209_1006807218 6 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807218 6:36796480-36796502 AACCCAGGTAAAGCCACGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 74
1006807209_1006807213 -9 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807213 6:36796465-36796487 CATCTCCATCCTGGCAACCCAGG No data
1006807209_1006807217 3 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807217 6:36796477-36796499 GGCAACCCAGGTAAAGCCACGGG 0: 1
1: 0
2: 0
3: 13
4: 147
1006807209_1006807224 18 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807224 6:36796492-36796514 GCCACGGGTGGGGGTGCTGCTGG No data
1006807209_1006807219 7 Left 1006807209 6:36796451-36796473 CCTCCCTCATAGGGCATCTCCAT 0: 1
1: 0
2: 3
3: 14
4: 137
Right 1006807219 6:36796481-36796503 ACCCAGGTAAAGCCACGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006807209 Original CRISPR ATGGAGATGCCCTATGAGGG AGG (reversed) Intronic
901731545 1:11283893-11283915 GTGGAGCTGCCCACTGAGGGAGG - Intronic
902769156 1:18635656-18635678 ATGGATCTGTCCTAGGAGGGTGG + Intronic
903337453 1:22634673-22634695 AAGGAGCTGCCCCCTGAGGGAGG - Intergenic
904469482 1:30727572-30727594 TTGGAGAGGGCCTATGTGGGGGG - Intergenic
905695062 1:39967932-39967954 CTGGAGATACCCGAGGAGGGGGG - Intronic
909887908 1:80965543-80965565 ATGGAGATAGACTTTGAGGGGGG - Intergenic
917627113 1:176857543-176857565 CTGGAGATGCCATCTGAGGCAGG + Intronic
920365847 1:205448074-205448096 AGGGAGATTCCCTCTGAGGAAGG - Intronic
922343351 1:224675144-224675166 GGGGAGATGCCTGATGAGGGAGG + Intronic
922737960 1:227999521-227999543 GTGGAGATGCCAGAGGAGGGCGG - Intergenic
922913249 1:229234798-229234820 AAGGAAATGCCTTGTGAGGGAGG - Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1068999152 10:63244161-63244183 AAGGAGATGCCATATCAGAGTGG + Intronic
1070328484 10:75402541-75402563 GTGGAGATGCCCAAAGAAGGGGG - Intergenic
1070398240 10:76031563-76031585 ATGGAGATCCCCTCTTAGAGGGG + Intronic
1073341040 10:102744527-102744549 ATTGAGTTGGCCTGTGAGGGAGG + Intronic
1073873893 10:107899034-107899056 ATGAAGATGCCCCTTGCGGGAGG - Intergenic
1074430461 10:113389965-113389987 CTGGTGATGCCCTATGAGTTAGG - Intergenic
1076653124 10:132003708-132003730 ATGGAGCTGCCCCGTGCGGGTGG + Intergenic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1078595212 11:12680559-12680581 ATGGAGCTGCCCAGTGGGGGAGG - Intronic
1082741493 11:56916531-56916553 AAGGAGATACCCAACGAGGGAGG + Intergenic
1088533752 11:110838029-110838051 AGGGAGGTGGCCTAGGAGGGAGG - Intergenic
1089073288 11:115717366-115717388 ATGGGGAGGCCCTGGGAGGGAGG + Intergenic
1091703944 12:2681161-2681183 ATGAAAATGCCCTTAGAGGGTGG - Intronic
1092071044 12:5631675-5631697 AAGGAGAAGCCCTTTGAAGGAGG + Intronic
1092671434 12:10866561-10866583 AAGGAAATCCCCTATGAGGTAGG + Intronic
1094474790 12:30832904-30832926 ATGAAAATGCCCTTAGAGGGAGG + Intergenic
1097183395 12:57183732-57183754 ATGGGGATGCCCAATAAGGCAGG - Intronic
1097189122 12:57211119-57211141 ATGGAGAGCCCTCATGAGGGTGG + Intronic
1103002384 12:117395225-117395247 ATGGTGGTGACCCATGAGGGTGG + Intronic
1104935225 12:132360857-132360879 ATGGAGATGGCCCAGGAGGGAGG + Intergenic
1106463750 13:29994699-29994721 GTGGAGATGGCCTCTGGGGGTGG + Intergenic
1107010396 13:35664721-35664743 ATGGTCATGCTCTATGAGGTAGG - Intronic
1108677944 13:52753727-52753749 GTGGAGATGCCCAGTGAGAGTGG + Intergenic
1110266951 13:73549327-73549349 ATGGCGATGCCATCTGAGGAAGG + Intergenic
1110370396 13:74733385-74733407 ATGGAGATGCCCCAGCTGGGAGG - Intergenic
1112490805 13:99861644-99861666 ATGATGATGCCCTTTGAAGGGGG + Intronic
1113732648 13:112652971-112652993 AGGGAAATTCCTTATGAGGGAGG + Intronic
1116514009 14:45784459-45784481 AAGGAGATGCCATATCAGAGTGG - Intergenic
1119716073 14:76860415-76860437 ATGCAGATGCCATTTGAGAGTGG + Intronic
1121582489 14:95041325-95041347 ATGGGGATGCTCTGTGAGGTGGG - Intergenic
1124466132 15:29941481-29941503 GTAGAGATGCCCCATGAGGGTGG - Intronic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1128599192 15:68981279-68981301 ATATAGATGACCTGTGAGGGTGG - Intronic
1129658099 15:77537902-77537924 ATGGTGGTGTCCTAAGAGGGAGG + Intergenic
1129974425 15:79810276-79810298 AGGGAGATGCTTTATGAGTGAGG - Intergenic
1130515266 15:84621519-84621541 GTGGAGAAGCCCTATAAGTGTGG + Exonic
1133170652 16:3980772-3980794 ATACAGAGGCCCTAGGAGGGGGG + Intronic
1133515617 16:6506196-6506218 ATGTAGATGCCCCAAGTGGGAGG + Intronic
1134456738 16:14400555-14400577 ATGAAGCAGCCCTCTGAGGGAGG - Intergenic
1136229964 16:28880170-28880192 CTGGAGATGCCCTGCGGGGGTGG - Intronic
1137712294 16:50574694-50574716 AGGCAGAGGCCCTCTGAGGGAGG + Intronic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1143341705 17:6216232-6216254 CTGGAGCTGCCCCAAGAGGGAGG - Intergenic
1143620237 17:8076334-8076356 AGGGACATGCCCTGTGAGGAAGG + Exonic
1144098606 17:11923993-11924015 ATGGAGATGCCCAGTGAGTGTGG - Intronic
1148352697 17:46951906-46951928 ATGGAGCTGGGCTGTGAGGGAGG - Intronic
1150081255 17:62241465-62241487 ATGGCCATGACCTATGTGGGAGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152828628 17:82483598-82483620 ATGGAGATTTCATAAGAGGGAGG + Intronic
1158038946 18:53069493-53069515 ATGGAGCTGAGCTAGGAGGGTGG + Intronic
1158597757 18:58831124-58831146 ATGGAGTTGCCCAATTAGGATGG + Intergenic
1161221329 19:3119510-3119532 AGGGAGATCTCGTATGAGGGGGG + Intronic
1166358120 19:42239433-42239455 ATGGAGGTGCCCTGTGAGCTAGG - Intronic
1166613086 19:44217359-44217381 TTGGAAAAACCCTATGAGGGAGG + Intronic
1166675505 19:44738352-44738374 AGGGAGGTTTCCTATGAGGGTGG + Intergenic
1168113802 19:54209602-54209624 AGGGAGATGGGCAATGAGGGTGG + Intronic
1168598802 19:57701437-57701459 AAGGAGATCCCTTATGAGGGTGG - Exonic
925490231 2:4383303-4383325 AAGGAGATTCCTTGTGAGGGAGG - Intergenic
925829967 2:7884225-7884247 ATGGAGGTGAACTATGAGGGAGG + Intergenic
926994367 2:18717966-18717988 ATGGATAAGACCTAGGAGGGAGG + Intergenic
927103117 2:19802891-19802913 ATGGTGAAGCCCTCTGGGGGCGG - Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
928583811 2:32737148-32737170 ATGGAGGTTCCCTAGGAGAGAGG + Intronic
929073326 2:38056261-38056283 GAGGAGATGCCCTATGAGCTGGG - Intronic
940177012 2:150889639-150889661 ATGTAGATGGACTATGAGGTTGG - Intergenic
942303921 2:174588041-174588063 CTGGAGATGCCCCTTGATGGAGG - Intronic
946398469 2:219455704-219455726 CTGGTGATGCCCTCTGTGGGTGG + Intronic
947822802 2:233083735-233083757 CTGGAGCTGGCCCATGAGGGCGG - Intronic
1170658772 20:18316067-18316089 AAGGAGAAGCCCTATGTGTGCGG + Exonic
1171347678 20:24478300-24478322 AGGGAGGAGCCCTAGGAGGGAGG + Intronic
1173841016 20:46157338-46157360 ATAGAGCTACCCTATGAGGTTGG + Intergenic
1175121231 20:56717633-56717655 GTGGATATGCCATATGAGGTGGG + Intergenic
1175323268 20:58104308-58104330 TTAGAGATGCCCTATGATAGAGG - Intergenic
1176168149 20:63685291-63685313 ATGGAGATGGCCTATGTTGGGGG + Intronic
1178471979 21:32902017-32902039 ATGGAGTAGCGCTAAGAGGGTGG + Intergenic
1179405520 21:41122306-41122328 AGGGAGATGCCCAAGGAAGGAGG - Intergenic
1179589743 21:42398626-42398648 AGGGAGAGGCCCTACAAGGGTGG + Intergenic
1179593522 21:42427243-42427265 CTGGATGTGCCCCATGAGGGTGG - Intronic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182443595 22:30377741-30377763 ATGGTGCTCCCCTGTGAGGGGGG - Intronic
1182673607 22:32018851-32018873 ATTAAGATGCCCAAGGAGGGTGG - Intergenic
1184665854 22:45988718-45988740 CTGGAGCTGCCCCATCAGGGCGG - Intergenic
949143490 3:664957-664979 GTGCAGATGCCCTATGAGGATGG - Intergenic
956063131 3:65368964-65368986 ATGGAGATGCCCCATGGAGTGGG - Intronic
958438512 3:94127431-94127453 AGGGAGATGCCTAATGAGAGTGG + Exonic
960929143 3:122826613-122826635 ATGTTGACTCCCTATGAGGGAGG - Intronic
961221922 3:125207930-125207952 AAGGAGATGCCATATGTGGAAGG - Intronic
965404501 3:168252532-168252554 CTGGAAATGCCCTATGAGGTAGG + Intergenic
968923618 4:3535593-3535615 ATGGAGAGGCCATGTGAAGGTGG + Intergenic
969057452 4:4410635-4410657 ATGGAAATGCCCTATTCAGGTGG - Intronic
969917250 4:10502743-10502765 ATGGAGAGGCCCTTTACGGGAGG + Intronic
973858151 4:55033970-55033992 AAGAAGATGCCCTATGAGTGAGG - Intergenic
975828305 4:78342355-78342377 ATGGAGATGTCATATGTGTGGGG + Intronic
976815923 4:89148545-89148567 TTGGAGATGCCCAAGGAGTGCGG + Intergenic
978200409 4:106018629-106018651 ATCAAGATGCCATCTGAGGGTGG + Intergenic
982008918 4:151088285-151088307 AAGGAAATTCCCTGTGAGGGTGG + Intergenic
982071556 4:151699666-151699688 ATGGAAATGCCCTCTGAAGGGGG + Intronic
990310766 5:54535843-54535865 CTGGAGATGCCCTCTGGGGAAGG - Intronic
992990454 5:82278202-82278224 ATGGAGAGGCTCCATGGGGGAGG - Intronic
993977478 5:94499912-94499934 ATGGAGATGCTGTAGGAGCGTGG + Intronic
996067159 5:119091830-119091852 AAGGAGATGCCACATGAGAGAGG - Intronic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
999360239 5:150978663-150978685 AGGGAGAAACCCTATGAGTGTGG + Intergenic
1000441372 5:161267710-161267732 ATGGAGAAGCCCTAGGAAGCAGG - Intergenic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1002178840 5:177419147-177419169 ATGGAGAGACCCTATGTGGCAGG - Intronic
1002818195 6:698063-698085 ATGCTGATGTCCTATCAGGGTGG - Intergenic
1003556610 6:7145687-7145709 ATGGAGAGGGCCTGTGAGGTTGG + Intronic
1005015490 6:21371463-21371485 ATGGAGATGACCAAGGAGAGAGG - Intergenic
1005923857 6:30423971-30423993 ATGGTGAAGCACTATGAGTGAGG - Intergenic
1006807209 6:36796451-36796473 ATGGAGATGCCCTATGAGGGAGG - Intronic
1007387530 6:41529683-41529705 AGGGAGAGGCCCTATTAGGGAGG - Intergenic
1008684554 6:53910810-53910832 AGGGAGATGCGGTATGATGGAGG - Intronic
1009275811 6:61677939-61677961 CTGGAGATTCCTTATGATGGGGG - Intergenic
1015737756 6:136419057-136419079 AAGGAGATGGCCAATAAGGGTGG + Intronic
1017786150 6:157758700-157758722 CTGGATAAGCCCCATGAGGGTGG + Intronic
1018419285 6:163628119-163628141 ATGGAGCAGTCCTATGGGGGTGG + Intergenic
1022898964 7:34782568-34782590 AAGACCATGCCCTATGAGGGAGG - Intronic
1023729227 7:43174283-43174305 ATGGAGATCCCTTATGAGGGAGG + Intronic
1024213481 7:47227340-47227362 ATGGAGATGCCCTAGGAGGTGGG - Intergenic
1024547682 7:50536093-50536115 AAGGAAATTCCTTATGAGGGAGG - Intronic
1024668280 7:51566777-51566799 AATGAGCTGCCCTATGGGGGTGG - Intergenic
1025777787 7:64574467-64574489 ATGCAAATGCCCTCTGAGGCAGG + Intergenic
1028533318 7:91863075-91863097 AAGGAGATGGCCAATGAGTGAGG - Intronic
1032656010 7:133930392-133930414 ATGGAAATGCTCTATGAGTTTGG - Intronic
1037554519 8:20009242-20009264 CAGGAAATCCCCTATGAGGGGGG + Intergenic
1037588535 8:20294672-20294694 GTGGAAATGCCCTTTGGGGGTGG + Intronic
1037590925 8:20311371-20311393 ATGGAGATGCTCATTGAGAGGGG - Intergenic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1045492477 8:102680754-102680776 GTGGAAATGCCATCTGAGGGAGG - Intergenic
1053799330 9:41754615-41754637 ATGGAGAGGCCATGTGAAGGTGG + Intergenic
1054145887 9:61560382-61560404 ATGGAGAGGCCATGTGAAGGTGG - Intergenic
1054187739 9:61966676-61966698 ATGGAGAGGCCATGTGAAGGTGG + Intergenic
1054650777 9:67621905-67621927 ATGGAGAGGCCATGTGAAGGTGG - Intergenic
1061421107 9:130473275-130473297 CTTTAGATGCCCTAGGAGGGAGG - Intronic
1061809845 9:133155869-133155891 ATGGAGAGGCCTGATGGGGGCGG - Intronic
1203780485 EBV:97962-97984 ACGGAGATGGCCCGTGAGGGCGG - Intergenic
1185532044 X:829887-829909 ATGGAGGTGCCCCATGAAGTTGG + Intergenic
1188549958 X:31352357-31352379 ATGAAGATGCCATATGGGAGTGG + Intronic
1189049096 X:37625279-37625301 ACAGAGATGCCCCATGAGTGAGG - Intronic
1196871590 X:120117337-120117359 ATGGAGATGTCTTTTGAGGGTGG + Intergenic
1198952412 X:142086726-142086748 ATGGAAATTCCCTGTGAGGGTGG - Intergenic