ID: 1006815575

View in Genome Browser
Species Human (GRCh38)
Location 6:36847674-36847696
Sequence CTCAGCCTCTGCCATGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006815571_1006815575 -10 Left 1006815571 6:36847661-36847683 CCTGTCCAGAAGCCTCAGCCTCT No data
Right 1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG No data
1006815569_1006815575 8 Left 1006815569 6:36847643-36847665 CCTGACCTGACTCAGGGGCCTGT No data
Right 1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG No data
1006815570_1006815575 3 Left 1006815570 6:36847648-36847670 CCTGACTCAGGGGCCTGTCCAGA No data
Right 1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG No data
1006815564_1006815575 17 Left 1006815564 6:36847634-36847656 CCTCTGCTCCCTGACCTGACTCA No data
Right 1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG No data
1006815568_1006815575 9 Left 1006815568 6:36847642-36847664 CCCTGACCTGACTCAGGGGCCTG No data
Right 1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG No data
1006815563_1006815575 30 Left 1006815563 6:36847621-36847643 CCTTAGGACAGTGCCTCTGCTCC No data
Right 1006815575 6:36847674-36847696 CTCAGCCTCTGCCATGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006815575 Original CRISPR CTCAGCCTCTGCCATGGCCC AGG Intergenic
No off target data available for this crispr