ID: 1006813353

View in Genome Browser
Species Human (GRCh38)
Location 6:36835115-36835137
Sequence CGCCCCGCCGCGTCTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006813350_1006813353 11 Left 1006813350 6:36835081-36835103 CCAGCAGGGCTAAGCAATGGGCT 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1006813353 6:36835115-36835137 CGCCCCGCCGCGTCTTCCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006813353 Original CRISPR CGCCCCGCCGCGTCTTCCCT GGG Intronic
900266130 1:1758085-1758107 AGCCCCGCTGCGCCCTCCCTTGG - Intronic
900338067 1:2174578-2174600 AGTCCCGCCGGGTCCTCCCTGGG - Intronic
900373576 1:2343382-2343404 TGCCCCGCAGCGTCATCCCCAGG - Intronic
900493829 1:2967192-2967214 CGCCCAGAAGCATCTTCCCTGGG + Intergenic
901634202 1:10663161-10663183 CCCCCAGCCACGCCTTCCCTTGG - Intronic
901798123 1:11692042-11692064 CTCCTCGCCGCGTCTGCCCACGG + Intronic
903078026 1:20787073-20787095 CGCCCCGCCCCCTCCTCTCTGGG + Intronic
904837537 1:33349272-33349294 CCCGCCGCTGCGACTTCCCTGGG - Intronic
910232010 1:84997184-84997206 CGCCCCGCCGCCTCCTACCGGGG + Intergenic
919463242 1:197902937-197902959 CGCCCCGCCGCGGCCGCCCCGGG + Intronic
1065046897 10:21753398-21753420 CGGCCCGCCACGTCCTCCGTGGG - Intergenic
1069990207 10:72310550-72310572 CGCCCTCCCCCGTCTTCCCCTGG + Intergenic
1072491184 10:95907602-95907624 CGCCCCGCAGCGTCCTCCCCGGG + Intronic
1074762079 10:116674752-116674774 CGCCCCGCTGCCTGTCCCCTTGG - Exonic
1076692317 10:132230139-132230161 CGCCCCGCCCCGCCCTCCCAAGG - Intronic
1077326065 11:1964642-1964664 CGCCCTGCCCCGTTCTCCCTGGG + Intronic
1077487554 11:2846034-2846056 CACCCAGCAGCATCTTCCCTGGG + Intronic
1086306287 11:85484242-85484264 CGCCCCTCCTCCTCCTCCCTAGG + Intronic
1089292810 11:117448529-117448551 TGCCCCGCGGCTTCTTCCCGTGG - Intronic
1091225952 11:133956566-133956588 CTCCCCGGCGCGCCTTCCCGCGG - Intronic
1202809045 11_KI270721v1_random:19821-19843 CGCCCTGCCCCGTTCTCCCTGGG + Intergenic
1092344721 12:7705933-7705955 CGCCCCGCGGCGTCCCGCCTAGG + Intergenic
1094411121 12:30169841-30169863 CTCCCCGCCGCGCCTTGGCTGGG - Intergenic
1107835591 13:44410205-44410227 AGCCCCTCAGAGTCTTCCCTGGG + Intergenic
1122397417 14:101443250-101443272 CACCACGCCGGGCCTTCCCTAGG - Intergenic
1122947618 14:105020506-105020528 CGGCCAGCGCCGTCTTCCCTGGG - Intronic
1124169351 15:27358963-27358985 CGCCCCGCCGGGTCCTCCCCAGG - Intronic
1125599213 15:40906494-40906516 CGCCCCGCCGAGTCTGCAGTGGG + Intergenic
1127606540 15:60592609-60592631 CGCCCCTCCGCTTCCTCCCGGGG + Intronic
1128374459 15:67065501-67065523 CGCCCCGCCACCTCCTCCCGCGG - Intronic
1130371103 15:83285466-83285488 AGCCCCTCCGCGTCTACTCTCGG - Intergenic
1134230125 16:12422547-12422569 CTTCCCTCCTCGTCTTCCCTGGG + Intronic
1136401493 16:30021665-30021687 CGCCCCGCTGCGCCTTTCCTAGG + Intronic
1136455661 16:30378406-30378428 CGCCCCGCCCGGCCTTACCTCGG - Exonic
1140664108 16:77212787-77212809 CGTCCGCCCGCGTCTGCCCTAGG - Intronic
1142550102 17:732913-732935 AGCCCCTCCGCGTCCTCCCCTGG + Intronic
1143104157 17:4520041-4520063 TGCCCCTCAGTGTCTTCCCTTGG - Intronic
1143551731 17:7634515-7634537 CCCCCTGCTGCTTCTTCCCTGGG - Intergenic
1144369352 17:14575301-14575323 GGGCCCCCCTCGTCTTCCCTGGG + Intergenic
1144656859 17:17042503-17042525 CGCGCCGCCGCAGCTGCCCTCGG - Intergenic
1148329747 17:46806740-46806762 CTCCCCTCCGCTTCTGCCCTTGG - Intronic
1149304538 17:55335274-55335296 AGCCCATCCGCCTCTTCCCTGGG + Intergenic
1151453312 17:74212390-74212412 AGCCCCGCCCCGTCCTCCCGGGG + Intergenic
1151662398 17:75525737-75525759 CGCTCCGCCGCGCCTGCCCACGG - Exonic
1154210877 18:12377452-12377474 CGCCCTCCCGAGTCCTCCCTCGG - Intergenic
1158434655 18:57427755-57427777 AGCCCGGCCGCGGCCTCCCTAGG + Intergenic
1161128867 19:2576415-2576437 CGGCCCGCCCTGTCCTCCCTGGG - Intronic
1161266348 19:3366493-3366515 CTCCTCGCCGCCTCCTCCCTCGG - Intronic
1161333839 19:3700471-3700493 CGGCCCGGCGCGCCCTCCCTTGG - Exonic
1161963629 19:7535873-7535895 CGTCCCGCCGAGCCTTCCCCGGG - Exonic
1162800159 19:13105606-13105628 CGCCCCACCCCTGCTTCCCTAGG - Exonic
1163473737 19:17512712-17512734 CGCCCCTCCCACTCTTCCCTCGG - Intronic
1165859390 19:38899413-38899435 CGCCCCACCGCGGCCACCCTTGG + Intronic
1166081181 19:40444737-40444759 CGCGCCCCAGCGTCCTCCCTCGG - Intergenic
1166303095 19:41923006-41923028 CCCCCTCCCGCCTCTTCCCTAGG - Intronic
1167008232 19:46788785-46788807 GGCCCCGCCCCGTCGTCTCTGGG - Intergenic
925953368 2:8937067-8937089 CACCCCTCTGCTTCTTCCCTGGG + Intronic
930529683 2:52573019-52573041 CGCTCTGCCGCCTCCTCCCTGGG - Intergenic
932331660 2:70901375-70901397 CGTCCCGCGCCGTCTCCCCTGGG - Intronic
934753731 2:96810870-96810892 TGCCCTGGCGCCTCTTCCCTGGG + Exonic
938637968 2:133249789-133249811 CGCCCCACCTTGTGTTCCCTTGG - Intronic
944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG + Intronic
948607203 2:239143746-239143768 AGCCCCTCCCCGGCTTCCCTAGG + Intronic
1172702830 20:36863390-36863412 CGCCCGGCCTCGACGTCCCTGGG + Exonic
1173308581 20:41875286-41875308 CGCCCTGCCCCATCTCCCCTTGG + Intergenic
1183821069 22:40346472-40346494 CGCCCCGCCCCGTCCTGCCCTGG + Intergenic
1184046756 22:41976871-41976893 CGCGCCGCCGCGCCCTCCCCGGG - Exonic
950660909 3:14466569-14466591 CGCCCGGCAGCGTCAGCCCTCGG - Exonic
969533272 4:7740994-7741016 CGCCCTACCCCGTCTGCCCTGGG - Exonic
970593350 4:17577866-17577888 CCCACCGCCGCGTCTTTCCCCGG - Intronic
985974110 5:3401762-3401784 CGGCCCACTGCCTCTTCCCTGGG - Intergenic
986506635 5:8458132-8458154 CTGCCCGCCGCGTCGTCCCTGGG + Intergenic
1000752599 5:165115114-165115136 CTTCCCGCCTCGGCTTCCCTAGG - Intergenic
1006813353 6:36835115-36835137 CGCCCCGCCGCGTCTTCCCTGGG + Intronic
1011075101 6:83430770-83430792 CGCCCCTCCGCCGCTCCCCTGGG - Intronic
1013144512 6:107374661-107374683 CGTCCAGCACCGTCTTCCCTAGG - Intronic
1015683510 6:135834197-135834219 CCCCCCGCCCCGTCCTCCTTAGG + Intergenic
1019324513 7:431698-431720 GGCCCCACCTCCTCTTCCCTTGG - Intergenic
1019453252 7:1110512-1110534 CCTCCCGCCACGTCTTCCCATGG + Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1024965555 7:55019754-55019776 CGCCCCGCGCTGTCTTCCCAGGG + Intronic
1025052358 7:55741775-55741797 CGCCCCACCGCGGCTTCCCGGGG + Intergenic
1029113128 7:98223526-98223548 CTCCCCACTGCTTCTTCCCTTGG + Intronic
1034977805 7:155458260-155458282 CACCCCGCCGAGTCTTCCGAGGG - Exonic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049535350 8:143177954-143177976 CCCGCCCCCGCGGCTTCCCTGGG + Intergenic
1056264117 9:84878938-84878960 CTCACTGCCTCGTCTTCCCTTGG + Intronic
1061975755 9:134067495-134067517 TCCCCCTCCGCGTCCTCCCTGGG + Intronic
1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG + Exonic
1062517630 9:136944289-136944311 CTCTCCGCCGCGTCATCCCCCGG + Intronic
1197774291 X:130109983-130110005 CGCCCCACCTCCTCTGCCCTCGG + Intronic
1201764474 Y:17565261-17565283 AGCCTCGCCGCTTCTTTCCTCGG + Intergenic
1201837079 Y:18340729-18340751 AGCCTCGCCGCTTCTTTCCTCGG - Intergenic