ID: 1006814337

View in Genome Browser
Species Human (GRCh38)
Location 6:36840127-36840149
Sequence TGTGCGCGCGTGGCGGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006814337 Original CRISPR TGTGCGCGCGTGGCGGGCCG GGG Intergenic
902214289 1:14924576-14924598 GGTGCGCGCGGGGCGGGGCGGGG + Intronic
903389481 1:22953858-22953880 CGTGCGCGCGCGCCTGGCCGCGG - Exonic
903750227 1:25616847-25616869 TGTGCGCGCGTGTGGGGCGCAGG + Intergenic
906614605 1:47225706-47225728 TGGGCGCGCGCGGAGGCCCGGGG - Exonic
914490813 1:148149114-148149136 TGCGCGCGCGTTGGAGGCCGCGG + Intronic
914869154 1:151458903-151458925 TGTGCGTGCGCCCCGGGCCGCGG - Intronic
921389721 1:214606104-214606126 TGCGCGCGCGTCGGAGGCCGCGG - Intronic
922757077 1:228102605-228102627 GGGGGGCGCGTGGAGGGCCGTGG - Intronic
922917650 1:229271390-229271412 GGGGCGCGCGGGTCGGGCCGCGG + Intronic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1063115538 10:3068977-3068999 TGAGCGCGCGGGGCGGGCGCGGG + Intronic
1070150251 10:73800874-73800896 TGTGCGTGCGCGGGGGGCGGAGG + Intronic
1070328772 10:75403840-75403862 TGTGCCCGCGTGGGGGGCGGGGG + Intergenic
1071579468 10:86756506-86756528 GGTGCGCGCGGCGCGGGCGGGGG + Intergenic
1076878766 10:133230136-133230158 GGGGCGCGCGGGGCGGGGCGGGG + Intergenic
1077052979 11:576034-576056 TGCGGGCGCGAGGCGGGGCGGGG + Intergenic
1077495767 11:2885917-2885939 GGTGCGCGGGGGCCGGGCCGCGG - Intergenic
1077675608 11:4191149-4191171 TGTGGGCACTTGGCAGGCCGAGG + Intergenic
1078594427 11:12674501-12674523 TGGGCGCCCGCGGCGGGCGGCGG - Intergenic
1083607346 11:63986752-63986774 TGTGCGCCCGGGGCGGGGCCTGG + Intronic
1083885631 11:65572295-65572317 TGTGGGGGCGGGGCGGGGCGCGG + Intronic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084151230 11:67288954-67288976 CGCGCGTGCGCGGCGGGCCGCGG - Intronic
1087118194 11:94545287-94545309 TGTTCGGCCGGGGCGGGCCGGGG + Exonic
1089564498 11:119363765-119363787 TAGGGGCGCGTGGCGGGCAGAGG + Intronic
1091450767 12:570737-570759 TGTGCGCTTGTGGCGGGTGGAGG - Intronic
1092743266 12:11649958-11649980 GGAGCGCGCGGGGCGGGGCGGGG - Exonic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1096847900 12:54418201-54418223 TGTGCGCGCGTGAAGGGGGGTGG - Intronic
1104676587 12:130715549-130715571 TGTGCGCGGGCTGCTGGCCGGGG - Intronic
1105571168 13:21604105-21604127 TGCGCGCGGGTGGCGGCCTGGGG - Exonic
1106269484 13:28139096-28139118 TTTTCGGGCGGGGCGGGCCGCGG + Intronic
1112365646 13:98752830-98752852 CGGGAGCGCGTGGCAGGCCGGGG + Intergenic
1113737649 13:112689930-112689952 TGTGGGCGCGGGGCCGGCGGGGG + Intergenic
1113789050 13:113017715-113017737 TGTGCAGGAGTGGCGGGCGGGGG - Intronic
1118926140 14:70191096-70191118 TGTGCGGGGGTGGCGGGGTGGGG + Intergenic
1121562457 14:94885447-94885469 TGTGGGCCCTTGGAGGGCCGGGG - Intergenic
1122231098 14:100306606-100306628 CGTGCGCGGGAGGCGGGGCGCGG + Intergenic
1123004543 14:105314945-105314967 TGAGCGCGCCGGGCGCGCCGGGG - Exonic
1123991650 15:25687943-25687965 AGTGCGAGCGTGGCCGGCCAGGG + Intronic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1124652358 15:31483423-31483445 AGTGCGGCCGTGGCGGCCCGGGG - Exonic
1127142738 15:55993774-55993796 GGGGCGCGCGTGGCGGGGCTCGG + Intergenic
1132478486 16:154110-154132 GGTGCGGGCGGGGCGGGACGGGG + Intronic
1132478501 16:154141-154163 GGTGCGGGCGGGGCGGGGCGGGG + Intronic
1132480572 16:164700-164722 GGTGCGGGCGGGGCGGGGCGGGG + Intronic
1132579310 16:677825-677847 TGTGGGCCCGAGGCGGGCAGCGG - Exonic
1132652743 16:1028924-1028946 TGTGCGGGTGTGGGGGGCCGGGG + Intergenic
1132683434 16:1152974-1152996 GGCGCGCGCGTCTCGGGCCGGGG + Intergenic
1137531763 16:49282408-49282430 CGTGCGCGCGCGGCGGGGCGGGG + Intergenic
1141688600 16:85584140-85584162 TGTGCGTGCGTGCCGGTGCGTGG + Intergenic
1141775153 16:86117996-86118018 TGTGAGTGCGTGTCGGGGCGAGG + Intergenic
1141936346 16:87241321-87241343 AGTGCGCGCAGGGCTGGCCGGGG + Intronic
1142156183 16:88533812-88533834 GGGGCGCGCGGGCCGGGCCGGGG - Exonic
1145191396 17:20843710-20843732 TGTGCGCGCGTCGGAGGCCGCGG + Intronic
1145318693 17:21750225-21750247 TGTGCGTGCCAGGCTGGCCGGGG + Intergenic
1147620816 17:41865452-41865474 AGTGCGCGCGGGGCGGGGCCAGG + Intergenic
1147651399 17:42064044-42064066 TGTGCGCGCGTTGGGGGACAGGG - Intronic
1150802434 17:68292216-68292238 TGCGCGCGCGCCCCGGGCCGGGG - Intronic
1151708400 17:75784999-75785021 CGTGCGCGCGCGGCGGGGGGGGG - Intronic
1152466656 17:80470459-80470481 TGTGCGTGCGTGGCTGGGGGAGG - Exonic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153565676 18:6414962-6414984 CATGCGCGCGGGGCGGGCAGGGG - Intronic
1153844768 18:9039305-9039327 TGTGTGTGTGTGGCGGGGCGGGG - Intergenic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1157162259 18:45324747-45324769 TGTGCGGGGGTGGGGGGCGGTGG - Intronic
1160499805 18:79396057-79396079 TGTGCGCGCGTGGCGGGGCCCGG - Intronic
1160739638 19:680007-680029 GGTGCGCGCGGGCCGGGGCGGGG - Intronic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1160966048 19:1747407-1747429 TGTGTGTGTGTGGCGGGCGGTGG - Intergenic
1160994806 19:1877712-1877734 TGCGCGCGCGTCGGAGGCCGCGG - Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1161104155 19:2434937-2434959 TGCGGGCGCGGGGCGGGGCGGGG + Intronic
1161203681 19:3029332-3029354 GGTGGGCGCGGGGCGGGCCGCGG - Intronic
1162932479 19:13963836-13963858 GGTGAGCGCGGGGCGGGGCGGGG - Exonic
1162993285 19:14317354-14317376 TGTGCGCGTGCCGCCGGCCGTGG - Intergenic
1163829682 19:19541708-19541730 TGTGTGGGCGTGGGGGACCGGGG - Intronic
1164356622 19:27441241-27441263 TGTGAGCGCTTGGAGGGCTGTGG + Intergenic
1165832277 19:38735864-38735886 TCTGCGGGCGGGGCGGGGCGGGG + Intronic
1166039192 19:40191812-40191834 TGTACGGGCGGGGCGGGGCGGGG - Exonic
924988250 2:289373-289395 TGTGCGCACCTCGGGGGCCGTGG - Intergenic
926581429 2:14634954-14634976 CGGACGCGCGTGGCGGGGCGGGG - Exonic
927129483 2:20046194-20046216 TGTCAGCGGGTGGCGGGCTGGGG + Intronic
931763608 2:65436215-65436237 TGCGCGCGCCTCGCGGGGCGGGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935046813 2:99490083-99490105 TGTGAGCGCGAGCGGGGCCGGGG - Intergenic
942453915 2:176124811-176124833 TGGGCTCGCGTGGGCGGCCGCGG + Exonic
942458335 2:176152491-176152513 GGAGCGCGCGGGGAGGGCCGCGG + Intronic
942653843 2:178194746-178194768 TGTGCGCCTCCGGCGGGCCGAGG + Intronic
945225864 2:207530438-207530460 TGTGTGCGGGCGGCCGGCCGCGG + Intronic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
947992403 2:234497450-234497472 TGTGGGCGCGAGGCGGGGCAGGG + Intergenic
948892477 2:240914200-240914222 TGTGCGCGAGTGGGGGCCCAAGG + Intergenic
1171346591 20:24470156-24470178 TGAGGGCGCGCGGCGGGCCAAGG + Intronic
1173548139 20:43914785-43914807 CGAGCGCGGGGGGCGGGCCGGGG - Intergenic
1174607109 20:51768706-51768728 TGGGCGCGCGTGGGGGGCGCGGG - Intergenic
1175889025 20:62307914-62307936 TGTGCGCGCCTGGGGTGCTGGGG + Intronic
1176062208 20:63177394-63177416 GGAGCGCGCGGGGCGGGACGCGG + Intergenic
1176097396 20:63350396-63350418 TGTGCGTGCGTGGCGAGCGGTGG + Exonic
1178488463 21:33033241-33033263 TGGGCGCGCGGCGCGGGCGGAGG + Intergenic
1179882663 21:44300025-44300047 GGCGCGCGCGGGGCGGGGCGGGG + Intergenic
1180908368 22:19431583-19431605 TGAGGGCGCGGGGCGGGCGGCGG - Exonic
1183823953 22:40370582-40370604 AGCGCACGCGTGGCGGGGCGTGG - Intronic
1184043438 22:41957936-41957958 TGGGCGGGCGGGGCGGGCTGGGG - Intergenic
949552423 3:5122338-5122360 TGTCCGCCCGTGTCGCGCCGGGG + Exonic
950720504 3:14879264-14879286 TGTGCAGGCGTGGCTGGCAGCGG - Intronic
951544428 3:23810625-23810647 GGTGCCCGAGTGGCGGGCGGGGG + Intronic
955228455 3:57079344-57079366 CGTGGGCGGGAGGCGGGCCGGGG + Intergenic
956675074 3:71725444-71725466 GGGGCGCGCGGGGCGGGGCGGGG - Intronic
961545508 3:127630002-127630024 TGTGGGTGCGTGGCGGGCTGGGG + Intronic
961827241 3:129605585-129605607 TGCGCGGGCGGCGCGGGCCGCGG - Exonic
965558135 3:170038074-170038096 GGAGCGCGCGGGGCGGGGCGGGG + Exonic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
968534135 4:1113103-1113125 CGGGGGCGCGTGGGGGGCCGAGG - Intronic
968541654 4:1171241-1171263 GGTGAGCGCGGGGCCGGCCGGGG - Exonic
968913103 4:3485664-3485686 TGTGGGAGCCTGGCCGGCCGGGG + Intronic
972380587 4:38516025-38516047 TGTGTGTGTGTGGCGGGCGGGGG - Intergenic
975683518 4:76898004-76898026 TGAGCGCGCCAGGAGGGCCGTGG + Exonic
985994734 5:3591635-3591657 TCTGCGCGCGAGTCGGGGCGCGG + Intergenic
986748041 5:10761181-10761203 CGCGCGCGCGTGGGGCGCCGGGG + Exonic
987186492 5:15425684-15425706 TGTGTGCGTGTGACGAGCCGTGG - Intergenic
989637905 5:43556512-43556534 TCGGCACGCGTGGAGGGCCGTGG + Intronic
992067402 5:73120507-73120529 TGCGCGGGCGCGGCGGCCCGGGG - Exonic
993904145 5:93604451-93604473 TGTGTGCGCTGGGAGGGCCGCGG + Intergenic
995724366 5:115169126-115169148 TGCCCGCGGGGGGCGGGCCGGGG - Intronic
995735679 5:115296886-115296908 TGTGGGGGCGGGGCGGGGCGGGG + Intergenic
1002139856 5:177132370-177132392 TGTGCGTGCGCGCCGGGCTGGGG - Intergenic
1002928779 6:1619812-1619834 CGGGCGGGAGTGGCGGGCCGCGG - Intergenic
1004224012 6:13769920-13769942 CGGTCGCGCGTGGCGGGCAGGGG - Intergenic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1004690336 6:17987665-17987687 CGGGCGCGCGGGGCGGGGCGCGG + Intergenic
1006814337 6:36840127-36840149 TGTGCGCGCGTGGCGGGCCGGGG + Intergenic
1007424259 6:41736503-41736525 GGTGGGTGGGTGGCGGGCCGGGG - Intergenic
1008952203 6:57172882-57172904 AGGCCGCGTGTGGCGGGCCGGGG + Intronic
1011518558 6:88179554-88179576 TTTGTGTGCGTTGCGGGCCGGGG - Intergenic
1017282128 6:152636849-152636871 TGAGCGCGGGCGCCGGGCCGCGG - Intronic
1017725777 6:157275044-157275066 CGAGCGCGCGGGGAGGGCCGAGG + Intergenic
1019726988 7:2608210-2608232 TGGGGGCCCGTGGCGGGCGGAGG + Intronic
1020169414 7:5833418-5833440 TGTGCCCGCGAGGCGGGGGGTGG + Intergenic
1025007414 7:55365511-55365533 TGTGTGCGCGTCGCCGACCGGGG - Exonic
1029496327 7:100896994-100897016 TGCGCGCGCGCGGCGGTGCGGGG + Intergenic
1030983255 7:116210740-116210762 GGGGCGCTCGTGGCGGGCGGCGG + Intronic
1033306732 7:140230801-140230823 GGGGCGCGCGGGCCGGGCCGTGG + Intergenic
1035432062 7:158829633-158829655 TCATCGCGCGGGGCGGGCCGTGG + Intronic
1037260441 8:17001874-17001896 GGAGCGCGCGCGGCGGGCCGGGG - Exonic
1037855280 8:22367199-22367221 GGGGCGAGCGGGGCGGGCCGGGG + Intergenic
1038205054 8:25458164-25458186 TGAGGGGGCGCGGCGGGCCGGGG - Intronic
1041068090 8:54101655-54101677 TGCGGGCGCGTGGCGGCCTGCGG - Intronic
1043873959 8:85464195-85464217 TGTGCGGGCGCTGCGGGCCCCGG - Intronic
1044734801 8:95268747-95268769 TCTGCGGGCGGGGCGGGGCGGGG + Intronic
1049452502 8:142669793-142669815 CGGGCGCGCGGGGCGGGGCGGGG - Intronic
1049765787 8:144354595-144354617 GGTGCGCGCGAGGCTGGGCGGGG - Exonic
1049798854 8:144508672-144508694 AGCGCGCACGTGGCGGGGCGGGG + Intergenic
1055611831 9:78031764-78031786 TCTGCGCGCGAGCCGGGCGGTGG - Intergenic
1057623312 9:96655348-96655370 TGGGCGCGGGGGGCGGGGCGGGG + Intergenic
1057995633 9:99820042-99820064 AGGGCGCGCGGGGCGGGGCGGGG - Intergenic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1059191840 9:112333848-112333870 CGCGCGCGCGCGCCGGGCCGAGG - Intergenic
1060985192 9:127815659-127815681 TGGGCGAGCGCGGGGGGCCGGGG + Exonic
1061108734 9:128552346-128552368 GGTGAGCGAGGGGCGGGCCGCGG - Intergenic
1061517180 9:131096690-131096712 TGTGCGCGCCGGGCGGACCGCGG + Intronic
1062516772 9:136940785-136940807 TGTGAGCGTGTGGCGGGGCCTGG + Exonic
1062646758 9:137551773-137551795 GGAGCGCGCGGGGCGGGGCGGGG - Exonic
1185894210 X:3843667-3843689 GGTGCGCGCGCGGCCGGGCGCGG + Exonic
1185899329 X:3882091-3882113 GGTGCGCGCGCGGCCGGGCGCGG + Intergenic
1185904446 X:3920520-3920542 GGTGCGCGCGCGGCCGGGCGCGG + Intergenic
1187281464 X:17860986-17861008 TGGGCGCGCCTGGCGGGGCCCGG - Intronic
1199469812 X:148181885-148181907 TGTGCGAGCGTGGTGGGGGGAGG - Intergenic
1200229439 X:154436844-154436866 GGCGCGCGCGGGGCGGGGCGGGG + Intergenic
1200249822 X:154546959-154546981 CGTGCGGGCGGGGCGGGGCGAGG + Exonic