ID: 1006818532

View in Genome Browser
Species Human (GRCh38)
Location 6:36871217-36871239
Sequence ATAAAGCAGGAAAAGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 3, 2: 7, 3: 58, 4: 454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006818532_1006818537 10 Left 1006818532 6:36871217-36871239 CCCACACCCTTTTCCTGCTTTAT 0: 1
1: 3
2: 7
3: 58
4: 454
Right 1006818537 6:36871250-36871272 AATTCTGTCTCTTTGTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006818532 Original CRISPR ATAAAGCAGGAAAAGGGTGT GGG (reversed) Intronic
901593833 1:10369160-10369182 ATAAAGCAGGAAAGAGGTGTAGG - Intronic
901661194 1:10798894-10798916 TTAATGCAGGAAAAGGGCCTGGG + Intergenic
901739555 1:11333401-11333423 ATAAAACAGGAAAAGGAGATAGG - Intergenic
901946913 1:12711658-12711680 ATACAACAGGAAAAGGATGAAGG - Intergenic
903679538 1:25087898-25087920 ATCAGGCAGGACAATGGTGTTGG + Intergenic
903835464 1:26200756-26200778 GCCAAGCAGGAAAAGGGTGCCGG + Intronic
904556266 1:31366790-31366812 AGAAAGCATGAAAATGGGGTAGG + Intronic
906086824 1:43143410-43143432 GTAAGGGAGGAAAAGGGTGTTGG + Intergenic
906472493 1:46142755-46142777 TTAAAGGAGGTAAAGGGTGGTGG + Intronic
906558681 1:46736892-46736914 ATAAAGCAGCAGCAGGGTTTGGG - Intergenic
906558923 1:46739585-46739607 AGAAAGGAGGAAAAGGGGGAAGG - Intergenic
907229813 1:52985913-52985935 AGAAAGCAGGGAAAGGGTATAGG - Intronic
907874951 1:58476764-58476786 TTAAATCAGGGAAAAGGTGTTGG + Intronic
908043811 1:60146015-60146037 AAAATGCAGGAAATGGCTGTTGG + Intergenic
909057240 1:70835962-70835984 AGAAAGTAAGAAAATGGTGTTGG + Intergenic
910014665 1:82507166-82507188 ATAAAACAGGAAAAGGGTGTGGG + Intergenic
910107852 1:83651013-83651035 AGAAAACAGGAAAGGGGTCTGGG + Intergenic
910170008 1:84367589-84367611 ATAAAGGGGCAAAAGGGGGTGGG + Intronic
910281228 1:85503751-85503773 ATAAAGCAGGAAGATGGGATAGG + Intronic
910527841 1:88201572-88201594 ATGTAGCAAGGAAAGGGTGTTGG - Intergenic
910718108 1:90255215-90255237 ATAGAGCAGGAAATGAGTTTGGG + Intergenic
910983731 1:92983906-92983928 ATAAAGCAGCAGCAGGGTTTGGG + Intergenic
911573089 1:99541581-99541603 ATATAGCAGAGAAAGGATGTGGG - Intergenic
911642977 1:100308444-100308466 ATAAAGCAGGCAGAGGAAGTTGG - Intergenic
911959532 1:104283062-104283084 ATATAGGGGGAAAAAGGTGTGGG - Intergenic
912258055 1:108081264-108081286 ATACATCAGGAAAGGGGTCTGGG - Intergenic
912971684 1:114289771-114289793 GTAGAGCAGAAAAAGGGGGTGGG + Intergenic
913126834 1:115798790-115798812 ATAAAGGAGGAAAATGGAATAGG - Intergenic
915483782 1:156205690-156205712 ATAAAGCAGGAAAGGGAGATAGG - Intronic
916753503 1:167745072-167745094 AGAAAGCAGGAAAAGGATACTGG + Intronic
918179492 1:182074067-182074089 ATATAGCAGGAAAAGAGAGAGGG + Intergenic
918550779 1:185739812-185739834 AAAAAGCAGGAAAAGGGATGGGG + Intronic
918860756 1:189823947-189823969 ATAAAGCATGAAAAAGGCATTGG + Intergenic
919137344 1:193527091-193527113 ATAAAGGAAGAAAAGGGGGTAGG + Intergenic
919991908 1:202713262-202713284 AGAAAGCAGGAAATGGGAGCTGG - Intergenic
920049524 1:203154920-203154942 AAAAAGAAGGAAGAGGGGGTGGG - Intronic
920369744 1:205471077-205471099 ATAAATCAGGAAAATGGTCTAGG + Intergenic
921080728 1:211736888-211736910 AGAAAGCAGGACAAAGGGGTGGG - Intergenic
921206762 1:212856211-212856233 AAAAAGCAGGGAAGGGATGTTGG + Intergenic
923829670 1:237541469-237541491 ATAAAGTAGGAAAGGGGGATAGG - Intronic
1062978810 10:1704889-1704911 TTTGAGCAGGAAAAGGGTGCAGG + Intronic
1063369723 10:5513247-5513269 TTAAAGCAGGCAAAGGGATTCGG - Intergenic
1063614777 10:7592162-7592184 ATAAACCAGAAAAAGTGTCTGGG - Intronic
1065288946 10:24211098-24211120 ATAAAGCAGGAAAAGGAATAAGG + Intronic
1066482435 10:35809955-35809977 AGAAAGCAGCAGAATGGTGTAGG - Intergenic
1067293945 10:44963641-44963663 AGAAAGGAGGACAAGTGTGTGGG - Intronic
1069247524 10:66225124-66225146 ATAAAGGAGGAATAGGTTATAGG - Intronic
1069663683 10:70140304-70140326 GTAAAGCCAGGAAAGGGTGTGGG - Intronic
1070715085 10:78714176-78714198 ATAAAGCAGGAAAATGAAATTGG + Intergenic
1071103906 10:82071801-82071823 ATAATGAAGGAAAAAGATGTTGG + Intronic
1071283473 10:84124062-84124084 ATACAACAGGAAAAGGATGAAGG - Intergenic
1071719894 10:88132316-88132338 ATACAGTATGAAAAGGGAGTGGG + Intergenic
1072419478 10:95277659-95277681 ATAAAACAGTAAACGGGTTTAGG + Intronic
1073316330 10:102583450-102583472 CTAAGGCAAGAAAAGGGAGTCGG - Intronic
1074180743 10:111060371-111060393 ATAGAGAAGGAAAAGGGTGAGGG - Intergenic
1074403227 10:113159372-113159394 ATAAAGAAAGAAAAGGGTTGTGG - Intronic
1075428843 10:122364071-122364093 GTAAACCAGGCAAAGGGTGTGGG - Intergenic
1078398765 11:11004896-11004918 ATAAAGCAGCAGCAGGGTTTGGG - Intergenic
1078921447 11:15834812-15834834 TTAAAGAAGGCAAAGGGTATGGG - Intergenic
1079148476 11:17875928-17875950 CTAAAGCAGGCAAAGGCAGTAGG + Intronic
1080083621 11:28252241-28252263 ATAAAGAAGGGAAAGGGAATAGG + Intronic
1084439357 11:69162997-69163019 ATAATGCAGTAAAAGGGTGGCGG + Intergenic
1085380370 11:76111602-76111624 ATAAAGTTGGAAAAGGCAGTTGG - Intronic
1085530106 11:77187483-77187505 TTAAAGCAGGAAATGCATGTTGG - Intronic
1086147663 11:83570821-83570843 GTAAAGGAGGAAAAGGGTATAGG + Intronic
1086452581 11:86931881-86931903 ATAATCCAGGAGAAGGGTGACGG + Intronic
1087541048 11:99520610-99520632 ATAAAGAAAGAAAAGAGTGAGGG + Intronic
1087895451 11:103580757-103580779 GTAAAGCAGGAAAATGGGGCAGG - Intergenic
1089372722 11:117972632-117972654 ATAAAGTAAGAAAGGGGTTTAGG - Intergenic
1090013628 11:123065935-123065957 ATAATGCAGGAAAAAGATATTGG - Intergenic
1090447703 11:126778001-126778023 ATATACCAGGAAAAGAGAGTAGG - Intronic
1090726355 11:129530554-129530576 AGAGAGCAGGACAAGGGTGGAGG + Intergenic
1090857941 11:130627081-130627103 AAAAAGAAGGACAAAGGTGTAGG + Intergenic
1091013398 11:132026931-132026953 AATAACCAGGAAATGGGTGTCGG - Intronic
1092225855 12:6748056-6748078 ATAAAGGCAGAGAAGGGTGTAGG + Exonic
1093054854 12:14545962-14545984 ATAAAGCTAGACAAGTGTGTGGG + Intronic
1093385951 12:18553648-18553670 GTAAAGCAGGAAAAGGGGATGGG + Intronic
1093830477 12:23750488-23750510 ACAAAACAGGAAAAGGTTTTAGG + Intronic
1095280329 12:40344216-40344238 TTAAAGCAGGAAAAGACTCTAGG - Intronic
1095466616 12:42494376-42494398 ATAAAGCAGCAACAGAGTTTGGG - Intronic
1096055905 12:48651708-48651730 AGAAAACAGGAAGAGGGGGTAGG - Intergenic
1096392420 12:51239440-51239462 ATAACGCAGGAATAGGTTGAGGG + Intronic
1096434001 12:51572895-51572917 ATAAAGCAGGGAAGGGGATTAGG + Intergenic
1096770804 12:53934786-53934808 ATAGGGCAGGCAAAGGGTTTGGG - Intergenic
1096847284 12:54414283-54414305 AGGAAGCAGGAAAAAGATGTGGG - Intronic
1097687050 12:62700901-62700923 ATAAAGCAGGAAAGGGGACTAGG - Intronic
1097705437 12:62863748-62863770 TTAAAGCTGGAAAAGGGTTCAGG + Intronic
1098299621 12:69040661-69040683 ATAAAGCAGGGAAGGGGCATAGG - Intergenic
1098299745 12:69042310-69042332 ATAAAGCAGGGAAGGGGCATGGG + Intergenic
1098888632 12:75985090-75985112 ATAAAGCAGAGAAAGGGGATAGG - Intergenic
1099119335 12:78668431-78668453 ATAAAGCAGGGCAAGGGGATGGG - Intergenic
1099248894 12:80227889-80227911 ATTAAGCAGGGAAAGGGGATAGG - Intronic
1099347343 12:81518667-81518689 ATAAGGCAGGGAAAGTTTGTAGG - Intronic
1099629913 12:85129500-85129522 ATAAAGCAGGAAAAGTGGGATGG + Intronic
1099790142 12:87323278-87323300 ATAAAGCAGAAAACTGGTCTGGG + Intergenic
1100397672 12:94199046-94199068 ATAAAGCAGAAAAAGGAAATGGG + Intronic
1100592648 12:96043899-96043921 ATAAACCAGGAAAATGTAGTAGG + Intergenic
1100826332 12:98478078-98478100 ATAAAGCAGGAGGAAGATGTAGG + Intergenic
1100887083 12:99083515-99083537 ATAAAGCAGAAAAAGTAGGTTGG - Intronic
1101347701 12:103901690-103901712 GCAAGGCAGGCAAAGGGTGTGGG + Intergenic
1101536453 12:105622256-105622278 TTAAAACAGGAAAAAGTTGTAGG + Intergenic
1102003090 12:109570380-109570402 AAAAAGAAGGAAGAGGATGTTGG - Intronic
1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG + Intronic
1102741790 12:115213921-115213943 ATATGGCAGGAACTGGGTGTTGG - Intergenic
1103522044 12:121542766-121542788 ATAAAGCAGGAAAAAGGATTGGG - Intronic
1103599441 12:122044909-122044931 ATAAAGTAGGAAAGGGGTGGGGG + Intronic
1103860654 12:124010565-124010587 ATGAAGCAGGATATGTGTGTGGG + Intronic
1104563487 12:129859644-129859666 AAAAAGCAGGCAAAGAGGGTGGG + Intronic
1105346704 13:19579523-19579545 AGAAAGGAGAAAAAGGTTGTGGG - Intergenic
1106446197 13:29833687-29833709 ATAAAGCAGTAAAGGGGGTTGGG - Intronic
1106847539 13:33752292-33752314 CTCAAGCAGGGGAAGGGTGTTGG + Intergenic
1106916333 13:34519272-34519294 AAAAAGCAGGAAAAGTTTGCCGG - Intergenic
1106920119 13:34554074-34554096 ATAAGGTAGAAAAAGGGTCTAGG - Intergenic
1106923703 13:34590804-34590826 ATGAAGCAGGAAAAAGGGATAGG - Intergenic
1107270521 13:38610650-38610672 ATAAAGCAGGAGTAGGATGGAGG - Intergenic
1107380006 13:39846846-39846868 ACAAAGCAGAAAAAAGGTGGTGG + Intergenic
1107743390 13:43479096-43479118 ATAAAGATGGAACTGGGTGTTGG + Intronic
1108713336 13:53055672-53055694 ATGAGGGGGGAAAAGGGTGTTGG - Intergenic
1109250609 13:60015598-60015620 AAAAAGCAGAGAAAGGGTGGTGG + Intronic
1110160069 13:72366297-72366319 ATAAATCATCAAAAGGGTCTTGG + Intergenic
1110294010 13:73841035-73841057 ATAAGGCATGATAAGGGAGTTGG - Intronic
1111685788 13:91499210-91499232 CAAGAGCAGGAAGAGGGTGTTGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112869547 13:103953273-103953295 AGGAAGAAGGAAAAGGGTGCAGG - Intergenic
1113524975 13:110967534-110967556 ATACAACAGGAAAAGGATGAAGG + Intergenic
1113923320 13:113926907-113926929 ACAAAGCTGGAGAAGGATGTGGG - Intergenic
1114522615 14:23348508-23348530 ATAAAACAGGAAGAGGATGCAGG + Exonic
1116616456 14:47146807-47146829 ATACATCAAGAAATGGGTGTTGG - Intronic
1116992028 14:51286740-51286762 ATAAAGCAGGACATGGGAGTGGG - Intergenic
1118166815 14:63344813-63344835 ATAAAGCAGGGTAAGGGGATGGG - Intergenic
1118497380 14:66321820-66321842 ATAAAGCAAAAAAAAGGAGTAGG + Intergenic
1121043223 14:90767519-90767541 AGAAAGAAGGAAAAGGGGGCTGG - Intronic
1121733045 14:96199681-96199703 AAAAAGCAGGAAAGAAGTGTTGG - Intergenic
1123456393 15:20430288-20430310 AGAAAGCAAGAAACGGGTGTGGG - Intergenic
1123661672 15:22570069-22570091 AGAAAGCAAGAAACGGGTGTGGG + Intergenic
1124123736 15:26915762-26915784 ATGAAGCATGAAAACTGTGTGGG + Intronic
1124195001 15:27617361-27617383 ATAAATCAGTAGAAGGGTGGTGG + Intergenic
1124262530 15:28205440-28205462 AGAAAGCAAGAAACGGGTGTGGG - Intronic
1124315471 15:28664302-28664324 AGAAAGCAAGAAACGGGTGTGGG + Intergenic
1124891115 15:33734040-33734062 ATAAAGCAGTTAAAGCCTGTAGG - Intronic
1125128746 15:36256519-36256541 CTCATGCAGGAAAAGGCTGTGGG - Intergenic
1126039856 15:44579227-44579249 AAAAAGCAGGAAGAGGGGCTGGG + Intronic
1126665577 15:51073659-51073681 ATAAAGCAGGAAAAAGAAATAGG - Intronic
1126747505 15:51841421-51841443 ATAATGCAGGAAAAGAGAGGAGG - Intronic
1127192320 15:56543607-56543629 AGAGAGGAGGAAAATGGTGTAGG - Intergenic
1127375177 15:58377686-58377708 ATAAAGCAGGAAAGGGGAGTGGG - Intronic
1127817066 15:62620481-62620503 AGAAAGAAAGAAAAGGGTGTGGG - Intronic
1128625318 15:69196006-69196028 ATAAAGGAGGGAAAGGGGATGGG + Intronic
1128845378 15:70890184-70890206 ATGAAGAAGAAAAATGGTGTAGG + Intronic
1129128744 15:73470710-73470732 ATAAAGCTGGAGAAGGGAATAGG + Intronic
1130095486 15:80852694-80852716 ATAAAAGAGGAAAAGGGAGGGGG - Intronic
1130240064 15:82179729-82179751 GTAGAGAAGGAAAAGGGAGTTGG + Intronic
1130626773 15:85523515-85523537 ATAAAGCAGGAAAGGGGGATAGG - Intronic
1130673097 15:85930449-85930471 AGAAGGCAGGAGAAGGGGGTAGG - Intergenic
1131185737 15:90272465-90272487 ACAAAGCAGGCAAAGGCTTTAGG + Exonic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132286345 15:100665814-100665836 ATAAAGCATGATAAGGGACTTGG - Intergenic
1132329795 15:101004255-101004277 ATAAAGTTGGAAAAGTGGGTTGG + Intronic
1132404616 15:101534977-101534999 ACAAAGCAGGTAAAGAGTATAGG + Intergenic
1133757741 16:8775259-8775281 AGAAAACAGGAAAAGGCTGATGG - Intronic
1134334246 16:13281892-13281914 ATAAAGCATCATAAGGGTGCTGG - Intergenic
1134641647 16:15833847-15833869 ATAAAGAAGGAAAGGGGTTGGGG - Intronic
1135163243 16:20115977-20115999 ATAAAGCATGATAATGGTCTGGG + Intergenic
1137284586 16:47004630-47004652 AGGAAGCAGGATGAGGGTGTTGG - Intergenic
1137763836 16:50962311-50962333 ACAGAAAAGGAAAAGGGTGTGGG - Intergenic
1138482666 16:57314155-57314177 AAGAAGCTGGAAAAAGGTGTCGG + Intergenic
1141118824 16:81335024-81335046 ATAAAGCAAGGGAAGGGGGTTGG + Intronic
1141786334 16:86203280-86203302 ATAGAGGAGGAAATCGGTGTTGG - Intergenic
1142012020 16:87720305-87720327 ATCAGGCAGGGATAGGGTGTCGG + Intronic
1142638112 17:1270360-1270382 ATAAAGCAGGAGGAGGGAGATGG + Intergenic
1143323006 17:6080277-6080299 ATAAAGCAAGCACAGGGTGAGGG + Intronic
1144126559 17:12207938-12207960 ATAAAGCAGGAAGAGAGAATGGG - Intergenic
1145121763 17:20266748-20266770 ATAAAGCAGGGAAGGAGGGTTGG + Intronic
1145203250 17:20966254-20966276 ATAAAGCAGGGAAGGAGGGTTGG + Intergenic
1145266435 17:21381696-21381718 ATAAAGCAGGAAAAGGAACATGG - Intronic
1146689896 17:34866144-34866166 ACAAAGCTGGAAATGGCTGTGGG - Intergenic
1147541039 17:41359935-41359957 ATAAAGCAAGGAAAGGGAATAGG - Intergenic
1147686755 17:42290506-42290528 TGGAAGCAGGAAAGGGGTGTGGG + Intronic
1149007743 17:51822971-51822993 ATTAAGCAGCAAAAGTGGGTGGG - Intronic
1149643857 17:58224787-58224809 ATAAATAAGGAAAGGGGTGAAGG + Intronic
1149915125 17:60601089-60601111 ATAAAGCAAGAATAGGCTGCAGG - Intronic
1150339067 17:64351427-64351449 ATAAAGCAAGAAAAGTGGCTGGG + Intronic
1150490128 17:65568627-65568649 ATAGAGCTGGAAAAGGGCCTGGG - Intronic
1152527248 17:80895365-80895387 ATAAAGCAGGAAAAGGGAGCAGG - Intronic
1153713582 18:7823597-7823619 ATAAAGCAGGCAAAAGAAGTTGG + Intronic
1154280183 18:12995699-12995721 AGAAAGCAGGGAAAGGAGGTTGG + Intronic
1155049650 18:22135401-22135423 ATAAGGCCAGAAAAGGGGGTTGG + Intergenic
1155772026 18:29713281-29713303 ATATATAAGGAATAGGGTGTGGG + Intergenic
1155855800 18:30832959-30832981 AGGAAGTAGGAAAAGGGTATAGG + Intergenic
1156926508 18:42586739-42586761 CCAAAGCAGGAGGAGGGTGTGGG - Intergenic
1157581743 18:48777728-48777750 AAACAGCAGGAAGAGGTTGTGGG + Intronic
1157908238 18:51589309-51589331 ATAAATCAAGTAAAGGGAGTAGG - Intergenic
1160375396 18:78407600-78407622 CAAAAGCAGGAAATGGGTGAAGG + Intergenic
1162268390 19:9594803-9594825 ATACAACAGGAAAAGGATGAAGG - Intergenic
1164632446 19:29770366-29770388 ATAAGGCAGGGCATGGGTGTGGG - Intergenic
1165323991 19:35103570-35103592 AAAAAGCAGGAAAGGGGTGAGGG + Intergenic
1165949904 19:39468541-39468563 ATAAATCAGGGAATGGGTGGAGG + Intronic
1167001990 19:46751021-46751043 ATAAAGCAGGAATGGGGGATAGG + Intronic
1167596662 19:50431959-50431981 AGGAAGGAGGGAAAGGGTGTTGG - Intergenic
1167795600 19:51706151-51706173 ATCAAGGAGGAAAGGGGTATGGG - Intergenic
1168314430 19:55478262-55478284 ATAAGGCAGGAAAAGGGAATGGG + Intronic
1168472281 19:56649495-56649517 ATGAAGCAGGAAGGGGGTTTGGG + Intronic
1168636213 19:57999393-57999415 ATAACCCTGGAAAAGGGTCTGGG + Intronic
925002052 2:410894-410916 ATAAATCTGGAAAAAGGTATTGG - Intergenic
925695124 2:6568381-6568403 ATAAAGCAGGAAAGTGGAGATGG - Intergenic
925779023 2:7362980-7363002 ATAAAACAGGAAAGGGGGGTGGG - Intergenic
926053139 2:9757410-9757432 ATATGGCAGGAAAAAGGGGTGGG - Intergenic
926804006 2:16687913-16687935 ATATTAGAGGAAAAGGGTGTAGG + Intergenic
927096667 2:19752454-19752476 GGAAAGCAGGACATGGGTGTAGG - Intergenic
927571790 2:24166689-24166711 ACAAAGCAGGTAGAGGGGGTGGG + Intronic
928695358 2:33843523-33843545 ATAAAGCAGGAAAGTGGTATAGG - Intergenic
929619513 2:43340578-43340600 TTAGGGAAGGAAAAGGGTGTCGG + Intronic
929833091 2:45365766-45365788 AAAAAGCAGGAAAAGAGTAAAGG - Intergenic
929977996 2:46653678-46653700 ATAGAGCAGGTGAAGGGAGTGGG - Intergenic
930750215 2:54927299-54927321 ATACAGCAGGAAACAGGTGCAGG - Intronic
931309822 2:61066827-61066849 ATAAACCAAGAGAAGGGGGTCGG + Intronic
931909859 2:66887308-66887330 TTAGAGCAGGAAAAGAGTGATGG - Intergenic
932977198 2:76617358-76617380 ATAATGCAGAAAAAGGATGTTGG + Intergenic
933035227 2:77387776-77387798 AAAAAGCAGGAAAACGGTAATGG + Intronic
934122173 2:88850673-88850695 ATCAAGCAGGAAAACAGTTTGGG - Intergenic
934556413 2:95289192-95289214 ATTAAGAAGGAAACGGGTGAAGG - Intronic
937621751 2:123996327-123996349 AAAAAGCAGGAAGGGGGTGAGGG - Intergenic
937642189 2:124226262-124226284 ATAAAGAAGGAGATAGGTGTTGG - Intronic
939689231 2:145237140-145237162 ATAAAGCAGGCAAAAAGTGGAGG + Intergenic
940405765 2:153300116-153300138 ATCAAGAAGGAAAAGTGGGTTGG + Intergenic
941946079 2:171098891-171098913 TTAAATCAGAAACAGGGTGTTGG - Intronic
944140054 2:196446346-196446368 ATAAAGCAGGAAAAGGGGGTAGG - Intronic
944171826 2:196787655-196787677 ACAAAGCAGGAAAAAGGGATAGG - Intronic
944719144 2:202405391-202405413 AAAAAGCAGGAAAAGGGGCAGGG + Intronic
945005842 2:205405061-205405083 ATATAGCAGCAAAATGGTTTCGG - Intronic
945253223 2:207782120-207782142 ACAAAGCAGGATAAGGGTTGTGG - Intergenic
945920752 2:215752628-215752650 ACAAAGGTGGAAAAGGGTGGAGG - Intergenic
946762864 2:223012474-223012496 ACAAAGCAGGCAAATGCTGTGGG - Intergenic
946884330 2:224208098-224208120 ATAAAGCAGAGAAAGGGAGGTGG + Intergenic
947314984 2:228847158-228847180 ATAAAGCAGGCAGAGGAAGTTGG + Intergenic
947342872 2:229158356-229158378 ATAAAGCAGGGACAAGGAGTAGG - Intronic
947415220 2:229888507-229888529 ATAAATCAGGATAGTGGTGTTGG + Intronic
1168796447 20:612827-612849 ATAAAGCAGGATAAGGGGAAAGG - Intergenic
1168917888 20:1506261-1506283 ATAGACCAGGGAAAGGGGGTTGG + Intergenic
1169031236 20:2408909-2408931 ATAAAGAAGGGAAAGAGTTTAGG + Intronic
1169674966 20:8143138-8143160 CTAAAGGAGGAAAAGGGACTGGG - Intronic
1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG + Intronic
1169988311 20:11471598-11471620 ATAAAGGAGGGAGAGGGCGTGGG - Intergenic
1170226030 20:13992823-13992845 ATATAGCAGGGAAAGGGGGTGGG + Intronic
1171559083 20:26105768-26105790 ATATAACAGGAATAGGGTGGTGG + Intergenic
1172716248 20:36966072-36966094 ATACAACAGGATAAGAGTGTAGG + Intergenic
1172718238 20:36979790-36979812 ATACAACAGGATAAGAGTGTAGG - Intergenic
1172978504 20:38923989-38924011 AAAGAGGATGAAAAGGGTGTCGG + Intergenic
1173718181 20:45229796-45229818 ATAATGCAAGAAAAGGGATTGGG - Intergenic
1173718346 20:45230921-45230943 ATAATGCAAGAAAACGGTGTGGG - Intergenic
1173902202 20:46599060-46599082 TCAAAGCAGGAAAAGGGTGGGGG - Intronic
1174406435 20:50306166-50306188 ATGAAGCAGGAAAAGGAGATGGG + Intergenic
1174456730 20:50654024-50654046 ATAAAGCAGGAAGAGGGAATTGG - Intronic
1174465102 20:50711216-50711238 CTGAAGGAGGGAAAGGGTGTGGG + Intergenic
1174881160 20:54280822-54280844 ATAAAGCTGGAAAAGGGAATAGG - Intergenic
1176651939 21:9556835-9556857 ATATAACAGGAATAGGGTGGTGG - Intergenic
1177216547 21:18137141-18137163 AGAAATAAGGAAGAGGGTGTTGG - Intronic
1178400318 21:32279599-32279621 AAAAAGAAGAAAAAGGGTGGTGG - Intergenic
1178624495 21:34203804-34203826 AGAAAGCAGGAAAGGGGGATGGG + Intergenic
1179212886 21:39340567-39340589 TTAAAACAGGTAAAGGGTTTTGG - Intergenic
1179289242 21:40004476-40004498 ATAAATCAGAAAAAGGGTAGAGG + Intergenic
1179729496 21:43359872-43359894 TTAAAGCAGGAAACAGGTCTTGG + Intergenic
1180891558 22:19292146-19292168 AGAAAGATGGAAAAGGGTCTTGG + Intergenic
1183072279 22:35404712-35404734 AGAAAGCAGGAAGAGGCTGTGGG - Intronic
1183611205 22:38907613-38907635 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1184839313 22:47043303-47043325 ACAGAGCAGGCGAAGGGTGTGGG + Intronic
1185097085 22:48815594-48815616 ATAAAGCAGCAGCAGGGTTTGGG + Intronic
949122505 3:403664-403686 ATAAAGGAGCAGCAGGGTGTGGG - Intronic
950168868 3:10822456-10822478 ATAGAGGAGGAAGAGGGTATAGG + Intronic
950269506 3:11602422-11602444 AACAAGCAGGAAAAGTGAGTTGG - Intronic
950364432 3:12473072-12473094 AAGTAGCAGGAGAAGGGTGTGGG + Intergenic
950610029 3:14120554-14120576 ATAAAGCGGGATAAGGGAGATGG - Intronic
950738772 3:15032966-15032988 AGAAAGCAAGAAAAGGGGGGGGG - Intronic
951053484 3:18121003-18121025 ATAACTCAGGAAAAGTGTTTTGG + Intronic
951687772 3:25363683-25363705 ATAAGGCATGGAAAGGGTGGAGG - Intronic
951830487 3:26920856-26920878 ATTAAGCAGCAACAGGGTCTTGG - Intergenic
952093837 3:29924329-29924351 ATCTAGCAGCAAAAGGGTGTAGG + Intronic
952708155 3:36401018-36401040 TTAAAGAAGGCAAAGGATGTCGG + Intronic
952851334 3:37732339-37732361 AAAAGGCAGGATTAGGGTGTGGG + Intronic
952866277 3:37857328-37857350 GTAAAGCAGGAAAAGCATCTGGG - Intergenic
952909805 3:38173863-38173885 AAAAAGCAGGGAAAGGGGTTAGG + Intronic
952998573 3:38908992-38909014 TTAAAGGAGGAAAAGGAGGTAGG - Exonic
954966396 3:54614959-54614981 CTAAAAAAGAAAAAGGGTGTGGG + Intronic
955672608 3:61417823-61417845 CTAAAGAAGGGAAAGGGTGGGGG - Intergenic
956069522 3:65432938-65432960 ATAAAGCAGGAAAAAGGGATTGG - Intronic
956293834 3:67690924-67690946 AAAAAGCAGGAAAAGGAGCTAGG + Intergenic
956780185 3:72597476-72597498 ATAAAACAGGACAATGGTGCAGG + Intergenic
956818828 3:72933924-72933946 ATAAAGAAAGGAAAGGATGTTGG + Intronic
957230414 3:77506396-77506418 ATAAATAAGGCAAAGGGAGTTGG - Intronic
957256791 3:77846536-77846558 ATAATTCAGTAAAATGGTGTGGG - Intergenic
957533797 3:81475096-81475118 ATGAAGCAGGAAATGAGTGGAGG - Intergenic
958962039 3:100520183-100520205 ATAAAGCAGGAAAAGAGGGTAGG + Intronic
958994898 3:100893071-100893093 ATAAAGCAGGCAAAAGAAGTTGG + Intronic
959128137 3:102316422-102316444 AGAAAGGAGGAACAGAGTGTGGG + Intronic
959170934 3:102842707-102842729 AAAAGGCAGGAAAAGTGGGTAGG + Intergenic
959358458 3:105361412-105361434 ATGAAGCAGGAAAAGGAATTTGG + Intergenic
960555772 3:119028892-119028914 AAAAACCAGGAAATTGGTGTTGG - Intronic
960984859 3:123270820-123270842 AGAAAGCAGGAAAAAGGGATAGG - Intronic
961027670 3:123573705-123573727 ATAAACAAGCAAAAGGGTGTTGG + Intronic
961324731 3:126103424-126103446 AGACAGGAGGAAATGGGTGTGGG - Intergenic
961523661 3:127483176-127483198 ATAAAGCAGGGAATGGGAGTCGG - Intergenic
961582324 3:127892828-127892850 ATACAACAGGAAAAGGATGAAGG + Intergenic
962113611 3:132476915-132476937 ATAAAGCAGGAAATGGGGATAGG - Intronic
962116093 3:132509516-132509538 ATAAAGCAGCAGCAGGGTTTGGG + Intronic
962909090 3:139831530-139831552 ACAAAGCAGGAAAAGGAGATTGG + Intergenic
963338111 3:144000767-144000789 ATAAATAAGTAATAGGGTGTTGG - Intronic
963885522 3:150577546-150577568 TTCAAGCAGGAAATGGGAGTAGG + Intronic
964029364 3:152118652-152118674 TTAAAGCAGGAAAAGTCTGGAGG + Intergenic
964086600 3:152826622-152826644 TAAATGCAGGAAAAGGATGTGGG - Intergenic
964104955 3:153029199-153029221 AAATTGCAGGAAAAGGTTGTCGG + Intergenic
964746665 3:160019047-160019069 ATAAAGCCTGAAGTGGGTGTTGG - Intronic
965556995 3:170028760-170028782 AGAAAGCAAGGAAAGGATGTAGG + Intergenic
966113079 3:176427293-176427315 ATAAAGCAGGGAAGGGGGATAGG - Intergenic
966503517 3:180673204-180673226 ATAAAGCAGCAGCAGGGTATTGG + Intronic
967121347 3:186385330-186385352 ATAAAGGTGGAAATGGGGGTAGG + Intergenic
967409696 3:189154856-189154878 ATAAATCAGGAAAGGTGAGTGGG + Intronic
967741587 3:193009027-193009049 ATAAAGCAGGTTAAGAGTGAGGG - Intergenic
967755166 3:193160569-193160591 ATAAAGCAGGAAAAGGGGTGGGG - Intergenic
968534855 4:1118079-1118101 AGAAAGAAGGAAAATGATGTAGG + Intergenic
969670030 4:8585006-8585028 ATAAAGCAGGTAAAGGAGATGGG + Intronic
970058073 4:11998230-11998252 ATAAAAAAGGAAAAGGCTGGAGG + Intergenic
970608039 4:17700125-17700147 ATTAAACGGGAAAAGGGGGTGGG + Intronic
970865615 4:20755650-20755672 ATAAAGCAGGGGAAGGGGATGGG + Intronic
970997215 4:22281127-22281149 ATAAAGCAGAAAGAGTGTTTTGG - Intergenic
971552137 4:27970706-27970728 ATCAAGCAAGAAAAGGGGATTGG - Intergenic
972168170 4:36312497-36312519 ATAAAGCAGGGAAAGGATAGGGG + Intronic
972311157 4:37884811-37884833 ATAAAGCAGGAAAAGGGATAAGG + Intergenic
972697320 4:41460067-41460089 ATAAAGCAGAGAGGGGGTGTGGG + Intronic
973734242 4:53854799-53854821 ATGAAGCAGGAAAAGAGTGAAGG - Intronic
974479474 4:62424497-62424519 ATAAAGCAGGCAGAAGGTGTTGG - Intergenic
974738497 4:65973269-65973291 ATACTGCAGAAATAGGGTGTGGG - Intergenic
974866258 4:67584484-67584506 ATAAAGCAGGAAGAGAGAGATGG + Intronic
974976507 4:68900646-68900668 AGAAAGAAGGAAAAGAGAGTAGG - Intergenic
975823686 4:78297321-78297343 AGAAAAGAGGAAATGGGTGTCGG + Intronic
976788066 4:88845153-88845175 AAAAATGAGGAAAAGGATGTTGG + Intronic
976830810 4:89311744-89311766 ATAAAGCAGGGTAAGGGGGATGG - Intergenic
977184442 4:93919100-93919122 ACAAAGCAGGAAAAGGGAACAGG - Intergenic
977397223 4:96485935-96485957 TTAGAGCAAGAAAAGGATGTGGG + Intergenic
978152398 4:105452581-105452603 AGATAGCAGGCAAAGGTTGTAGG + Intronic
978737888 4:112104983-112105005 ATTTAGCAGGGACAGGGTGTAGG - Intergenic
980509240 4:133762867-133762889 AGAAAGTAGGCACAGGGTGTCGG + Intergenic
980655540 4:135779306-135779328 ATAGAGCAAGAACTGGGTGTAGG - Intergenic
980892804 4:138832907-138832929 ATACTGTAAGAAAAGGGTGTGGG + Intergenic
981025258 4:140071312-140071334 CTAAAGAAGGAAAAGGCTGGTGG - Intronic
981247815 4:142560718-142560740 ATAAAGCAGGCAGAAGATGTTGG - Intronic
981601187 4:146490894-146490916 AAATGGCAGGAAAAGGGTTTGGG - Intronic
983852485 4:172598995-172599017 ATAAAGTAGGAGAAAGGTATGGG + Intronic
984486876 4:180382044-180382066 GTAAAGCAGGCAAAGGTTTTAGG - Intergenic
984625549 4:182003758-182003780 ATATAGCAAGAAAAGAGTGTAGG - Intergenic
984723580 4:182999518-182999540 GAAAAGCAGGAAAAGGGTGCAGG + Intergenic
986283652 5:6344232-6344254 AGAAAGCAGGGAATGGATGTTGG + Intergenic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
987791782 5:22577230-22577252 ATAGAGCATGCAAAGTGTGTGGG + Intronic
988658503 5:33238617-33238639 ATAAAGCCAGAAAATGGTATGGG - Intergenic
989317907 5:40103757-40103779 AGAATGCATGAATAGGGTGTGGG - Intergenic
989425950 5:41295757-41295779 ATAAAGCAGTGAAAGGGGATAGG - Intergenic
989563213 5:42874736-42874758 ATAAAGAAGCACAAGGCTGTTGG - Intronic
990344905 5:54862497-54862519 ATAAAGCAGGAAAGGGAGCTAGG - Intergenic
990348377 5:54891188-54891210 ACCAAGGAGAAAAAGGGTGTGGG + Intergenic
990383675 5:55238890-55238912 ATAAAGCAGGAAAGGGGAATGGG + Intergenic
990666926 5:58082978-58083000 ACAAAGCATTAAAAGTGTGTTGG - Intergenic
990929804 5:61076026-61076048 ATAAAGCAGGGAAAGGGCATAGG + Intronic
991524658 5:67542952-67542974 ATAAGGCAGGAAAAGGTAATAGG - Intergenic
993393731 5:87356118-87356140 ATAAAGCAGCAAGAGGGTTTGGG + Intronic
994094145 5:95833432-95833454 ATAACAGAGGAAAGGGGTGTGGG + Intergenic
994632923 5:102308339-102308361 AAAAAGAAGGAAAAGTGTGGGGG - Intergenic
994719411 5:103363922-103363944 ATAAAGCAGGAAAGGAGTTTAGG + Intergenic
995381270 5:111536376-111536398 ATACAATAGGAAAAGGATGTTGG - Intergenic
996058526 5:119006872-119006894 ATACAGCATGGAAAGGGAGTGGG + Intergenic
996313092 5:122129043-122129065 ATAAAGCAGGAAAATGTGGAAGG - Intergenic
996590693 5:125143997-125144019 CTAAATTTGGAAAAGGGTGTTGG - Intergenic
996664449 5:126042612-126042634 ATAAAGCATGAAAAGCTTTTAGG + Intergenic
997647916 5:135493208-135493230 ATGAAGCAGGAAACTGGTGTGGG + Intergenic
997765879 5:136502494-136502516 GTGAAGCAGGATGAGGGTGTAGG + Intergenic
998011460 5:138698800-138698822 ATAAAGCAGGGAAAGAGGGTGGG + Intronic
999825315 5:155268016-155268038 ATAAAGCAGTAGAAGGCTGCGGG + Intergenic
999987944 5:157022571-157022593 ATGAAGCAGGCAAAGTGAGTTGG + Intergenic
1000223177 5:159233828-159233850 ATAAAGCAGGCAGAAGGTGGTGG - Intergenic
1001525311 5:172424599-172424621 ATAAATCAGGACAAGGTTGGAGG + Intronic
1001941382 5:175742165-175742187 AAAAAGAAGAAGAAGGGTGTGGG + Intergenic
1001966424 5:175913102-175913124 ATAAAGCAGGATCAGGGCATGGG + Intergenic
1002250523 5:177926102-177926124 ATAAAGCAGGATCAGGGCATGGG - Intergenic
1002932909 6:1646704-1646726 ATAAACCTGGAAAAGGAGGTTGG - Intronic
1003217817 6:4131089-4131111 ATAATGCAGGATAAAGGTTTTGG + Intronic
1004207628 6:13606967-13606989 AAAAAGCAGGCCAAGTGTGTTGG - Intronic
1004263534 6:14129495-14129517 ATAAAGCACAAAAAGGAGGTGGG - Intronic
1004264307 6:14135537-14135559 ATGCAGCTGGAAAAGGGTCTTGG + Exonic
1005614599 6:27560521-27560543 ATGCAGCTGGAAAAGGGTCTTGG - Intergenic
1006818532 6:36871217-36871239 ATAAAGCAGGAAAAGGGTGTGGG - Intronic
1007135430 6:39516855-39516877 AAAGAGCAGGAAAGGGGTGAGGG - Intronic
1007161958 6:39798818-39798840 AATAAGGAGGAAAAGGGGGTTGG - Intronic
1007221940 6:40285707-40285729 AGAAAGCTGGAAAGGGGTGGAGG - Intergenic
1007253677 6:40513713-40513735 ATAAAGCAGAAAAGGGGAATAGG + Intronic
1007291386 6:40789765-40789787 GTAAAGTAGGAAAAGTGGGTAGG - Intergenic
1007620792 6:43213355-43213377 ATGAAGGAGGAACAGGGTTTAGG - Intronic
1007744539 6:44035303-44035325 TTAAAGGAGGAAAGGGGTGTGGG - Intergenic
1008087777 6:47262572-47262594 ATAAAGCAGGTAAAGAGGATAGG + Intronic
1008766455 6:54922600-54922622 ATAAATAAGAAAAAGGTTGTGGG + Intronic
1009374892 6:62954983-62955005 ATAAAGAAGGAAAAGGGATAAGG + Intergenic
1009524427 6:64726082-64726104 ATAAAGAAGGAAAAGAATGAGGG - Intronic
1010351181 6:74876442-74876464 AGAAAGCGGGGAGAGGGTGTTGG + Intergenic
1010830658 6:80524254-80524276 TTAAAACAGGAAAAGGAAGTGGG + Intergenic
1010974054 6:82293173-82293195 TTCAAGAAGGAAAAGGGTGGAGG + Intergenic
1011219863 6:85042837-85042859 ATAAGGCAGTAAAATGATGTGGG - Intergenic
1011856782 6:91702927-91702949 ATAAAGGAGGGAAAGGGAATAGG + Intergenic
1012107758 6:95186815-95186837 ATAAAGTAAGCAAAGGGTGAGGG + Intergenic
1012331766 6:97999360-97999382 AGAAAGCAGAAAAATGGTGCAGG - Intergenic
1012575750 6:100795354-100795376 AGAAAGCAGGAAAAGAGGGGAGG + Intronic
1012642590 6:101638393-101638415 ATAAAGCAGGAGAGATGTGTAGG + Intronic
1012667782 6:101998556-101998578 ATATAGCAGGAAATTGTTGTGGG - Intronic
1013000176 6:106013933-106013955 ATAAAGCAGGATAAAGGAATTGG - Intergenic
1013007007 6:106083193-106083215 AGGAAGCGGGAAATGGGTGTGGG + Intergenic
1013205708 6:107944015-107944037 ATAAACCAGGACAGTGGTGTTGG + Intronic
1013658553 6:112270906-112270928 CAGAAGCAGGAAAAGGGAGTGGG - Intergenic
1015069110 6:129067930-129067952 ATAAAGCAGGAAAGTGGTTTAGG - Intronic
1015159337 6:130134924-130134946 ATAAATCAGAAAAAGGATGTTGG - Intronic
1015282290 6:131446719-131446741 AGAAAGCAGGACAATGGTGATGG - Intergenic
1015745255 6:136503194-136503216 ATAAAGGAGGGAAAGGGAGAAGG - Intronic
1017171958 6:151465368-151465390 ATAAAGCAGGAAAAGGGCGTTGG + Intronic
1019464153 7:1177334-1177356 ATAAAGCTGGAAAGGGATGCTGG - Intergenic
1020769365 7:12368923-12368945 ACTAAGAAGGAAAAGGCTGTAGG + Intronic
1020816971 7:12917591-12917613 AAAACCCAGGAAGAGGGTGTGGG - Intergenic
1021093089 7:16505660-16505682 GTAAATCAGGAAGAGGGAGTGGG + Intronic
1021537186 7:21718724-21718746 TTATAGCAAAAAAAGGGTGTGGG - Intronic
1022543498 7:31161704-31161726 AGAAATCAGGAAAAGGATATTGG + Intergenic
1022967951 7:35491372-35491394 TCCAAGCAGGAAAAGGGTGATGG + Intergenic
1023798399 7:43812367-43812389 ATACAACAGGAAAAGGATGAAGG + Intergenic
1024247909 7:47484429-47484451 ATAAGGGAGGAAAAGTGTGACGG - Intronic
1024668586 7:51569392-51569414 ATAAAGCAGCCAAGGGGTTTGGG + Intergenic
1025278600 7:57607796-57607818 ATATAACAGGAATAGGGTGGTGG - Intergenic
1025734136 7:64132024-64132046 AAACAGTAGGAAAAGGGTGAAGG - Intronic
1026159947 7:67859953-67859975 AAAAGGTAGGAAAAGGGTGAAGG - Intergenic
1026440540 7:70439881-70439903 ATACACAAGAAAAAGGGTGTGGG - Intronic
1028424940 7:90676231-90676253 TTAAAGCAGGAAAAGGAGATAGG + Intronic
1028529916 7:91827178-91827200 ATAAAGCAGGAAAAGGGTAGAGG - Intronic
1030598658 7:111568737-111568759 ATAAAGCAGGGCAAGCATGTGGG + Intergenic
1030872999 7:114780798-114780820 ATAAAGTAGGATGAGGGAGTGGG - Intergenic
1031373546 7:120996956-120996978 ATAAGGCTGGAAAAGTATGTTGG - Intronic
1031520671 7:122761596-122761618 ATAAAGTAAGAATAGGGTGGTGG - Intronic
1031792277 7:126121083-126121105 ATAAATGAAGAAAATGGTGTAGG + Intergenic
1032417215 7:131745132-131745154 ATAAAGCAGGAATGGGAGGTAGG + Intergenic
1032696990 7:134345664-134345686 ACAAAGGAGGAAGAGGGTTTCGG - Intergenic
1032723358 7:134568794-134568816 ATAAAAAAAGAAAAGGATGTTGG + Intronic
1032819503 7:135511253-135511275 TTAAAGCAGGGAAGGGGAGTAGG + Intergenic
1033600352 7:142884594-142884616 AGAAAGCAGGACACGGGTTTAGG + Intronic
1033610161 7:142957340-142957362 ATAAGGCTGGAGAAGTGTGTAGG + Intronic
1034041659 7:147883985-147884007 ATAAAGTAGGATAAGGGTTATGG + Intronic
1035270162 7:157715064-157715086 AGAAAGCAGGACAAGCGCGTCGG - Intronic
1035634945 8:1137490-1137512 ATAGAGTAAGAAAATGGTGTGGG - Intergenic
1036211144 8:6842155-6842177 ATAAAGCTGGAAGAGGGTTTGGG + Intergenic
1036466153 8:8999404-8999426 GTAAAACAGGAAAAGGGAATGGG - Intergenic
1036596928 8:10221723-10221745 ATAAAGCAGGGAAAGAGAATAGG + Intronic
1036782556 8:11659529-11659551 GGAAAGGAGGAAAAGGGTTTTGG - Intergenic
1037584969 8:20269960-20269982 CTCAAGCAGAAAGAGGGTGTTGG + Intronic
1037829140 8:22177825-22177847 CAAGATCAGGAAAAGGGTGTGGG - Intronic
1038013948 8:23497558-23497580 ATAAGGCAGCAAGAAGGTGTTGG - Intergenic
1038708447 8:29919305-29919327 ATAAGGGAGGAAAAGAGTATTGG + Intergenic
1039618146 8:38973579-38973601 ACAAAGGAAGAAAAGGGTGCTGG - Exonic
1040067654 8:43161130-43161152 AAAAAGCAGGACATGGGGGTGGG + Intronic
1040516071 8:48136257-48136279 ATCAAGGAGGAAGAGGGTATTGG - Intergenic
1040983862 8:53272099-53272121 ATAAAGCAGGGAAAAGGCGAAGG - Intergenic
1041795297 8:61741203-61741225 ATAATAAAGGAAAATGGTGTAGG - Intergenic
1043011096 8:74882941-74882963 ATAAAGCAGGAGAAGGGGTGAGG - Intergenic
1043135443 8:76518201-76518223 ATGAAGCAGGAAAAGTAGGTTGG + Intergenic
1043331245 8:79120980-79121002 ATACAGCAGGGAAAGGATGAAGG + Intergenic
1043502550 8:80872827-80872849 GGAAACCAGGAAAAGGGGGTGGG - Intronic
1043871989 8:85443330-85443352 ATAAAGCAGGAAAAATGAATTGG - Intronic
1044071217 8:87762566-87762588 ATAAAGCAGGAAAAAGGTATTGG - Intergenic
1044665378 8:94629320-94629342 ATAAGGCAGCAAAAGACTGTTGG - Intergenic
1046174613 8:110559436-110559458 ATAATGAAGGAAAAGAGTGAAGG - Intergenic
1046584035 8:116129590-116129612 ATAAAGATGGAAAGGGGTATTGG + Intergenic
1046770680 8:118113314-118113336 ATAAAGCAGGGAAGGGGCATGGG + Intergenic
1047517144 8:125564899-125564921 ATAAAGCAGGGAAAGGGTTTGGG + Intergenic
1048364262 8:133724664-133724686 CTAATGCGGGGAAAGGGTGTCGG - Intergenic
1048889084 8:138931895-138931917 AAAAAGCAGGATAAAGGTGCTGG + Intergenic
1049088343 8:140494921-140494943 AAAAAGAAGGAAAAGAGTCTGGG - Intergenic
1050109885 9:2203673-2203695 AGAAAGCAGGAAAATGCTATAGG + Intergenic
1052187322 9:25614419-25614441 ATAAAGCAGGATAAGGGAGATGG - Intergenic
1052240019 9:26260433-26260455 AGAAAGCAGGAAGAGGGAGGAGG + Intergenic
1053605640 9:39655815-39655837 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1053625300 9:39864718-39864740 CTAAAGAAGGAAAAGTCTGTAGG + Intergenic
1053863559 9:42412445-42412467 TTTAAGAAGGAAAAAGGTGTGGG + Intergenic
1053879568 9:42578508-42578530 CTAAAGAAGGAAAAGTCTGTAGG - Intergenic
1053893097 9:42715829-42715851 CTAAAGAAGGAAAAGTCTGTAGG + Intergenic
1054218591 9:62385976-62385998 CTAAAGAAGGAAAAGTCTGTAGG - Intergenic
1054232124 9:62523191-62523213 CTAAAGAAGGAAAAGTCTGTAGG + Intergenic
1054247903 9:62686600-62686622 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1054562017 9:66721125-66721147 TTTAAGAAGGAAAAAGGTGTGGG - Intergenic
1054734380 9:68735737-68735759 GTAAAGCAGGATAAGGGAGTAGG + Intronic
1055546712 9:77382715-77382737 ATAAAGCAGGAAGAGGGTCATGG - Intronic
1055723285 9:79199551-79199573 ATAAAGCAGGATGAGAGTGGTGG + Intergenic
1056376976 9:86024324-86024346 ATAGAGCAGGAAAAGGATGGCGG + Intergenic
1057470826 9:95354605-95354627 AAAAAGCAGGGAAAGGGGATTGG - Intergenic
1058022257 9:100101922-100101944 ATAAAGCAGCTTAAGGGTTTAGG + Intronic
1059127532 9:111706532-111706554 ATAAAGCAAAAAAAGGATTTTGG + Intronic
1060068375 9:120525137-120525159 ATTGAGCAGGAAAAGCATGTGGG - Intronic
1203629668 Un_KI270750v1:60381-60403 ATATAACAGGAATAGGGTGGTGG - Intergenic
1186262087 X:7790620-7790642 ATAAGGCAGGAAAAAGATGGAGG + Intergenic
1186452724 X:9686809-9686831 ATGAAGGAGGAAGGGGGTGTGGG + Intronic
1187132269 X:16514239-16514261 AGGAAGGAGGAAAAGTGTGTAGG + Intergenic
1187306895 X:18103339-18103361 ATAAAGCAAGAAAAGGAAATAGG + Intergenic
1187577577 X:20574763-20574785 ATAAAACAGGAAAAGGGGACAGG + Intergenic
1188192445 X:27188605-27188627 AAAAAGCAGGAAGAGGGAGACGG - Intergenic
1188282957 X:28293056-28293078 ATAAAGCATGGAAAGGGAATAGG + Intergenic
1188522407 X:31053427-31053449 ATGAAGCAGGAAAGGGGGATAGG + Intergenic
1189739802 X:44106101-44106123 ATTAAGCAGGGAAGGGGGGTGGG + Intergenic
1189834230 X:45004606-45004628 ATACAACAGGAAAAGGATGAAGG - Intronic
1190003804 X:46714807-46714829 ATAAGGCAGGGAAAGGGTTAAGG + Intronic
1190320624 X:49177356-49177378 AGAAAGCAGGAAACAGGTTTTGG + Intronic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1190759224 X:53425882-53425904 ATAAATCTGGCAAAGGGGGTTGG + Intronic
1191666039 X:63703754-63703776 ATAAAGCAGGAAAGGGGCAGAGG + Intronic
1191718688 X:64211014-64211036 ATAGAGCAGGGAATGGGTATAGG + Intergenic
1192782124 X:74304795-74304817 ATCAATCAGCAAAAGGGTGGGGG - Exonic
1194410458 X:93551390-93551412 AAAAAGGAGGAAAAGGGTGAAGG - Intergenic
1194881857 X:99262565-99262587 ATATAGCAGGTCAAGTGTGTTGG + Intergenic
1195393355 X:104386067-104386089 ATAAAGCAAGAAGAGAGTCTTGG + Intergenic
1196130407 X:112149347-112149369 ATAAAGCAGGAAGAGGTGATAGG + Intergenic
1196705029 X:118710049-118710071 ATAAAGCAGGTTAAGGGGATGGG - Intergenic
1196795663 X:119500370-119500392 ACAAAAAACGAAAAGGGTGTAGG + Intergenic
1197189319 X:123628273-123628295 ATACAGCAGCAAGAGGGAGTAGG - Intronic
1197358349 X:125466032-125466054 ATAAAGCAGCAGCAGGGTTTGGG - Intergenic
1200836424 Y:7736613-7736635 AGAAAGCTGTAAAAGAGTGTAGG - Intergenic