ID: 1006818922

View in Genome Browser
Species Human (GRCh38)
Location 6:36874869-36874891
Sequence CCCTTTCGATACCAGGATTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006818917_1006818922 -10 Left 1006818917 6:36874856-36874878 CCGGTCCGTTCAACCCTTTCGAT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1006818922 6:36874869-36874891 CCCTTTCGATACCAGGATTTGGG 0: 1
1: 0
2: 0
3: 11
4: 117
1006818915_1006818922 9 Left 1006818915 6:36874837-36874859 CCGTCGCTGCTGCACACTTCCGG 0: 1
1: 1
2: 0
3: 6
4: 75
Right 1006818922 6:36874869-36874891 CCCTTTCGATACCAGGATTTGGG 0: 1
1: 0
2: 0
3: 11
4: 117
1006818914_1006818922 10 Left 1006818914 6:36874836-36874858 CCCGTCGCTGCTGCACACTTCCG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1006818922 6:36874869-36874891 CCCTTTCGATACCAGGATTTGGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006818922 Original CRISPR CCCTTTCGATACCAGGATTT GGG Exonic
905948459 1:41924277-41924299 CCCTATCAATACCTTGATTTTGG + Intronic
906491664 1:46273470-46273492 CCCTTTTCCTACCAGTATTTGGG + Intronic
907070217 1:51527803-51527825 ACCTTTCTATAACATGATTTTGG - Intergenic
909369660 1:74869438-74869460 CCATATCAATACCAGCATTTTGG - Intergenic
909482008 1:76135993-76136015 CCCTTTTGAGACCAGGTCTTTGG + Intronic
915516672 1:156417192-156417214 CCCTTTCCATGCCTGGAATTGGG + Intronic
916726396 1:167527471-167527493 CCCTCTCGATAACAGTAGTTGGG - Intergenic
916796674 1:168173749-168173771 CCCTTTCTATCCCAGCACTTTGG - Intergenic
921013930 1:211169780-211169802 CCTTATCGCTACCAGCATTTTGG + Intergenic
923149471 1:231220467-231220489 CCCCTTAGATACCAGAACTTAGG - Intronic
923659141 1:235943566-235943588 CCATTTCAATACCATGATCTTGG + Intergenic
1067925816 10:50507002-50507024 CCCATTCGGTACCAGCATTCTGG - Intronic
1069861340 10:71473549-71473571 ACCTCTGGATACCAGGATTTGGG - Intronic
1075145026 10:119875278-119875300 CCCTTTTGATGCCAGGGTCTTGG - Intronic
1077416160 11:2425254-2425276 CCCTGCCGATGCCTGGATTTGGG - Intergenic
1079345118 11:19645107-19645129 ACCTTTCGACACCTTGATTTCGG - Intronic
1086313233 11:85559896-85559918 CACTTTTGATATTAGGATTTGGG - Intronic
1089908092 11:122066155-122066177 CCCTGTCAATACCTTGATTTCGG - Intergenic
1094192163 12:27708933-27708955 CCCTGCCGACACCTGGATTTTGG + Intergenic
1102488212 12:113272589-113272611 TCCTTTTGACACCAGGTTTTGGG + Intronic
1104017933 12:124972762-124972784 CCCTTCAGAAACCAGGATTTTGG - Intronic
1105647587 13:22338067-22338089 CCATATCACTACCAGGATTTTGG - Intergenic
1105770880 13:23610701-23610723 CCTGTTAGATACCAGGCTTTTGG + Intronic
1107011922 13:35678566-35678588 CCCTTTCCCTACCAGGTTTTTGG - Intergenic
1109264458 13:60181071-60181093 TCCTTTCAATACCAAAATTTAGG + Intergenic
1112796880 13:103066833-103066855 CCCTTTCAATAGAAGGGTTTAGG + Exonic
1113458783 13:110467429-110467451 GCCTTTCCATCCCAGGATCTAGG + Intronic
1120499932 14:85283792-85283814 CCCTTACGTTACCCTGATTTGGG - Intergenic
1123470868 15:20551149-20551171 CGCTTTTGATCCCAGGAGTTTGG + Intergenic
1123470957 15:20551606-20551628 CGCTTTTGATCCCAGGACTTTGG + Intergenic
1123471031 15:20552022-20552044 CGCTTTTGATTCCAGGACTTTGG + Intergenic
1123647027 15:22448680-22448702 CGCTTTTGATTCCAGGACTTTGG - Intergenic
1123647101 15:22449094-22449116 CGCTTTTGATCCCAGGACTTTGG - Intergenic
1123647192 15:22449561-22449583 CGCTTTTGATCCCAGGAGTTTGG - Intergenic
1123721516 15:23065554-23065576 CACTTTTGATCCCAGGACTTTGG + Intergenic
1123722165 15:23069238-23069260 CGCTTTTGATCCCAGGACTTTGG + Intergenic
1123731170 15:23146136-23146158 CGCTTTTGATCCCAGGAGTTTGG + Intergenic
1123731259 15:23146594-23146616 CGCTTTCGATCCCAGGACTTTGG + Intergenic
1123731332 15:23147011-23147033 CGCTTTTGATTCCAGGACTTTGG + Intergenic
1123749308 15:23343554-23343576 CGCTTTTGATCCCAGGAGTTTGG + Intergenic
1123749397 15:23344009-23344031 CGCTTTCGATCCCAGGACTTTGG + Intergenic
1123749470 15:23344426-23344448 CGCTTTTGATTCCAGGACTTTGG + Intergenic
1124075403 15:26439114-26439136 CCCTCTCCTTACCAGGAATTGGG + Intergenic
1124281679 15:28367438-28367460 CGCTTTTGATCCCAGGAGTTTGG + Intergenic
1124281769 15:28367886-28367908 CGCTTTTGATCCCAGGACTTTGG + Intergenic
1124281843 15:28368301-28368323 CGCTTTTGATTCCAGGACTTTGG + Intergenic
1124300860 15:28543300-28543322 CGCTTTTGATTCCAGGACTTTGG - Intergenic
1124300934 15:28543719-28543741 CGCTTTTGATCCCAGGACTTTGG - Intergenic
1124301024 15:28544176-28544198 CGCTTTTGATCCCAGGAGTTTGG - Intergenic
1124322524 15:28725792-28725814 CCCTTGTGATCCCAGGATTTTGG + Intronic
1124322712 15:28726835-28726857 CCCTTGTGATCCCAGGACTTTGG + Intronic
1124523621 15:30427413-30427435 CCCTTGTGATCCCAGGACTTTGG + Intergenic
1124535046 15:30538802-30538824 CCCTTGTGATCCCAGGACTTTGG - Intergenic
1124763603 15:32468799-32468821 CCCTTGTGATCCCAGGACTTTGG + Intergenic
1124775023 15:32580252-32580274 CCCTTGTGATCCCAGGACTTTGG - Intergenic
1126821789 15:52511633-52511655 CCCTTCCCATTCCAGTATTTTGG - Intronic
1130350684 15:83089054-83089076 CCGCTTCACTACCAGGATTTTGG - Intergenic
1140715765 16:77724079-77724101 CCCTGCCGATACCTTGATTTTGG - Intronic
1141604409 16:85144757-85144779 CCCTGTCGACATCCGGATTTTGG - Intergenic
1151039099 17:70837840-70837862 CCATTTCAATAACAGGGTTTAGG - Intergenic
1151193890 17:72418248-72418270 CCCTCTCCATACCTTGATTTTGG - Intergenic
1151649075 17:75454802-75454824 CACTTGCGATCCCAGCATTTTGG + Intronic
1151694961 17:75709997-75710019 GCCTTTTAATACCAGGACTTTGG + Intergenic
1162148434 19:8628211-8628233 CCCTGTCGACACCTTGATTTTGG - Intergenic
926216357 2:10907972-10907994 CCCTGACGACACCTGGATTTTGG - Intergenic
926438919 2:12867016-12867038 CCCTGTCGACACCTTGATTTTGG - Intergenic
927807623 2:26161931-26161953 CCCTTTCAATGGCAGGATTTAGG - Intergenic
929140921 2:38666028-38666050 CCCTTTCCCTGCCTGGATTTAGG - Exonic
930326593 2:49927698-49927720 CCCATTCTATATCAGGAATTAGG - Intronic
936449509 2:112623440-112623462 TCTTTTAGATAACAGGATTTGGG + Intergenic
940595824 2:155791445-155791467 CCCTTTTGATACCTTGATTTTGG - Intergenic
943265926 2:185732349-185732371 CCTTGTCAATACCTGGATTTTGG + Intergenic
948540215 2:238685960-238685982 CCCTTTAGATCCCAGGACTCTGG - Intergenic
1169856002 20:10103578-10103600 CCCTGTCGACACCTTGATTTTGG - Intergenic
1172237318 20:33387001-33387023 CCCTTATAATCCCAGGATTTTGG + Intronic
1176970356 21:15258045-15258067 CCCTGTCAATACCATGCTTTCGG - Intergenic
1177358266 21:20036951-20036973 CCATATCGCTATCAGGATTTTGG - Intergenic
1178695013 21:34785544-34785566 CCCTTTAGATTCTGGGATTTAGG + Intergenic
1179272041 21:39859060-39859082 CCATATCGCTACCAGCATTTTGG + Intergenic
1181260416 22:21593357-21593379 CCCTTTGGATACCTGTATTTCGG + Intronic
1183004416 22:34889321-34889343 CCATTTCACTACCAGCATTTTGG - Intergenic
949167525 3:959947-959969 CCCTTTCAATACATTGATTTTGG + Intergenic
956606564 3:71078896-71078918 CTCTTTCGTTACCTGGATTCTGG + Intronic
962518417 3:136175423-136175445 CACTTACAATACCAGCATTTTGG + Intronic
978009625 4:103663649-103663671 CCCTTTCTACAACAGTATTTTGG - Intronic
984056653 4:174938820-174938842 CCCTGCCGACACCTGGATTTTGG - Intronic
984364009 4:178774729-178774751 CCTTTACGATGCCTGGATTTGGG - Intergenic
985422853 4:189801888-189801910 CCCTGTCGACACCTCGATTTTGG - Intergenic
986284262 5:6348236-6348258 CCCTGTCGACGCCTGGATTTTGG - Intergenic
987940571 5:24530734-24530756 ACTTTTAGATATCAGGATTTAGG + Intronic
988377973 5:30462718-30462740 CCCCTTGGATACCAAAATTTGGG - Intergenic
989122756 5:38020672-38020694 GCCTTGCTATACCAGGATGTGGG - Intergenic
990375369 5:55165173-55165195 CCCTTTTTATACTAGAATTTAGG - Intronic
991131153 5:63123626-63123648 CCCTGTCGACACCTTGATTTCGG - Intergenic
994275176 5:97828272-97828294 CCCTCTCAAAACCAGGACTTTGG - Intergenic
1001129785 5:169054368-169054390 CCCTGTCCACACCTGGATTTTGG + Intronic
1001304608 5:170562598-170562620 CCCATTGGATGCCAGGCTTTGGG - Intronic
1001601550 5:172932264-172932286 CCCCTTGGATACCGGGAATTGGG - Intronic
1002443409 5:179275734-179275756 CCCTGCCGATGCCTGGATTTGGG + Intronic
1006818922 6:36874869-36874891 CCCTTTCGATACCAGGATTTGGG + Exonic
1007978631 6:46128077-46128099 TCCTTACTATAACAGGATTTTGG + Intergenic
1009342316 6:62571552-62571574 CTTTTTCTATACCAGGCTTTAGG + Intergenic
1010785199 6:79992670-79992692 CCCTATCTCTACCAGCATTTTGG - Intergenic
1012159531 6:95866157-95866179 CCCTTCAGATACCATGATTTGGG + Intergenic
1012202629 6:96424824-96424846 CCCTATCACTACCAGCATTTTGG + Intergenic
1021077157 7:16319045-16319067 CCCTTTCAATATCATAATTTTGG + Intronic
1024583761 7:50823419-50823441 CCCTTCTGATACCTTGATTTTGG - Intergenic
1027937742 7:84631636-84631658 CCATATCGATATCAGGCTTTTGG - Intergenic
1030547620 7:110917241-110917263 CCCTTTCAATACCAGACTTGTGG + Intronic
1030832367 7:114241380-114241402 TCCTTTCCTTACCTGGATTTTGG - Intronic
1034458149 7:151182794-151182816 CCCTTACGATGACAGGTTTTTGG - Intronic
1035988126 8:4457139-4457161 ACCTTTTGATACCATGATTTGGG + Intronic
1036508031 8:9373785-9373807 CCCATTTGATAACTGGATTTGGG - Intergenic
1041644666 8:60239061-60239083 CCCTTTTGATAAAATGATTTTGG - Intronic
1044901685 8:96952888-96952910 CCCTATCAATACCAGCTTTTAGG - Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1052755003 9:32531938-32531960 CTCTTCCAATACCTGGATTTGGG + Intergenic
1056574656 9:87846287-87846309 GCCTTTTGATTCAAGGATTTTGG + Intergenic
1061771856 9:132930798-132930820 CCTTTTTGATACCATGATATAGG + Intronic
1062152403 9:135028330-135028352 CCCTTTCAATCCCAGCATGTGGG + Intergenic
1185973489 X:4691598-4691620 CACTTTCCATACCAGCATTCAGG - Intergenic
1186240672 X:7562011-7562033 GCCTTTTCATACCATGATTTTGG + Intergenic
1187077028 X:15945645-15945667 CCCTGTGGATACCTTGATTTTGG - Intergenic
1188962458 X:36508751-36508773 CCATGTCAATATCAGGATTTTGG + Intergenic
1190756483 X:53406016-53406038 CCCTTTCCATACTGGGAATTAGG - Intronic
1191603946 X:63041587-63041609 AACTTTGGATCCCAGGATTTGGG - Intergenic
1192831720 X:74757054-74757076 CCTTTTCTGTGCCAGGATTTGGG + Intronic
1194902835 X:99535507-99535529 CCTTCTCGTTTCCAGGATTTTGG - Intergenic
1199220632 X:145311884-145311906 CCTTTTCAATATCAGCATTTTGG + Intergenic