ID: 1006812309

View in Genome Browser
Species Human (GRCh38)
Location 6:36827753-36827775
Sequence TCTCGGGCCCTTCGTCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006812309 Original CRISPR TCTCGGGCCCTTCGTCAGGG CGG (reversed) Intronic
906460677 1:46033517-46033539 TCCCTGGGCCTTAGTCAGGGAGG - Intronic
1072687903 10:97549710-97549732 TCTCGGGCCCCAGCTCAGGGAGG - Intronic
1074318334 10:112378822-112378844 TGTCAGGCCCTGCGCCAGGGAGG - Intronic
1075522940 10:123154820-123154842 TCTCGGCCCCTCCCTCTGGGGGG + Intronic
1076722421 10:132398543-132398565 GCTCGTGCCCCTCTTCAGGGAGG - Intronic
1084888355 11:72224613-72224635 TCCCGGGCCCTTCGGGAAGGTGG + Intronic
1089089826 11:115862300-115862322 CCTCGGGCCCTCTGTCAGGCGGG - Intergenic
1090433323 11:126664827-126664849 TCTTGTGCCCTTAGACAGGGGGG + Intronic
1092007629 12:5083062-5083084 TCTTGGTACCTTAGTCAGGGGGG - Intergenic
1092795603 12:12107764-12107786 TCTGGAGCCCTGGGTCAGGGAGG - Intronic
1096878580 12:54648838-54648860 TCTCTGGACCTTAGTCAGGTGGG - Intergenic
1101755217 12:107616276-107616298 TCGCTGGCCCTGCGGCAGGGTGG - Intronic
1106188401 13:27428347-27428369 TCTCGGTCCCTTCCTCTGGCTGG + Intronic
1109537591 13:63739402-63739424 TCTCTGTCCCCTCGTCACGGGGG + Intergenic
1110195420 13:72782455-72782477 TCTCGGGCCCTTTGTAATCGAGG + Intronic
1121133759 14:91475093-91475115 TCTCAGGTCCTTCTTAAGGGAGG - Intronic
1121473605 14:94174760-94174782 TCTCGGACCCTTCCTCAGAGCGG + Intronic
1125735261 15:41920379-41920401 TCTCAGGCCTTTCCCCAGGGAGG + Intronic
1131036436 15:89225493-89225515 TCTTGGGCCCTTCCCCAGAGAGG + Intergenic
1135910993 16:26560646-26560668 TCTGGGCCCATTAGTCAGGGAGG - Intergenic
1140940866 16:79720671-79720693 TCTTGAGTCCTTTGTCAGGGTGG - Intergenic
1141788970 16:86220101-86220123 CCTCGGGCCCTTCGGAAGGAGGG - Intergenic
1142142868 16:88480306-88480328 TCTCTGGCACCTCGTGAGGGTGG + Intronic
1142283402 16:89160902-89160924 CCTCGGTCCCTGCGTCAGTGCGG + Intergenic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146931273 17:36779928-36779950 TCTCTGGCCTTTCTGCAGGGAGG + Intergenic
1151183153 17:72344154-72344176 TCTCGGGCCCTTAGGGAGTGAGG - Intergenic
1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG + Intronic
1152610705 17:81313882-81313904 CCTCGGGCCCTGCAGCAGGGTGG + Exonic
1155928060 18:31678807-31678829 CCTTGGGCCCTTGGACAGGGGGG + Intronic
1157614093 18:48976537-48976559 CCTCGGTCCCTTCCCCAGGGAGG - Intergenic
1161028288 19:2046589-2046611 CCTCGGGCCCCTCACCAGGGCGG + Exonic
1165431720 19:35776702-35776724 TCTGGGGCCCTCCTTCTGGGAGG + Intronic
1165713467 19:38028454-38028476 TCTCTGTCCCCTCGTCCGGGAGG + Intronic
930549178 2:52810037-52810059 TCCTGGGCCCTGCTTCAGGGAGG - Intergenic
931005987 2:57850389-57850411 TCTGGGGGTCTTCGTCATGGTGG + Intergenic
932667406 2:73708382-73708404 ACTCGGGCCCTTCTTCTTGGTGG - Intergenic
933967733 2:87443574-87443596 TCTCAGGCCCTCAGTCAGGCTGG + Intergenic
936326066 2:111506922-111506944 TCTCAGGCCCTCAGTCAGGCTGG - Intergenic
938682673 2:133707395-133707417 TCTCATTCCCTTGGTCAGGGTGG - Intergenic
939252926 2:139706138-139706160 GCTGGGGCCCTTAGTCATGGAGG - Intergenic
1169538977 20:6579704-6579726 TCTCAGGCACTTCGGCAGCGTGG - Intergenic
1172080188 20:32334367-32334389 TCTGGCGCCCTTGGTCATGGAGG - Exonic
1174589292 20:51632478-51632500 TCTCAGGCCCTTCCTCAGGTGGG + Intronic
1176046456 20:63095304-63095326 TCTCGGGCCCTTCAACATAGAGG + Intergenic
1176140444 20:63542570-63542592 CCTCGGGGCCTTCTGCAGGGAGG + Exonic
1181343527 22:22200916-22200938 TCTCAGGCCCTTCCTGAGGAAGG - Intergenic
1181538146 22:23557460-23557482 TTTTGGGCCCTTGGTCAAGGTGG - Intergenic
1181979651 22:26757005-26757027 GCTCGGGCCATCCGTCAGGCTGG - Intergenic
1184817742 22:46884897-46884919 TCTCGGCCTCTTGGTCAGAGAGG + Intronic
952952126 3:38533572-38533594 TGACAGGCCCTTCGGCAGGGAGG + Intronic
954444818 3:50540917-50540939 TCTCAGCCCCTGCGTCAGGGAGG - Intergenic
955392487 3:58531617-58531639 TCTGGGGCCCCAGGTCAGGGAGG + Intronic
967858951 3:194137574-194137596 TCACGGGCGCATGGTCAGGGAGG + Intronic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
997241210 5:132309461-132309483 TCTTGGGCCCCTCTTCAGGGAGG + Intronic
1002170909 5:177373732-177373754 TCTGGGGCCCTCCTTCTGGGAGG - Intergenic
1003568996 6:7243751-7243773 TCTCGGGCCCTTCCTTTGCGCGG - Intronic
1006812309 6:36827753-36827775 TCTCGGGCCCTTCGTCAGGGCGG - Intronic
1013273103 6:108560546-108560568 GCTCGGGCCATTCGACCGGGTGG + Intronic
1041710971 8:60894134-60894156 CCTTGGTCCCTTGGTCAGGGTGG - Intergenic
1042123334 8:65511751-65511773 GCTCGGACCCTGCTTCAGGGCGG - Intergenic
1049446973 8:142635673-142635695 TCTCTGGCCCTTTGGCAGAGGGG - Intergenic
1049688135 8:143947190-143947212 TCTGTGGCCCTGCGTCAAGGAGG - Intronic
1049741296 8:144242262-144242284 GCTCTGGCCCTTCTTCTGGGAGG + Intronic
1051170744 9:14315906-14315928 TCGCGGGCCCATCCCCAGGGCGG + Intronic
1060995666 9:127873872-127873894 TCTCTGCCCCTTCCCCAGGGAGG + Intronic
1197648527 X:129041718-129041740 TCTGGCGCTCTTCCTCAGGGCGG + Intergenic