ID: 1006815110

View in Genome Browser
Species Human (GRCh38)
Location 6:36844835-36844857
Sequence AGTTTGTTCTAGGTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006815110_1006815114 2 Left 1006815110 6:36844835-36844857 CCATGCTGCACCTAGAACAAACT No data
Right 1006815114 6:36844860-36844882 AAAAAGGCATTCTCTACTGTGGG No data
1006815110_1006815115 23 Left 1006815110 6:36844835-36844857 CCATGCTGCACCTAGAACAAACT No data
Right 1006815115 6:36844881-36844903 GGTAAATGCAACCTTGAGTCAGG No data
1006815110_1006815116 27 Left 1006815110 6:36844835-36844857 CCATGCTGCACCTAGAACAAACT No data
Right 1006815116 6:36844885-36844907 AATGCAACCTTGAGTCAGGCAGG No data
1006815110_1006815113 1 Left 1006815110 6:36844835-36844857 CCATGCTGCACCTAGAACAAACT No data
Right 1006815113 6:36844859-36844881 GAAAAAGGCATTCTCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006815110 Original CRISPR AGTTTGTTCTAGGTGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr