ID: 1006811117

View in Genome Browser
Species Human (GRCh38)
Location 6:36821237-36821259
Sequence CCGTGTGACTGGAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006811102_1006811117 24 Left 1006811102 6:36821190-36821212 CCAGGAAAAAGGAAGAGCAGGTG 0: 1
1: 1
2: 20
3: 93
4: 727
Right 1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG 0: 1
1: 0
2: 5
3: 52
4: 210
1006811112_1006811117 -5 Left 1006811112 6:36821219-36821241 CCTGGAGGCGGGGGCGGGCCGTG 0: 1
1: 0
2: 2
3: 63
4: 607
Right 1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG 0: 1
1: 0
2: 5
3: 52
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006811117 Original CRISPR CCGTGTGACTGGAGTGGAGT GGG Intronic
901242970 1:7705335-7705357 CCGTGTGTCTGGAGTGGCCGAGG + Intronic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902736382 1:18404036-18404058 CCATGTGACTGGAGTCTAGAGGG - Intergenic
903168186 1:21535793-21535815 CCTAGTCATTGGAGTGGAGTGGG - Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903646265 1:24897994-24898016 CCGTGTGCCAGGTGTGGAGTAGG - Intergenic
904552237 1:31328666-31328688 GGGTATGGCTGGAGTGGAGTGGG + Intronic
905030746 1:34882861-34882883 CCATGTGGCTGGTGTGGAGTGGG - Intronic
906747544 1:48232254-48232276 GATTGTGACTGGACTGGAGTAGG + Intronic
913306817 1:117436754-117436776 CAGTGTGATTGGGGTGGAGGTGG + Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
919417983 1:197335175-197335197 TAGTGTGACTGGAGTGAAGGAGG + Intronic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
922350304 1:224729758-224729780 CTGTGTGGCTGGATTGGAGGTGG + Intronic
922574363 1:226652309-226652331 GCGTGTGCCTGGAGTGGATTTGG - Intronic
923533805 1:234832565-234832587 CTGAGTGACTGGAGTGGAGCTGG - Intergenic
923746092 1:236701471-236701493 CCCTGTGACTGGAGGGCTGTGGG + Intronic
924200203 1:241650573-241650595 CAGTGTGACTGAGGTGGTGTGGG - Intronic
1063058690 10:2528453-2528475 CCACGTGACTGGGGTGGAGGGGG - Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074223920 10:111464732-111464754 CTGTGTAACTGGAGTGCAGGAGG + Intergenic
1075700965 10:124469181-124469203 AAGTGTGATTGGAGTGGGGTGGG + Intronic
1077058692 11:608339-608361 CTGTGTGACTGTCGTGGAGCCGG + Exonic
1077504217 11:2922674-2922696 CTGTGTGGGTTGAGTGGAGTGGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078860117 11:15239091-15239113 GGCTGTGGCTGGAGTGGAGTGGG + Intronic
1083838185 11:65286426-65286448 CAGTCTCACTGGAGTGCAGTGGG + Intronic
1084362696 11:68679223-68679245 CTGTGTTACTGGAGTGGGGCTGG + Intergenic
1084457629 11:69277665-69277687 TCATGTGACTGGGGTGGAGGAGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088456074 11:110034307-110034329 CTGTGTGACTGGAGCTGTGTGGG - Intergenic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1089466844 11:118691005-118691027 CTGTGTGACTGGGGCAGAGTGGG - Intergenic
1089629262 11:119773893-119773915 CCATGTGAGTGGAGTGGGGTGGG + Intergenic
1090481548 11:127073387-127073409 GTGTGTGACTAGAGTGGGGTTGG + Intergenic
1096541171 12:52308161-52308183 CCCCGTGACTGAAGTGGAGGGGG - Intronic
1098239585 12:68453228-68453250 CCATGTGCCAGGAGTGGAGAGGG + Intergenic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1101440902 12:104703705-104703727 CAGTGAGCCTGGAATGGAGTGGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102222416 12:111203587-111203609 CCATGTGCCTGGAGCAGAGTGGG + Intronic
1102233730 12:111281223-111281245 CCCAGTGGCTGGAGTGGAGTTGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1104061997 12:125276554-125276576 CTGAATGGCTGGAGTGGAGTTGG + Intronic
1104986474 12:132600432-132600454 CAGCGTGACGGGACTGGAGTGGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106934345 13:34701879-34701901 CCCTGTGAGTGAAGTGGAGAGGG - Intergenic
1110362415 13:74642661-74642683 CTTTGTTAGTGGAGTGGAGTGGG + Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114683570 14:24507078-24507100 CCGTGTGTCTTGAGTTGGGTAGG + Intronic
1115211110 14:30967911-30967933 CCGGGTGACTGGGGTGGTGGGGG + Intronic
1115273513 14:31580838-31580860 CCATGTGATTGGAGTGGTCTAGG + Intronic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1119197676 14:72729400-72729422 TCTTGTGCCTGGAGTGGAGTGGG + Intronic
1120253905 14:82093516-82093538 CTGTGTGAGTTAAGTGGAGTAGG + Intergenic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1121811390 14:96894199-96894221 CCGTGTGCCTGGAGTGGGTGAGG + Intronic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1124545851 15:30626135-30626157 CCGGGTGTCTGCAGTGGAGCTGG + Intronic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125749972 15:42021438-42021460 CCATGAAACTGAAGTGGAGTTGG - Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128998743 15:72316205-72316227 ACTTGTGACTGGAGTGGGGAGGG - Intronic
1130160601 15:81395402-81395424 GCATGTGACTGAAGTGGAATGGG - Intergenic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1133235939 16:4387466-4387488 CCATGTGGCTGGTGTGGAGTAGG + Intronic
1133741090 16:8652067-8652089 CCGTGGAAGTGGAGTGGAGCTGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134802357 16:17096979-17097001 CCGAGTAATTGGAGTGGAGAGGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1141733911 16:85839879-85839901 CCTTGTGGCTGGGGTGGTGTGGG + Intergenic
1141750752 16:85956337-85956359 CCCTGTGGTTGTAGTGGAGTGGG - Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1144957519 17:19026591-19026613 CCCCTTGACTGGAATGGAGTAGG - Intronic
1144977637 17:19147925-19147947 CCCCTTGACTGGAATGGAGTAGG + Intronic
1145739143 17:27257678-27257700 GCCTGTGGCTGGAGTGGAGATGG - Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1149694453 17:58605601-58605623 CCCTGTGACTTGAGTGGAGTGGG - Intronic
1150379854 17:64712093-64712115 CCGAGGTACTGGAGTGGAGTCGG + Intergenic
1151432170 17:74071025-74071047 ACCTGTGACTGGGGAGGAGTGGG - Intergenic
1151972804 17:77467512-77467534 CGGTGGGAGGGGAGTGGAGTGGG - Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1154192313 18:12241097-12241119 CTGGGTGACTGGAGTGCCGTGGG - Intergenic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1156171630 18:34493581-34493603 CCGTGTGCCGGGCGAGGAGTGGG + Intronic
1156623271 18:38878459-38878481 CTGTGTAACTGGATAGGAGTGGG + Intergenic
1159440402 18:68471564-68471586 GCTGGAGACTGGAGTGGAGTAGG - Intergenic
1161532347 19:4797546-4797568 CCTTGAGACTGGGGTGGGGTGGG + Exonic
1161857803 19:6775673-6775695 CCGTGTGTCTGGTATGTAGTGGG + Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1164101706 19:22060524-22060546 TCGTCAGACTGGAGTGCAGTGGG + Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165139095 19:33688471-33688493 CCCTTTGCCTGGAGTGGAGGTGG - Intronic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166298718 19:41902426-41902448 CCCTGGGACTGGAGTAGGGTGGG - Intronic
1166729375 19:45050121-45050143 CTGTGTGCCTGGAGCAGAGTAGG + Intronic
1167201370 19:48067730-48067752 GCGTGTGAATGGGCTGGAGTAGG - Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
925502592 2:4522668-4522690 CCGTGTCACTGAAGTGGAGAGGG - Intergenic
926371671 2:12184944-12184966 CAATTTGACTGCAGTGGAGTGGG + Intergenic
930297901 2:49578609-49578631 CCTTGTCACTGCTGTGGAGTCGG - Intergenic
931463802 2:62469937-62469959 CCCTGGGACTGGAGTGGGGATGG - Intergenic
932761258 2:74440497-74440519 CCGTGGGCCTGGCGTGGAGGCGG - Intronic
935052635 2:99536602-99536624 CCCTGTGATGGGAGTGGAGGAGG + Intergenic
937046502 2:118854836-118854858 GGGGGTGAATGGAGTGGAGTTGG - Intergenic
937914212 2:127090911-127090933 TCCTGTGCCTGGAGTGGAGTCGG - Intronic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938707463 2:133944955-133944977 CCATGTCACTGCAGAGGAGTTGG - Intergenic
944486996 2:200217426-200217448 CTGTGTGCCTGGAGTAGAGGTGG - Intergenic
946065806 2:216986169-216986191 TTATGTGAATGGAGTGGAGTAGG - Intergenic
948173244 2:235923517-235923539 CCTTGTGAGTGGGGTGGGGTGGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
949055842 2:241927950-241927972 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949055858 2:241928009-241928031 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949055945 2:241928335-241928357 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949055992 2:241928513-241928535 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056008 2:241928572-241928594 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056031 2:241928661-241928683 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056064 2:241928778-241928800 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056086 2:241928866-241928888 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056093 2:241928895-241928917 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056102 2:241928924-241928946 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056122 2:241928982-241929004 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056135 2:241929041-241929063 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056144 2:241929070-241929092 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056151 2:241929099-241929121 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056158 2:241929128-241929150 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056179 2:241929188-241929210 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056192 2:241929247-241929269 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056201 2:241929276-241929298 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056223 2:241929363-241929385 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056232 2:241929392-241929414 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056239 2:241929421-241929443 TCCTGTGAGTGGGGTGGAGTGGG - Intergenic
949056248 2:241929450-241929472 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
949056270 2:241929537-241929559 TCCTGTGAGTGGAGTGGAGTGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169625586 20:7564964-7564986 CCCTGAGACTGGGGTGGTGTAGG + Intergenic
1170443798 20:16404735-16404757 CCTTGTGACTATAATGGAGTTGG + Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171050056 20:21849455-21849477 CTGTGTGGCTAGAGTGGATTGGG + Intergenic
1173282722 20:41643719-41643741 CTGCGTGCCTGGAGTGGTGTAGG - Intergenic
1173591587 20:44229026-44229048 CCTTGTGAATCGTGTGGAGTGGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1174463667 20:50700697-50700719 CCTTGTGCCTAGAGTGGAGGGGG + Intergenic
1174568789 20:51486304-51486326 CCCTGTGGCTGGACTGGAGTTGG - Intronic
1175110846 20:56646834-56646856 CCCTGTGGCTGGAGTGGGGAGGG + Intergenic
1177143815 21:17385592-17385614 CCGTGTAACTGGAGTGGGGCAGG - Intergenic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1180137588 21:45871368-45871390 CCCTGTGACTGGGGTGGGGAAGG + Intronic
1181057627 22:20267639-20267661 CCGTGAGGCTGGGGTGGAGGCGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183046933 22:35227859-35227881 CCGTTTTATAGGAGTGGAGTAGG - Intergenic
1183805884 22:40210626-40210648 CCCTTTGACTGCAGTGGAGACGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
949797775 3:7869588-7869610 CCATGTGGCTGGTGTGCAGTGGG - Intergenic
954106622 3:48413006-48413028 CCGTGTGATGGGAGTGGGTTTGG + Intronic
954106863 3:48414196-48414218 CCGTGTGACTGGCCTGCACTCGG - Intronic
954714872 3:52521988-52522010 CCTAGTGACTGCAGGGGAGTGGG - Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
960458793 3:117907158-117907180 TCGTATGACTGGAGTACAGTGGG - Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
968579773 4:1384460-1384482 CTGTGTGACTGGTGAGGACTTGG + Intronic
969335115 4:6503232-6503254 AGGTGTGGCTGGAGTGGGGTGGG - Intronic
972521289 4:39859771-39859793 CCATGGGACAGGACTGGAGTGGG - Intronic
978723447 4:111942171-111942193 CCTTGTGAATGGATTAGAGTGGG - Intergenic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
981637806 4:146900043-146900065 ATATGTGACTAGAGTGGAGTGGG - Intronic
982829755 4:160044599-160044621 CTGTTGTACTGGAGTGGAGTAGG + Intergenic
983918338 4:173316193-173316215 ACATGGGGCTGGAGTGGAGTGGG - Intronic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986557461 5:9025845-9025867 GAATTTGACTGGAGTGGAGTAGG - Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
994081714 5:95714572-95714594 CAGTGTGACCGGAGTGGTGGAGG + Intronic
997197711 5:131990797-131990819 CTGTGTGGCAGGGGTGGAGTGGG - Intronic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
1000300172 5:159949947-159949969 GCTTGTGACAGGAGGGGAGTGGG - Intronic
1000643405 5:163732544-163732566 CCTTGTTACTGGAGTGAAGTTGG + Intergenic
1001382357 5:171312784-171312806 CGGTGTCACTGGGCTGGAGTGGG + Intergenic
1001803498 5:174563941-174563963 TTGTGGGACTGGAGTGGAGGTGG + Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002373945 5:178775135-178775157 CCCTGGTGCTGGAGTGGAGTGGG + Intergenic
1003080058 6:3014520-3014542 CCGGGTTATGGGAGTGGAGTGGG - Intronic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG + Intergenic
1004274907 6:14227459-14227481 CGGTGTGCATGCAGTGGAGTGGG - Intergenic
1004814119 6:19294028-19294050 CCCTGTGACTGTAGTGGCCTTGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1006513250 6:34532873-34532895 CCGGCAGCCTGGAGTGGAGTGGG - Exonic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1010501712 6:76609469-76609491 CCGTGGGTCTGGCATGGAGTTGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011728135 6:90231490-90231512 CAGGGTCACTGGATTGGAGTTGG - Intronic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1016920625 6:149289591-149289613 CCCAGTGGCTGGAGTGGACTGGG - Intronic
1018027444 6:159817220-159817242 CCCTGGGACTGGAGAGGTGTTGG - Intronic
1018047095 6:159975128-159975150 ACTTGTGACTGGTGTGGGGTGGG - Intronic
1018614783 6:165676618-165676640 CCATGTGCCTGGAGTGGACTAGG + Intronic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1024933799 7:54691334-54691356 ATCTGTGACTCGAGTGGAGTGGG - Intergenic
1026184529 7:68072122-68072144 CAGCCAGACTGGAGTGGAGTGGG + Intergenic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1032335228 7:131018638-131018660 TCGTGTCACTGGAGCAGAGTGGG - Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1034776599 7:153833273-153833295 GCGTATGACATGAGTGGAGTTGG - Intergenic
1037561207 8:20076117-20076139 CAGTGTGAGTGGAGTGGATGAGG - Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040533300 8:48283341-48283363 CCTGGTGACTGGGGTGGTGTAGG + Intergenic
1041136422 8:54764044-54764066 GCGTGAGTCTGGAGTGGAGGTGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044346305 8:91108320-91108342 ATGTGTGTCTGCAGTGGAGTAGG + Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1046173573 8:110545643-110545665 CCATGTGACTGCAGTAGAGTTGG - Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1049226152 8:141451470-141451492 CAGTGTCATTGGGGTGGAGTGGG + Intergenic
1050295920 9:4205133-4205155 CCCAGGGACTGGAGTGCAGTGGG - Intronic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1059422757 9:114202654-114202676 CTGTATGACTGGAATAGAGTGGG - Intronic
1059585459 9:115601308-115601330 CTGTGAGAATGGACTGGAGTAGG + Intergenic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1062104859 9:134749686-134749708 GAGTGTAACTGGAGTGTAGTTGG + Intronic
1062488405 9:136792273-136792295 CGGGGTGACGAGAGTGGAGTCGG + Exonic
1062628919 9:137454971-137454993 CTGTGTGATTGGAGTGGGGGAGG + Intronic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1188741651 X:33790751-33790773 CCCTGGGACAGGAGGGGAGTTGG - Intergenic
1190579794 X:51881253-51881275 CAGTGTGACTGTATTGGAGATGG - Intronic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1199323017 X:146463332-146463354 GTGTTTGACTGGAGTGGAGTGGG - Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic