ID: 1006808783

View in Genome Browser
Species Human (GRCh38)
Location 6:36806444-36806466
Sequence CTCTCTGAGTGGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 456}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006808783_1006808789 4 Left 1006808783 6:36806444-36806466 CCCTCCACCTCCCACTCAGAGAG 0: 1
1: 0
2: 3
3: 45
4: 456
Right 1006808789 6:36806471-36806493 AGTGCCTTCTCCCATCGCCACGG 0: 1
1: 0
2: 1
3: 13
4: 112
1006808783_1006808791 13 Left 1006808783 6:36806444-36806466 CCCTCCACCTCCCACTCAGAGAG 0: 1
1: 0
2: 3
3: 45
4: 456
Right 1006808791 6:36806480-36806502 TCCCATCGCCACGGCAAGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 83
1006808783_1006808793 14 Left 1006808783 6:36806444-36806466 CCCTCCACCTCCCACTCAGAGAG 0: 1
1: 0
2: 3
3: 45
4: 456
Right 1006808793 6:36806481-36806503 CCCATCGCCACGGCAAGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 110
1006808783_1006808795 17 Left 1006808783 6:36806444-36806466 CCCTCCACCTCCCACTCAGAGAG 0: 1
1: 0
2: 3
3: 45
4: 456
Right 1006808795 6:36806484-36806506 ATCGCCACGGCAAGCCTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006808783 Original CRISPR CTCTCTGAGTGGGAGGTGGA GGG (reversed) Intronic
900483449 1:2910387-2910409 CTAGCTGAGTGGGAGGATGAGGG + Intergenic
900519851 1:3100238-3100260 CTCTCTGGGAAGGAGGTAGATGG + Intronic
900664970 1:3809045-3809067 CTCACAGGGTGGAAGGTGGAGGG + Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
902257003 1:15196124-15196146 GTCTCTGGGTGGGGGATGGATGG - Intronic
902391792 1:16111214-16111236 TACCCTGAGTGGGAGATGGAGGG - Intergenic
902810225 1:18883851-18883873 CTCGGTGTGTGGGAGGTGGATGG + Intronic
903634351 1:24800425-24800447 CCGTCTGGGAGGGAGGTGGAGGG + Intronic
904118274 1:28178057-28178079 CTCTCTGTGTAGGAGGTTGTTGG - Intronic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904471042 1:30736370-30736392 CTCTCTGTGTGGGGTGTGGATGG + Intronic
904947976 1:34213248-34213270 TTCTGTGATGGGGAGGTGGAAGG - Intronic
905149386 1:35915333-35915355 CTCTCTGACTGTCAGGTGGTAGG + Exonic
905637467 1:39564426-39564448 CTCTCTGAGTGGTAGTAGGGAGG + Exonic
906210964 1:44011917-44011939 CACTGTGGGAGGGAGGTGGAAGG - Intronic
906344937 1:45009166-45009188 CTCGATGATCGGGAGGTGGACGG + Exonic
906429150 1:45740506-45740528 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
907038238 1:51235850-51235872 CTCTCTGGCTGTGATGTGGAAGG + Intergenic
907308002 1:53524286-53524308 CCCTCTGGGTGGGAGCAGGAAGG - Intronic
907663874 1:56417353-56417375 GCCTCTGAGTGGGAGGGGGCAGG - Intergenic
907960802 1:59278973-59278995 CTCTATGGGTAGGAGATGGAGGG + Intergenic
908474257 1:64472120-64472142 CTCTCCCGGTGGGAGGTGGAAGG - Intronic
910189488 1:84581080-84581102 CCCTCTTAGTGGCAGGTAGAGGG - Intergenic
910780446 1:90926665-90926687 AAATCTGAGTGGGAGGAGGATGG - Intronic
910831244 1:91464500-91464522 CTCCCTGACTGGGAGGGTGAGGG - Intergenic
911437901 1:97886393-97886415 CTCTATGAGTGGGGGCTGGATGG - Intronic
912133694 1:106633320-106633342 CTCTCTGAGTGGCTGGTGTATGG - Intergenic
912266146 1:108160100-108160122 CTGTCCGGGAGGGAGGTGGAGGG - Intronic
912302415 1:108531815-108531837 CTCTGTGAGTGGGAAGAGCAGGG - Intergenic
912547946 1:110464898-110464920 CTCTGGGAGTGGGAGGTACAAGG - Intergenic
915111206 1:153565679-153565701 CTCTCTGGGAGGGAGGGGGCTGG - Exonic
915932323 1:160068349-160068371 GGCTCTGAGTGGGGGGTGGGGGG + Intronic
916037859 1:160936778-160936800 CCCTCTGGGAGGGAGGTGGGGGG - Intergenic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
916213244 1:162375042-162375064 CTGGCTGAGTGGGCCGTGGAGGG - Intronic
917304639 1:173613443-173613465 CCCTCTGGGAGGGAGGTGGGGGG + Intronic
917375733 1:174349462-174349484 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
918098192 1:181351378-181351400 CTCTCTGAGGTGGAGGAAGATGG + Intergenic
918420631 1:184361127-184361149 TTCTGAGAGTGGAAGGTGGAAGG - Intergenic
918515436 1:185358273-185358295 CTCTCTTGGTGGGAGAAGGACGG - Intergenic
920526153 1:206668069-206668091 TTCTCTGAGTGGCAGGATGAAGG + Intronic
920656820 1:207882860-207882882 AGCTCTGAGTGGGAGGGGCATGG - Intergenic
920844463 1:209582305-209582327 CTACCTGGGTGGGAGGTTGAAGG + Intergenic
921152810 1:212415078-212415100 CTCTCTTTGTTGGAGGGGGAGGG + Intergenic
921975089 1:221193219-221193241 CACTCAGAGTGGGTGGTAGAGGG + Intergenic
922222369 1:223618460-223618482 GTGCCTGAGTTGGAGGTGGAGGG - Intronic
922350101 1:224728287-224728309 CTCTTTGAATGGGAGGGGGTAGG + Intronic
922979505 1:229813744-229813766 CTCTCTGAGAGGAAGGTGCTAGG - Intergenic
924098411 1:240578539-240578561 CTTTGTGAGTCTGAGGTGGATGG + Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
924784513 1:247183132-247183154 CTGTCTGAGTGTGGGGTGGGAGG - Intergenic
924883452 1:248188011-248188033 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883465 1:248188076-248188098 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883479 1:248188142-248188164 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
1062953341 10:1522352-1522374 CTCTAAGAGGGGGAGGTGGAAGG + Intronic
1062977063 10:1691749-1691771 GGCTCTGAGTGGGATGTGGTGGG - Intronic
1063118884 10:3090601-3090623 CTCTCTGAGTGTCAGGGCGATGG + Intronic
1063277918 10:4591522-4591544 CTCTCAGAATGGGAGGATGACGG + Intergenic
1063350329 10:5348196-5348218 CACTCTGCGTGTCAGGTGGACGG - Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064795201 10:19004302-19004324 TTCTTTGAGTGGGGGGTGGAAGG - Intergenic
1065519398 10:26556783-26556805 ATGTCTGAGTGGGGGGTGGGTGG + Intronic
1066265573 10:33773195-33773217 CTCTCTGAGTGGGGTTTAGAGGG - Intergenic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1067479800 10:46587376-46587398 CTCTCTGAGTGGGAGCTGACAGG - Intronic
1067614937 10:47754421-47754443 CTCTCTGAGTGGGAGCTGACAGG + Intergenic
1068005921 10:51392815-51392837 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1068136258 10:52953357-52953379 CTCTCTCAGTGGGAGGAGGGGGG + Intergenic
1068270344 10:54715708-54715730 ATGTCTGAGTGTGACGTGGAGGG - Intronic
1068447055 10:57137513-57137535 CTCCCTGACTGGGAGGGTGAGGG + Intergenic
1069832610 10:71290414-71290436 CTCTGAGGGTGGGAAGTGGAGGG - Intronic
1070286060 10:75084805-75084827 CTTCCTGAGTGGGCGGTGGGAGG - Intergenic
1070697807 10:78575697-78575719 CTTTCTGCCTGGGAGGTGAAGGG + Intergenic
1070791301 10:79191074-79191096 CTATGGGTGTGGGAGGTGGAGGG + Intronic
1071547116 10:86537222-86537244 CTCTCGGAAGGGGAGGTGGAGGG - Intergenic
1071616551 10:87080953-87080975 CGCTCCGAGAGGGAGGTGGGGGG + Intronic
1072116759 10:92375540-92375562 CTGTCCGGGAGGGAGGTGGAGGG + Intergenic
1072360330 10:94653059-94653081 CTCCCTGACTGGTAGGTTGAGGG + Intergenic
1074079410 10:110155954-110155976 CTCTCTGCAGGGGAGGTGGTGGG + Intergenic
1074548018 10:114416930-114416952 GTAGCTGAGTGGGTGGTGGATGG - Intergenic
1075313745 10:121435565-121435587 ATCCCTGAGTGTGAGGCGGAGGG - Intergenic
1075454851 10:122578504-122578526 CTCTCTCAGAGAGAGGTGGAAGG + Intronic
1075499753 10:122962206-122962228 TTCTTTGAGTGGGAAGAGGAAGG - Intronic
1076679168 10:132162912-132162934 GAAGCTGAGTGGGAGGTGGAGGG - Intronic
1077392468 11:2306516-2306538 CTCTCTGCGCGGGAGGTTGGTGG + Intronic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1077537657 11:3132131-3132153 GTGTCTGAGTGTGAGGTGAATGG - Intronic
1078148715 11:8740808-8740830 GTCACTGAGTGGCAGGAGGATGG - Intronic
1079203373 11:18394048-18394070 CACTGTGAGTGGGAGCTGGTAGG + Intergenic
1081024395 11:37992113-37992135 CTCTCTGAGCGGTGGGTGGTGGG - Intergenic
1082063374 11:47879410-47879432 TTCTCTGAGAGAGTGGTGGAGGG + Intergenic
1083154631 11:60815362-60815384 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1083588700 11:63879405-63879427 CTTTCTGGGTGGGAAGAGGAGGG - Intronic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1083960186 11:66010751-66010773 GGCTCTGTGTGGGAGGTTGAGGG + Intergenic
1084107608 11:66990157-66990179 CTCTTGGAGTCTGAGGTGGATGG + Intergenic
1084796616 11:71510324-71510346 CTCTCAGTCTGGGAGCTGGATGG - Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085309079 11:75505566-75505588 ATCTCTGAGTGGGAGGCAGGAGG + Intronic
1086005999 11:82036613-82036635 CTCCTTTAGTGTGAGGTGGATGG + Intergenic
1086430589 11:86732506-86732528 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1088098389 11:106126473-106126495 CTCTCTGTGTTGGATGTGGGTGG + Intergenic
1088333447 11:108676897-108676919 TCCTCTGAGTTGGGGGTGGATGG + Intronic
1088639835 11:111861470-111861492 ATCTCGGAGTGGGAGGAGGAGGG - Intronic
1089610207 11:119664658-119664680 CTCCTGGAGTGGGAGGTGGGGGG + Exonic
1090428989 11:126630242-126630264 CTCTCTGTGTGGGATGAGGTGGG + Intronic
1090524839 11:127522117-127522139 CTCTGTGAGTGGGCATTGGATGG + Intergenic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091046531 11:132330573-132330595 CTCTCTAACTTGGAGCTGGAAGG + Intronic
1091643086 12:2252451-2252473 CGTGCTGAGTGGAAGGTGGAAGG + Intronic
1091777304 12:3192789-3192811 CTCCCTGAGGAGGAGGAGGAGGG + Intronic
1092172999 12:6384878-6384900 CTCACTGAGAGGGAGCCGGAGGG + Intronic
1092331281 12:7589860-7589882 CCGTCTGGGAGGGAGGTGGAGGG - Intergenic
1092843869 12:12566267-12566289 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1094015114 12:25854662-25854684 CTCTGGGACAGGGAGGTGGATGG - Intergenic
1094462162 12:30708134-30708156 CTCTCTTGGTGGGTGGGGGAGGG + Intergenic
1096671190 12:53199176-53199198 CTCTCTCAGTGTAAGATGGAGGG - Intronic
1096757057 12:53808478-53808500 CCCTCTCAGTGGGATGAGGAAGG - Intergenic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1097437903 12:59572622-59572644 CTCCCTGACTGGTAGGGGGAGGG + Intergenic
1099012658 12:77310142-77310164 CCCACTGAGGGGAAGGTGGAGGG - Intergenic
1099105047 12:78486565-78486587 CTCTGTGGGTGGGAGGGGAAGGG + Intergenic
1100586550 12:95985963-95985985 CTCTCTGTGGAAGAGGTGGAGGG + Exonic
1101848950 12:108387151-108387173 CTCTCTGATTGGGATGTGATGGG - Intergenic
1102208378 12:111106233-111106255 CTCTGTGAGGCCGAGGTGGATGG - Intronic
1102227790 12:111241122-111241144 CTCTTGGGGTGGTAGGTGGAAGG + Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103010183 12:117452259-117452281 CACCCAGAGTGGGAGGGGGAAGG - Intergenic
1103404463 12:120665608-120665630 CACTCTGTGTGGGATGTGGTTGG + Intronic
1104166042 12:126230468-126230490 AACTCTGTGTGGGATGTGGAGGG + Intergenic
1105367931 13:19779715-19779737 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1106544362 13:30717446-30717468 CCCTCTGACTGGGAGAAGGAGGG - Intronic
1107830721 13:44372661-44372683 CTCTTGGAGCGGGAGGTGGCTGG - Intergenic
1109258434 13:60112609-60112631 CTCTCGGAGTGGGGGTGGGAGGG + Intronic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1110386932 13:74923255-74923277 CTCACTGAGTTGCAGGTGGCAGG + Intergenic
1110749721 13:79098579-79098601 CTCTCTGAGTGTGAGATGCTTGG - Intergenic
1110922212 13:81102369-81102391 CCATCTGGGAGGGAGGTGGAGGG + Intergenic
1111768550 13:92566769-92566791 CTCTCTGATTGGGAATTGGAAGG - Intronic
1112250067 13:97771338-97771360 CTCTCTGACTGGTAGGGTGAAGG - Intergenic
1112408570 13:99142452-99142474 ACTTCTAAGTGGGAGGTGGAAGG + Intergenic
1112487288 13:99831397-99831419 CTCTCAGGGAGGCAGGTGGAGGG + Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113609660 13:111634966-111634988 CTCTCAGTGTGGGAGGTGTGCGG + Intronic
1113694311 13:112333095-112333117 CTCTCTGTGTGGGGGGAGGGTGG - Intergenic
1113856076 13:113446129-113446151 CTCTCTGGGGGGGAGGGGGGAGG - Intronic
1114207229 14:20583640-20583662 CTCTCTGTGTGGGGGGAGGGTGG - Exonic
1114727568 14:24955004-24955026 CTCTCTGAGAGGGTTGTAGAAGG + Intronic
1115402517 14:32978364-32978386 CTCTCTGAGTTGTATGTGGATGG - Intronic
1116090837 14:40304362-40304384 ATCTCTGAGTGTGATGTGAAAGG - Intergenic
1116828052 14:49691178-49691200 GTCACTGGGTGGGAGGTGGGTGG - Intergenic
1118456805 14:65952105-65952127 CCCTCTGTGGGGGTGGTGGAGGG + Intergenic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1122239061 14:100349802-100349824 CTCTTTGAGTGGGAGGGAGGTGG - Intronic
1122630018 14:103103469-103103491 CTCTCTGCCTGGGATGAGGATGG + Intronic
1122716025 14:103697674-103697696 GGCACTGAGTGGGGGGTGGAGGG + Exonic
1122837449 14:104437100-104437122 CTCTCAGAGAGGGAGGTGGCTGG + Intergenic
1122930691 14:104931890-104931912 AGGTCTGAGTGGGAGGTGGGCGG + Intronic
1123948075 15:25248512-25248534 CTCTGTGTGTGGGAGGTGTAGGG + Intergenic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1126100094 15:45113642-45113664 CTCTCTGATGGGGTGGCGGATGG - Intronic
1126226599 15:46277995-46278017 CTCTCAGTGTGGGCGATGGATGG - Intergenic
1126819133 15:52483949-52483971 CTTCCTGACTGGGAGGTGGACGG - Intronic
1128334522 15:66777612-66777634 CTCTCTGACTGGTAAGGGGAGGG - Intronic
1128489615 15:68134369-68134391 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1128698703 15:69788325-69788347 CACTATGCATGGGAGGTGGAAGG + Intergenic
1128719886 15:69940515-69940537 CCCTCTGTGTGTGAGGTGGTTGG - Intergenic
1129243961 15:74268689-74268711 CTCTCTGTCTTGGAGGTGGCGGG + Intronic
1131545493 15:93312639-93312661 GTCTCTGAGTGGGTGGTGGGGGG + Intergenic
1132612735 16:825308-825330 CTCTCCGAGCGGGAGGGTGATGG + Intergenic
1132689902 16:1177763-1177785 CTCACCTGGTGGGAGGTGGAGGG + Intronic
1133047585 16:3097486-3097508 CTCCCAGTTTGGGAGGTGGATGG + Intronic
1133925713 16:10190355-10190377 CTCTGTGAGAGGGAGACGGAGGG + Intergenic
1134545716 16:15106510-15106532 CTCTGGGAGGGCGAGGTGGATGG + Intronic
1135890200 16:26349986-26350008 CGCTCTATGAGGGAGGTGGAGGG + Intergenic
1137596928 16:49730267-49730289 TTCTCTGAGTAGGAGGAGAAGGG - Intronic
1137722059 16:50633273-50633295 CTTTCGGTGTGGGATGTGGATGG - Exonic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138043548 16:53698525-53698547 CCGTCTGGGAGGGAGGTGGAGGG + Intronic
1139109107 16:63867183-63867205 CTGTCGGAGTGGGAGGTTGCTGG + Intergenic
1139517967 16:67462976-67462998 CTCACTCAGTTGGAGGTGGAGGG + Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140686781 16:77441471-77441493 CTCTCTGAGTGAAAGGAGAAAGG - Intergenic
1141022682 16:80512444-80512466 TACTCTGTGTGGGAGGAGGAGGG - Intergenic
1141523689 16:84598166-84598188 CTCTCTGGGTGGGAAGGGGAGGG - Intronic
1141596322 16:85099249-85099271 CTCTGTGAGTGGGTGGTTAAGGG - Exonic
1142198360 16:88749336-88749358 CTCTCAGGGTGGGAGGGGGTGGG - Intronic
1142419379 16:89961088-89961110 CTCTCTGCGTGAGTGGTGGCAGG + Exonic
1142824088 17:2496837-2496859 CTCACAGGGTGGAAGGTGGAAGG - Intronic
1143343651 17:6233759-6233781 CTCTCTGGGCGGGTTGTGGAGGG + Intergenic
1143931703 17:10435634-10435656 CCCTCTGACTGGGAGCTCGAGGG + Intergenic
1145000986 17:19304509-19304531 CTTTCTGTGTGTGACGTGGAGGG + Intronic
1145684356 17:26638649-26638671 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1145684546 17:26639080-26639102 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1146838966 17:36136249-36136271 CTCTCCCACTGGGTGGTGGAGGG + Intergenic
1148753039 17:49956858-49956880 CTCTCTGAATGGGTGGGTGAAGG - Intergenic
1149428958 17:56581665-56581687 CCTTCTGGGTGGGAGGTGGAAGG - Intergenic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1151500460 17:74484907-74484929 CTCACTGAGTGGGAGAAGGTGGG + Intergenic
1151554061 17:74837732-74837754 ATGGCTGAGTGGGAGGTGGCTGG - Exonic
1151717402 17:75838123-75838145 GAGTCTGAGTGGGAGGCGGAGGG - Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1152122189 17:78425665-78425687 CTCGCTGAGTGGCCCGTGGAAGG - Intronic
1152372191 17:79895884-79895906 CTCACTTGGTGGAAGGTGGAAGG - Intergenic
1152438128 17:80288480-80288502 CTCCCTGGGTGGGAGTCGGAGGG + Intronic
1152922203 17:83071677-83071699 CTCTCAGATGGGGAGCTGGAGGG + Intergenic
1152930024 17:83104681-83104703 CTCTCCGAGTGGGAAGAGGCAGG - Intergenic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1153221673 18:2867871-2867893 CTCCCAGAGTGGGTGGTGGCCGG + Intronic
1153448012 18:5195937-5195959 CATTCTGAGGGGGAGGGGGAGGG + Intronic
1153615450 18:6929581-6929603 CTCTCCGAGTGGAAGGCAGAGGG - Intergenic
1153979095 18:10294247-10294269 CGCTCTAAGAGGGATGTGGAGGG + Intergenic
1156180809 18:34601810-34601832 CTCCCTGAGTGGTAAGTGTAAGG - Intronic
1156506300 18:37596683-37596705 CACTTTGAGGCGGAGGTGGAAGG - Intergenic
1160257584 18:77260261-77260283 CTCACAGAGTGGAAGGTGAAAGG + Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1161216334 19:3096704-3096726 CTCACAGAGTGGGAGGGGGTGGG - Intronic
1161416932 19:4152586-4152608 CTCTCTTGGTAGGGGGTGGAGGG + Intergenic
1161919791 19:7257501-7257523 CTCTCTGTTTGGGTGGAGGAGGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163608055 19:18286595-18286617 CTCTCTGGCTGGGAGGAGGAAGG - Intergenic
1163790507 19:19303336-19303358 CTCTCAGAAAGGTAGGTGGACGG - Exonic
1163945290 19:20529994-20530016 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1164097265 19:22022777-22022799 CTCTCTGAGTAGTAGGGTGAGGG - Intergenic
1164105827 19:22107278-22107300 CTGTCCGGGTGGGAGGTGGGGGG - Intergenic
1164298408 19:23937143-23937165 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1165007708 19:32820028-32820050 CTCAGTGAGTGTGAGGAGGAAGG + Intronic
1165253390 19:34558107-34558129 CTCTCTCAGTGGGAGGAGGGGGG + Intergenic
1166180159 19:41103090-41103112 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1166284299 19:41814302-41814324 CTCTGTGGGTGGGAAGTGGTGGG - Intergenic
1166368270 19:42288002-42288024 CTCTCGGGGAGGGAGGTGGCAGG - Intronic
1167100617 19:47402310-47402332 CTCTCTCTCTGGGGGGTGGAGGG + Intergenic
1168115506 19:54219836-54219858 GGCTCTGAGTGGGAGATGGGCGG - Intronic
1168121303 19:54253985-54254007 GGCTCTGAGTGGGAGGTGGGCGG - Intronic
1168124816 19:54277517-54277539 GGCTCTGAGTGGGAGGTGGGCGG - Intronic
1168132848 19:54332144-54332166 GGCTTTGAGTGGGAGGTGGGCGG - Intergenic
1168362898 19:55757499-55757521 CTCGCTGACTGGGATGTTGAAGG + Intergenic
1168363856 19:55767501-55767523 CTCGCTGACTGGGATGTTGAAGG + Intergenic
925047095 2:780758-780780 CTCACTGGGTGGTAGGCGGAAGG - Intergenic
925457293 2:4027030-4027052 CTGGCTGAGTGGAAGCTGGAGGG + Intergenic
925853619 2:8108090-8108112 ATCTCTGCCTGGGAGGTGCAGGG + Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926340288 2:11899473-11899495 CTCTCTCACTGGGAGGTGATGGG - Intergenic
927872622 2:26633306-26633328 CTCTCTGTGGGAGAAGTGGAGGG + Intronic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
928082999 2:28326604-28326626 CAGTCTGAGAGGGAGGGGGATGG + Intronic
928419824 2:31129706-31129728 CTCTATGGCTGGGAGGTGGGGGG + Intronic
928447661 2:31347437-31347459 CTCCCTGGGTGGGAGCTAGAAGG - Intronic
928601414 2:32907508-32907530 GGCTCTGCGAGGGAGGTGGAAGG - Intergenic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
929878132 2:45814046-45814068 CCCTCTGTGCGGGAGGGGGAGGG - Intronic
929967437 2:46545784-46545806 TTCTCTGAGTGGGTGTTGGATGG + Intronic
930242380 2:48949288-48949310 CTATGTGAGTTGGAGGAGGATGG - Intergenic
930536741 2:52653360-52653382 CTCTCTGACTGGTAGGGTGAAGG - Intergenic
930587019 2:53279146-53279168 ATTTCGGAGTCGGAGGTGGATGG + Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932625925 2:73295866-73295888 CTGCCTGAGAGGGAGGAGGAGGG + Intergenic
933644113 2:84796149-84796171 ATCTTTGAGGGGGTGGTGGAAGG + Intronic
933894125 2:86795008-86795030 GTCTGGGAGTGGGAGGGGGAAGG - Intronic
935564463 2:104591367-104591389 CTCCCTGACTGGTAGGTAGAGGG - Intergenic
935617614 2:105102435-105102457 CACTCTGAGGAGGAGGTGGTGGG + Intergenic
937666177 2:124489728-124489750 CTCTCAGAATGGAAGATGGAGGG - Intronic
937718589 2:125063903-125063925 CTCTCCCAGTGGAAGATGGAAGG + Intergenic
937796557 2:126029360-126029382 CTCTGTGAGTTGGAGTTGCATGG + Intergenic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
938465274 2:131520853-131520875 CTCTCTGTGTGGGACCAGGACGG + Intergenic
938828795 2:135033248-135033270 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
938969647 2:136420513-136420535 CTCCCAGAGTGGAAGCTGGAGGG - Intergenic
939669160 2:144988486-144988508 CTTTCTGAGTGAGCTGTGGAAGG + Intergenic
940652394 2:156451749-156451771 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
941003032 2:160221351-160221373 CCCTCTGAGTGCAGGGTGGAAGG + Intronic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
941602908 2:167563415-167563437 CTGTCCGGGAGGGAGGTGGAGGG - Intergenic
941844468 2:170119532-170119554 CTCTCTGAGTTGGGGGTTGGGGG + Intergenic
943005842 2:182386784-182386806 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
943383578 2:187177299-187177321 CTCTATGGGTGGGTGGCGGACGG + Intergenic
943971813 2:194419370-194419392 CTCACACAGTGGAAGGTGGAAGG - Intergenic
944942127 2:204640171-204640193 CTCTGTGTCTGGGAGGTTGAGGG + Intronic
945725106 2:213465515-213465537 TTCTCTGGGAGGGAGGTGGCTGG + Intronic
945977540 2:216282471-216282493 CTCTCTGGGGTGGTGGTGGAGGG - Intronic
946566051 2:220966922-220966944 CCCTCTGGGTGGTAGGAGGAAGG + Intergenic
948974935 2:241458239-241458261 GTCCCTGAGTGGCAGCTGGATGG + Intronic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170241882 20:14175167-14175189 CCATCTGAGTGGGAGCTGCAAGG + Intronic
1170651961 20:18251172-18251194 GTCACTGAGTGGGATGTGGGGGG + Intergenic
1170669242 20:18415404-18415426 CTTTCTGAGTGGGCGGAGGAGGG + Exonic
1171956402 20:31467167-31467189 AGCACTGAGTGGGAGGTGGAGGG + Intronic
1172182979 20:33014884-33014906 CTCCCTGGGGGGGAGGTGGGAGG - Intronic
1172477370 20:35248956-35248978 CTCAGAGAGTGGCAGGTGGATGG + Intronic
1173571862 20:44082189-44082211 CTCTTGGATTTGGAGGTGGAAGG - Intergenic
1175098064 20:56557834-56557856 CTTTGGGAGTGGGAGGTGGGTGG + Intergenic
1175361183 20:58413829-58413851 CTATCTGGGAGGGAGGTGGCGGG - Intronic
1175361254 20:58414005-58414027 CTATCTGGGAGGGAGGTGGCGGG - Intronic
1176028433 20:62998204-62998226 CTCTCAGGGCTGGAGGTGGAGGG + Intergenic
1177178303 21:17720144-17720166 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1177942308 21:27425745-27425767 TTCTCAGAGGGGGAGATGGAAGG + Intergenic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179410261 21:41156907-41156929 CTCTTTGAGTTGGAGGAGTAGGG - Intergenic
1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG + Intergenic
1181584303 22:23844757-23844779 GTCTCTGGGTGGGATGGGGAGGG + Intergenic
1182616390 22:31592185-31592207 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1182616590 22:31592637-31592659 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
1183068045 22:35377183-35377205 CTCTTTAGGTGGGAGGTGAAAGG + Intergenic
1183324578 22:37184427-37184449 CTCTCTCAATAGGACGTGGAAGG - Intronic
1183669927 22:39266519-39266541 CACTCTGTGTGGGAGGGGCATGG - Intergenic
1184116131 22:42423406-42423428 CTCTGTTACTGGGAGGTGGTAGG - Intronic
1184142657 22:42587242-42587264 ATATCTGAGTGGAAGTTGGAGGG - Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184852832 22:47130480-47130502 CTCTCTGGATGGAGGGTGGAGGG + Intronic
1185081675 22:48712845-48712867 CTCTCAGAGCTGGAGGAGGAGGG + Intronic
949093635 3:60083-60105 CACTCAGAGTGGAAGGTGAAGGG - Intergenic
949799836 3:7891641-7891663 CTCTCTCAGTGGAATGTAGAAGG - Intergenic
949856982 3:8470852-8470874 TTCTCTCAGTGGAAGGTGGCTGG + Intergenic
951262294 3:20524088-20524110 CTGTCTGAGTAGGAGCTGCAAGG + Intergenic
952319475 3:32262502-32262524 ATCACTGTGTTGGAGGTGGAAGG + Intronic
952881745 3:37990132-37990154 CTCTCTCACTGTGGGGTGGAGGG - Intronic
953173568 3:40529273-40529295 ATCTCTGAGTGAGAAGTAGAAGG - Intronic
954059585 3:48056648-48056670 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
954224034 3:49171515-49171537 TTCCCTGAGTCGGAGGGGGAGGG + Intergenic
954356013 3:50084462-50084484 CTGTCCGGGAGGGAGGTGGAGGG - Intronic
954419190 3:50409679-50409701 CTCTCTGAGGGCAGGGTGGAAGG + Intronic
955805757 3:62732381-62732403 CTCTCTCAGTGGTTGTTGGAAGG - Intronic
957074413 3:75590507-75590529 CTCTCTGAAGGGGAGGCGGTGGG - Intergenic
960027111 3:113021852-113021874 ATCTTTGGGTGGGAGGTGGAGGG + Intergenic
961641563 3:128367938-128367960 CTCTCCCAGTGGGTGGTGGGAGG - Intronic
961874713 3:130013392-130013414 CTCTCAGAATGGGAGGCGGTGGG - Intergenic
962438731 3:135392196-135392218 CTGACTGTGTGGGATGTGGAAGG + Intergenic
962478030 3:135774052-135774074 CATGTTGAGTGGGAGGTGGAAGG + Intergenic
963566767 3:146939870-146939892 CTCTCTGACTGGTAGGGTGAGGG + Intergenic
965505447 3:169510220-169510242 CTCTGTGATTGGGATGTGAAGGG + Intronic
966767951 3:183479225-183479247 CTCTGTGAGGGAGAGATGGAGGG - Intergenic
967668164 3:192199757-192199779 TTTTCAGAGTGGGAGGAGGAGGG - Intronic
968771730 4:2511805-2511827 CTCTGTGGGTGGGAGGAGGGTGG + Intronic
969270112 4:6093974-6093996 ATCTCTGCTTGGGAGGTGAAGGG - Intronic
969330519 4:6471596-6471618 GTCCCTGAGTGGGAGGGAGAAGG - Intronic
969348583 4:6584757-6584779 CTCTCTGTCTGGCAGCTGGAGGG - Intronic
969537225 4:7763857-7763879 CCCTCTGAGTTGAATGTGGATGG - Intronic
969606068 4:8202861-8202883 CCCTCTGTGTGGGAGGTGGGTGG + Intronic
970637383 4:18023553-18023575 ATCTCTGGGTGGCAGGAGGAGGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971223745 4:24732809-24732831 CCCTGGGAGTGGGATGTGGAGGG - Intergenic
972095371 4:35341582-35341604 CTCCCTGAGTGGTAGGGTGAGGG + Intergenic
972254146 4:37335280-37335302 CCCTCTGACTGGGGGGTGGGCGG + Intronic
972938449 4:44167962-44167984 CCCTCTGGGAGGGAGGTGGGGGG + Intergenic
973593597 4:52465313-52465335 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
973716120 4:53678194-53678216 CTTTCTGACTGGAATGTGGATGG + Intronic
973982919 4:56321338-56321360 ATCTCTGGGTAGGAGGAGGAGGG - Intronic
975636086 4:76450169-76450191 TTCTCTGCTTGGGAGATGGAAGG - Intronic
977176805 4:93828786-93828808 ATCTCCGAGTGGGTGGGGGAGGG + Exonic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
979385965 4:120066307-120066329 CACTTTGAGTGGGAGGGTGAGGG + Intronic
979674940 4:123399433-123399455 CTCTCTCTGTGGTAGGAGGAGGG - Intronic
980407626 4:132374032-132374054 ATCTGTCAGTGGGAGGGGGAAGG - Intergenic
981677482 4:147358048-147358070 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
982435223 4:155377051-155377073 CTATCTGGGTGGGAGTTGGGCGG - Intergenic
983228319 4:165105953-165105975 CTCACGCAGTGGAAGGTGGAAGG - Intronic
983791066 4:171797776-171797798 CTCACATAGTGGGAGGTGGAAGG + Intergenic
984533561 4:180945067-180945089 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
986167093 5:5283466-5283488 CTTTCTGGGGGGGAGGTGGGGGG - Intronic
986261731 5:6153336-6153358 CTCCCTGAGTGGGAGGATGAGGG - Intergenic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
987578479 5:19759423-19759445 CTCCCTGACTGGTAGGTTGAGGG - Intronic
988004212 5:25387003-25387025 CCCTCTGAATGAGAAGTGGAGGG - Intergenic
988771710 5:34439378-34439400 CCCACTGAGTGGGAGGGGGCTGG - Intergenic
989552761 5:42755815-42755837 TTTTCTGAGTGGGAGATGGGAGG - Intergenic
990870987 5:60431176-60431198 CTGTCTGGGAGGGAGGTGGGGGG - Intronic
991932357 5:71766229-71766251 CTTTGTGAGTGGGAGGAGGCAGG + Intergenic
993319686 5:86457466-86457488 CTCTCTGACTGGTAGGGTGAGGG + Intergenic
994175141 5:96702789-96702811 CTCTCTGAGTGCGACGGGGCGGG - Intronic
995746970 5:115414432-115414454 CTTTATGAGTGGGAGTGGGAAGG - Intergenic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996440730 5:123487410-123487432 TTCTCTGTGTGGGTGGTGGGCGG + Intergenic
996581289 5:125034913-125034935 ATCTCTAAGTGGGAGGAGAAGGG - Intergenic
997897059 5:137728465-137728487 CTCTCTGAACGTGAGGTGGAGGG - Intronic
998684113 5:144504779-144504801 CCCTCTGACAGGCAGGTGGAAGG + Intergenic
999707620 5:154288070-154288092 TTCTTTGAGAGGAAGGTGGAGGG + Intronic
1000069778 5:157729555-157729577 CTCCCAGTGTGGGATGTGGATGG + Intergenic
1000103347 5:158037042-158037064 CCCTCTGGGAGGGAGGTGGGGGG - Intergenic
1001394189 5:171404188-171404210 CTATCTGGGAGGGAGGTGGGGGG - Intronic
1001936066 5:175706872-175706894 CTCTCTATGTGGAAGGGGGAGGG + Intergenic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002858360 6:1057724-1057746 CTTACTGGGTGGGATGTGGAAGG - Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004249893 6:14015205-14015227 CTCACATAGTGGAAGGTGGAAGG + Intergenic
1005158926 6:22836939-22836961 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006509585 6:34514889-34514911 CTTCCTGAGTGAGCGGTGGAGGG + Intronic
1006676904 6:35771190-35771212 CTCACCGAGTGGGAGAAGGAAGG + Intergenic
1006761376 6:36464927-36464949 CACTCTGTGTAGGAGGTGGGAGG - Intronic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1007122613 6:39395802-39395824 CTCACTAACTGGGAGGTAGAGGG + Intronic
1007927557 6:45662648-45662670 CGCTCTGCTGGGGAGGTGGAGGG + Intronic
1008058153 6:46966905-46966927 CTCTCTGCGTGGTAGGTGCCGGG - Intergenic
1009820987 6:68800875-68800897 CTATCTAAATGGGAGGAGGAAGG + Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011259185 6:85453843-85453865 TTGTCTATGTGGGAGGTGGAGGG - Intronic
1012820662 6:104081812-104081834 CTCCCTGACTGGTAGGAGGAAGG + Intergenic
1013154262 6:107477983-107478005 CTACCTGAGGGGGAGGTGGGAGG + Intergenic
1014416847 6:121194284-121194306 CTCTCTGACTGGTAGGGTGAGGG + Intronic
1015467073 6:133559336-133559358 CTCTCTGACTGGTAGGGTGAGGG - Intergenic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1016190154 6:141255283-141255305 CACTCTGACTGGGAGTTGGGTGG - Intergenic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019171524 6:170135930-170135952 CTCTGCGAGTGGGAGCGGGAGGG - Intergenic
1019450794 7:1096797-1096819 CTCACTGAGTGGGAGGTGCGGGG - Intronic
1021244331 7:18243518-18243540 CACTCTGAGTGGAATTTGGAAGG - Intronic
1022648686 7:32255288-32255310 CTCTCTCAGTGAGAGAGGGAAGG - Intronic
1022771876 7:33482252-33482274 CTCACTGAGTGGCAGAGGGAGGG + Intronic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1024808743 7:53182221-53182243 CTTTCTCAGTAGGAGTTGGAAGG - Intergenic
1026835186 7:73634000-73634022 CTCACTGAGTGAGAAGAGGATGG + Intergenic
1026964223 7:74429176-74429198 GTCTCTGAAGGGGAGGTGCAGGG - Intergenic
1027270274 7:76515119-76515141 CTCTCTGGGTGGGATGTGGTGGG - Exonic
1028880757 7:95877111-95877133 CTCTCCAAGTGGGAGCTGGCAGG - Intronic
1028899554 7:96081652-96081674 CTCTGTGAGTGCCTGGTGGATGG + Intronic
1029044259 7:97611442-97611464 CTCACATAGTGGGAGGTGGGAGG + Intergenic
1029272759 7:99386666-99386688 ATCTCTGAAGGGGAGATGGAGGG - Exonic
1029524165 7:101085221-101085243 TTCTCTGAGTAGAGGGTGGAGGG - Intergenic
1030087492 7:105829485-105829507 CTCTCTGAGTGGGAAATGGCTGG - Intronic
1031234476 7:119156397-119156419 CTCTCAGAGTGGAGGGTGGGAGG + Intergenic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1032057713 7:128697159-128697181 CACTCTGAGTGGGGCTTGGAGGG + Intergenic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032197409 7:129797412-129797434 CTCTGAGATTGGGAGGTAGAGGG - Intergenic
1032455622 7:132071309-132071331 CTCTCTGAGTTGGACGGGCAAGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1034419270 7:150980399-150980421 CTCTCTGTTTGGGAGGATGAAGG - Intergenic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1035906757 8:3519845-3519867 CTATTTTAGTGGGAGGTTGATGG - Intronic
1036183709 8:6606569-6606591 CTCCCTGTGTGGGAGGGGGCAGG - Intronic
1036663968 8:10726767-10726789 CTCTGTGGCTGGGAGGGGGAAGG - Intronic
1037080214 8:14775908-14775930 GCCTGTGACTGGGAGGTGGAAGG + Intronic
1037973509 8:23192152-23192174 CTCTGTGGATGGGAGGTGGGTGG - Intronic
1038650154 8:29395108-29395130 CTCTCTGTGTGGGACCAGGAGGG - Intergenic
1039026528 8:33264486-33264508 TTCTCTGAATGGGAGCTAGAGGG - Intergenic
1040109085 8:43558297-43558319 CTCTCTCAGTGGGAGGAGGGGGG + Intergenic
1040549631 8:48428234-48428256 CTCAATTGGTGGGAGGTGGAGGG - Intergenic
1042015247 8:64302177-64302199 CTCTCAGTGTGTGAAGTGGAGGG - Intergenic
1042359830 8:67869929-67869951 CTCAGTGAATGGGAGGGGGACGG + Intergenic
1043496318 8:80804671-80804693 CTGTCAGAGTGGGAGGTGGGAGG + Intronic
1045009982 8:97950580-97950602 CTCTCTGTGTGGGGGGTAAAAGG - Intronic
1047219136 8:122904518-122904540 CTCTCTGACTGGGAGGAGTCAGG - Intronic
1047336025 8:123937148-123937170 CTCTGGGAGGGCGAGGTGGACGG - Intronic
1047779174 8:128097904-128097926 ATCTCTGAGTAGGAGCTGGCTGG - Intergenic
1048276095 8:133067187-133067209 CTCTCTGAGTGCGAGGCTGGGGG + Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1052249489 9:26380636-26380658 TTCTCTGAGGGGGATGTGTATGG - Intergenic
1052340418 9:27359412-27359434 CCCTTTGATGGGGAGGTGGAAGG - Intronic
1052851459 9:33380856-33380878 TTCCCTGAGGGGGAGCTGGAGGG - Intergenic
1054935371 9:70681973-70681995 CTCACGTGGTGGGAGGTGGAAGG - Intronic
1055009186 9:71544898-71544920 CTACTTGGGTGGGAGGTGGAAGG + Intergenic
1055242248 9:74198004-74198026 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1055488240 9:76777971-76777993 CTATAGCAGTGGGAGGTGGAAGG + Intronic
1056564128 9:87758444-87758466 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1056564280 9:87758826-87758848 CTGTCTGGGAGGGAGGTGGGGGG - Intergenic
1057339542 9:94187556-94187578 CTCACATAGTGGAAGGTGGAAGG + Intergenic
1057440414 9:95078925-95078947 CTTTCTGTTGGGGAGGTGGAGGG + Intronic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1058465727 9:105225366-105225388 ATCTATGAGTGGGAGTTGGGTGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1059121070 9:111641385-111641407 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1059403042 9:114082401-114082423 CTCTTTGGGTTGGAGGTGTAGGG - Intergenic
1059934483 9:119295285-119295307 CTTTCAGAGTCTGAGGTGGATGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060258062 9:122050070-122050092 GTCTCTGAGTGGGGTGTGGTGGG - Intronic
1060520928 9:124293698-124293720 ATCTCTGACTAGTAGGTGGAGGG - Intronic
1060687310 9:125624191-125624213 CTGTCTGGGAGGGAGGTGGGGGG + Intronic
1061147502 9:128808530-128808552 CACTCTGGGAAGGAGGTGGAAGG - Exonic
1062035643 9:134381428-134381450 CTGTCTGAGCGGGAGAGGGAAGG + Intronic
1062707381 9:137953064-137953086 CTCTGGGAGTGGGATGTGGTAGG + Intronic
1203405794 Un_KI270539v1:836-858 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1185471016 X:383246-383268 CTTGCTGAGTGAGAGGTGGGTGG - Intronic
1186343682 X:8669072-8669094 CTCTGTGTGTGGGAAGTTGAAGG + Intronic
1186400318 X:9252537-9252559 CTCACTGGGTGGGGGGTGGGGGG - Intergenic
1186524401 X:10235223-10235245 CTTTCTAAGTGGGAAGAGGAAGG + Exonic
1186976453 X:14911642-14911664 CTTTCTGAGGCTGAGGTGGAAGG + Intronic
1187423891 X:19160211-19160233 CTGTCTGACTGGGGGGTGGTGGG + Intergenic
1189085570 X:38019710-38019732 CCCTCCACGTGGGAGGTGGAGGG - Intronic
1190286950 X:48967607-48967629 CTGTCTCTGTGGGAGGTGGGTGG - Intronic
1190397377 X:49998658-49998680 CACTCTGAGTGTGAGAGGGAAGG - Intronic
1191742668 X:64452415-64452437 CTCTCTGACTGGTAGGGTGAGGG - Intergenic
1193207402 X:78765295-78765317 CTGTCTGGGAGGGAGGTGGGGGG + Intergenic
1194812082 X:98399346-98399368 CTCCCATGGTGGGAGGTGGAAGG + Intergenic
1195085498 X:101409552-101409574 TACTCTGAGTGGGAGGTTTATGG - Intronic
1195319090 X:103706813-103706835 GGCTCTGGGTGGGAGGTGGCAGG + Intergenic
1196548907 X:116997782-116997804 CTCACTGAGAGGGAGGTAGATGG - Intergenic
1198783182 X:140258909-140258931 CTCCCTGACTGGGAGGGTGAGGG - Intergenic
1198933879 X:141886740-141886762 CTCCCTGACTGGGAGGGTGAGGG + Intronic
1199165797 X:144673475-144673497 CCTTGTGAGTGAGAGGTGGAGGG - Intergenic
1199452576 X:147992295-147992317 CCCTCTGGGAGGGAGGTGGGGGG - Intronic
1199540780 X:148955833-148955855 TTTTCTGAGTGGGCCGTGGACGG - Exonic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic
1201283259 Y:12358971-12358993 CTCTCTCAGTGGGAGGAGGAGGG + Intergenic
1201568010 Y:15386334-15386356 CTCTAGGTGTGGGAGGTGGCAGG + Intergenic
1201948312 Y:19535823-19535845 CCCTCTGGGAGGGAGGTGGGGGG + Intergenic
1202337421 Y:23826438-23826460 CTCTCTCAGTGGTAGGAGGGGGG + Intergenic
1202533345 Y:25843633-25843655 CTCTCTCAGTGGTAGGAGGGGGG - Intergenic