ID: 1006812381

View in Genome Browser
Species Human (GRCh38)
Location 6:36828205-36828227
Sequence AGCTACTCGGGACTCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13556
Summary {0: 1, 1: 1, 2: 68, 3: 1120, 4: 12366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006812374_1006812381 22 Left 1006812374 6:36828160-36828182 CCCATCTGGGGGAGCTTAAGAAA 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1006812381 6:36828205-36828227 AGCTACTCGGGACTCCAAGGAGG 0: 1
1: 1
2: 68
3: 1120
4: 12366
1006812373_1006812381 25 Left 1006812373 6:36828157-36828179 CCTCCCATCTGGGGGAGCTTAAG 0: 1
1: 0
2: 0
3: 16
4: 98
Right 1006812381 6:36828205-36828227 AGCTACTCGGGACTCCAAGGAGG 0: 1
1: 1
2: 68
3: 1120
4: 12366
1006812375_1006812381 21 Left 1006812375 6:36828161-36828183 CCATCTGGGGGAGCTTAAGAAAG 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1006812381 6:36828205-36828227 AGCTACTCGGGACTCCAAGGAGG 0: 1
1: 1
2: 68
3: 1120
4: 12366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006812381 Original CRISPR AGCTACTCGGGACTCCAAGG AGG Intronic
Too many off-targets to display for this crispr