ID: 1006814554

View in Genome Browser
Species Human (GRCh38)
Location 6:36841008-36841030
Sequence GAAGCCGATGTGCCTCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006814543_1006814554 20 Left 1006814543 6:36840965-36840987 CCGAGCTGGAACCTCCACTTCCT No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data
1006814545_1006814554 6 Left 1006814545 6:36840979-36841001 CCACTTCCTCGCCCACCGCCTGG No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data
1006814548_1006814554 -5 Left 1006814548 6:36840990-36841012 CCCACCGCCTGGCACATCGAAGC No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data
1006814550_1006814554 -9 Left 1006814550 6:36840994-36841016 CCGCCTGGCACATCGAAGCCGAT No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data
1006814549_1006814554 -6 Left 1006814549 6:36840991-36841013 CCACCGCCTGGCACATCGAAGCC No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data
1006814544_1006814554 9 Left 1006814544 6:36840976-36840998 CCTCCACTTCCTCGCCCACCGCC No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data
1006814547_1006814554 0 Left 1006814547 6:36840985-36841007 CCTCGCCCACCGCCTGGCACATC No data
Right 1006814554 6:36841008-36841030 GAAGCCGATGTGCCTCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006814554 Original CRISPR GAAGCCGATGTGCCTCGGGC CGG Intergenic
No off target data available for this crispr