ID: 1006819790

View in Genome Browser
Species Human (GRCh38)
Location 6:36883716-36883738
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 2, 1: 18, 2: 33, 3: 68, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006819790_1006819795 19 Left 1006819790 6:36883716-36883738 CCTTCACTCTTCTAGAAAGACAT 0: 2
1: 18
2: 33
3: 68
4: 295
Right 1006819795 6:36883758-36883780 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248
1006819790_1006819793 3 Left 1006819790 6:36883716-36883738 CCTTCACTCTTCTAGAAAGACAT 0: 2
1: 18
2: 33
3: 68
4: 295
Right 1006819793 6:36883742-36883764 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006819790 Original CRISPR ATGTCTTTCTAGAAGAGTGA AGG (reversed) Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
903197837 1:21706137-21706159 AGTTCTTTGTAGAAGAGTGGCGG - Exonic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906951753 1:50340708-50340730 CTGTGATTCTAGAAGAGGGATGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907713460 1:56906062-56906084 AAGTCTTGCTAGAAGATGGATGG - Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911194614 1:94981163-94981185 CTTTCTTTCTAGAACAGTCAAGG + Exonic
911263164 1:95711329-95711351 TTTTCTTTCCAGAAGAGAGAAGG + Intergenic
911532717 1:99064720-99064742 ATTTCTTTCCAAAACAGTGAAGG - Intergenic
915286840 1:154858613-154858635 ATATGTTTCCAGAAGAGGGATGG + Intronic
915955365 1:160216210-160216232 CCTTCTTTATAGAAGAGTGAAGG - Exonic
916177279 1:162053017-162053039 ATTTCTTTCTGGACCAGTGAAGG + Intergenic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917376434 1:174352912-174352934 ATCTCTTTGGAGAAGAGTAAAGG - Intronic
917407871 1:174727911-174727933 ATTTCTTTGTAGAAGAGGAAAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
919586956 1:199450947-199450969 TTGTCTTTTAAGAAGAGTTAGGG - Intergenic
919635438 1:199999020-199999042 TTGTCTTTTTAGAAGAGACAGGG - Intergenic
919944756 1:202310971-202310993 CTGTGTTTCTGGAAGAGTTAGGG + Intronic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923709817 1:236378261-236378283 TTGTGTTTGTAGAAGAGGGAGGG - Intronic
1063048852 10:2423077-2423099 GTGTATTTACAGAAGAGTGAAGG - Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1064871094 10:19937776-19937798 ATTTCTTTCTAGATGAGGAAGGG + Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066686298 10:37984707-37984729 TTGTCTTTTTAGTAGAGAGAGGG - Intergenic
1066706553 10:38185698-38185720 ATGTCTCTCCATAAGAGTAAGGG - Intergenic
1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG + Intergenic
1068725356 10:60294883-60294905 AAATCTTTCTAGAAGTGCGAAGG + Intronic
1068770886 10:60819378-60819400 AATTTTTTGTAGAAGAGTGAAGG + Intergenic
1069235257 10:66063499-66063521 ATCTCTCTCTAAAAGAGTAAAGG - Intronic
1071130536 10:82387725-82387747 AAGTCTTTCTAGAACAAAGATGG - Intronic
1071219791 10:83451896-83451918 TTGTATTTCTAGTAGAGTCAGGG - Intergenic
1071790936 10:88953242-88953264 ATGTATTTATAGACGACTGAAGG - Intronic
1073508975 10:104030733-104030755 AAGTCTTTTTAGAAGAGTAGTGG + Intergenic
1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG + Intergenic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1075981087 10:126740161-126740183 CTTTCTTTCTAGAAAGGTGATGG + Intergenic
1076499821 10:130928792-130928814 AAGTCTTTCTAGAAGGAAGAAGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078576878 11:12510038-12510060 ATGTCTTTGTGGCAGAGAGAGGG - Intronic
1079164297 11:18024411-18024433 ATGTCTGGCTAGAAGACAGATGG + Intronic
1079619522 11:22536152-22536174 AAGGCTTTCTAGAAGAGGTAAGG - Intergenic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083067108 11:59936177-59936199 ATGTCTTTTCAGAAGAGTCTTGG - Intergenic
1083299179 11:61731302-61731324 ATCTCTTGCTAGAAGAGAGGAGG - Exonic
1083444627 11:62699538-62699560 ATGTCTTTATAGAAGATTCTAGG + Intronic
1084697735 11:70765830-70765852 ATGTCATTCAAGAAAAGTGTTGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085868191 11:80319621-80319643 ATGTTTTCCTGGAAGAGAGATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087318221 11:96629690-96629712 ATATCTTTCTAGAGGTTTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090637566 11:128700465-128700487 AGGGCTTTCTAGGAGAGTGGAGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093910693 12:24743609-24743631 TTGTATTTTTAGAAGAGTCAGGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097786001 12:63759614-63759636 ATTTCTTCATAGAAGAGTTAAGG + Intergenic
1097810065 12:64009363-64009385 ATGTGTTTCTTGAAGAGCTAGGG + Intronic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1098881574 12:75922653-75922675 GTGTCTTTCTAGAAGTGATAAGG + Intergenic
1098890235 12:76003087-76003109 ATGTTTTTCTAAAACAGTCATGG - Intergenic
1099046697 12:77729361-77729383 ATTTCATACTTGAAGAGTGAAGG + Intergenic
1100009694 12:89938439-89938461 TTGTGTATCTAGAAGAGAGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100806155 12:98285785-98285807 ATATATTACTAGAAGAGGGATGG - Intergenic
1101071900 12:101084473-101084495 ATGTCATTTTAGAACAGTAAAGG + Intronic
1101078620 12:101158152-101158174 ACCTCTTTCTTGAAAAGTGATGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102003025 12:109569938-109569960 ATTTGTTTCTAGAAGACAGAAGG - Intronic
1105286694 13:19009936-19009958 ATGTCTTTTTAGGAGAGTGTTGG - Intergenic
1105614969 13:22003390-22003412 TTGTTTTTCTAGAAGGGTAAAGG + Intergenic
1106542950 13:30706176-30706198 ATGCCTTTCTAGGAGATTGGTGG + Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106721159 13:32435741-32435763 ATGTCTTTCTAGTTGAGAAATGG + Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108395336 13:49985960-49985982 AATTCTTTCTGGAAGAATGATGG - Intergenic
1109688999 13:65861374-65861396 ATGTATTTCAAGTAGAGGGAAGG - Intergenic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110232069 13:73177519-73177541 TTGTTTTTCTAGTAGAGTGATGG - Intergenic
1110260603 13:73480752-73480774 ATGTCTTTCTGGTAAAGTCAGGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111127359 13:83929014-83929036 CTGTCTTTCTAAAATAATGATGG + Intergenic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111610259 13:90596367-90596389 ATGTCTTTTTCAAAGAGTTAGGG - Intergenic
1112418320 13:99224250-99224272 ATGTCTTTTAAGAAAAGGGAGGG - Intronic
1112509803 13:99998809-99998831 TTGTATTTTTAGAAGAGAGACGG + Intergenic
1113049284 13:106190671-106190693 TTGTCTCTTTAGAACAGTGATGG - Intergenic
1113256199 13:108508850-108508872 GTGTCTTTTTGGGAGAGTGAGGG + Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1116858052 14:49971124-49971146 GTGTCTTTGGAGAAGAGTGATGG + Intergenic
1116875192 14:50104476-50104498 CTGTATTTCTATTAGAGTGAAGG + Intergenic
1118285466 14:64466595-64466617 AAGTCATTCTAGAACAATGACGG - Intronic
1118675092 14:68175559-68175581 ATTTCTTTCTAAATGAGTGCTGG + Intronic
1120649792 14:87118438-87118460 ATACCACTCTAGAAGAGTGAAGG - Intergenic
1120838265 14:89060485-89060507 ATGTATTCTTAGAAGAGGGAGGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1122758664 14:104003473-104003495 ATATCTATCTAGAAGGGTGAAGG - Intronic
1124638369 15:31379501-31379523 ATTTCTTTCCAGAAGACTGGGGG + Intronic
1127926594 15:63550190-63550212 TTGTATTTTTAGAAGAGAGAGGG + Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130901516 15:88210205-88210227 ATGTTTTTCTTGAATAGGGAGGG + Intronic
1131432621 15:92398932-92398954 CTGTCTTTCTAAATGACTGATGG - Intronic
1131484892 15:92812009-92812031 ATATCAATTTAGAAGAGTGAGGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134829539 16:17312078-17312100 AAGGCCTTCTAGAAGAGTCAAGG + Intronic
1139032836 16:62906200-62906222 TTTTCTTTATAGAAGAGTTAGGG + Intergenic
1140225156 16:73071069-73071091 AGGTGTTTTTAAAAGAGTGAGGG - Intergenic
1140936970 16:79681152-79681174 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1142029646 16:87832134-87832156 CTCTGTTTCTAGAAGACTGAAGG + Exonic
1142118827 16:88375986-88376008 ATTTTTTTCTAGAAGAATGTTGG + Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1148370587 17:47096887-47096909 TTGTCTTTTTAGTAGAGTCAAGG - Intergenic
1148584155 17:48765463-48765485 ATATTTATCTAGAAGAGTGCTGG + Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1150497679 17:65621097-65621119 TTGTATTTTTAGAAGAGAGAGGG - Intronic
1151291461 17:73153504-73153526 TTGTATTTTTAGAAGAGTCAGGG - Intergenic
1151909697 17:77073924-77073946 CTGTCATTCTAGTAGAGGGAGGG - Intergenic
1152536325 17:80952167-80952189 GTGACTTTCAAGAAGAGTGGTGG - Intronic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155898464 18:31358671-31358693 ATGTCTTTCCAAAATAGTCATGG - Intergenic
1155966267 18:32038220-32038242 TTGTCTTTTTAGTAGAGAGAGGG + Intronic
1156794950 18:41033084-41033106 ATGTATTAACAGAAGAGTGACGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157109714 18:44809207-44809229 TTGCCTTTATAGGAGAGTGAAGG - Intronic
1157735940 18:50049113-50049135 AAGTCTTTCTAAAACAGTGGTGG - Intronic
1157840239 18:50950659-50950681 TTGTATTTTTAGAAGAGTGGGGG + Exonic
1158188888 18:54803086-54803108 ATGTATATCTAGAAGAGGAAAGG + Intronic
1158448179 18:57539471-57539493 ATTATTTTCTAGAACAGTGATGG - Intergenic
1159508877 18:69370162-69370184 ATGTCTTTCTCTAAGAGCTATGG - Intergenic
1159609075 18:70506845-70506867 ATGTCTTTCTGGGAGAGAGGAGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1162229779 19:9256542-9256564 ACATCCTTCTAGAATAGTGATGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1162811789 19:13168534-13168556 TTGTATTTCTAGTAGAGTCAGGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1164893522 19:31846801-31846823 ATGGCTTTCTATAACAATGATGG + Intergenic
1165311685 19:35032326-35032348 ATTTCTTTCAACAAGAGAGAGGG + Intronic
1166322097 19:42024838-42024860 ATGGCTTCCCAGAGGAGTGAAGG - Intronic
1166759192 19:45213770-45213792 ATGTATTTTTAGTAGAGAGAGGG - Intronic
1168023513 19:53626872-53626894 TTGTATTTCTAGTAGAGTCAGGG + Intergenic
1168526224 19:57090686-57090708 GGGTCTTTGCAGAAGAGTGAAGG + Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
927016625 2:18970031-18970053 ACATCTTTCCAGAAGAGAGAGGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928459323 2:31456095-31456117 ATGTCTTTCTATTAGAAAGAGGG - Intergenic
929428940 2:41870659-41870681 ATGTCCTTCAAGAAGAGTTTAGG + Intergenic
930129046 2:47829411-47829433 ATGTATTTCTAGTAGAGACAGGG + Intronic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933666492 2:84969503-84969525 ATCTCTTTCTACAAGAGAAATGG + Intergenic
938705767 2:133924189-133924211 ATGGCTTTCAAGAAGGATGAAGG + Intergenic
938755420 2:134374818-134374840 ATGTATTTTTAGAAGAGATAGGG - Intronic
939058432 2:137391513-137391535 TTGTATTTCTAGTAGAGAGAGGG - Intronic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
941590840 2:167418433-167418455 ATGTTTTTCTAGGTGATTGAAGG + Intergenic
941889624 2:170565632-170565654 CTGTCTGTCTAGAACAGTGGGGG + Intronic
941940184 2:171027988-171028010 TTGTATTTTTAGTAGAGTGAGGG - Intronic
942236415 2:173911988-173912010 TTGTCTTTCTAGGAGAGACACGG + Intronic
942544419 2:177047966-177047988 TTCTCTTTCTAAAAGAGAGAAGG - Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943410814 2:187544940-187544962 TTGTGTTTTTAGAAGAGTCAGGG - Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945382223 2:209154529-209154551 AAGTCTTTCTAGATGAAAGAAGG - Intergenic
947973136 2:234341526-234341548 ATGTGTTTCTATCAGAGTGGCGG + Intergenic
948331420 2:237169524-237169546 AAGTCTTTGAAGAAGAGAGAGGG + Intergenic
1169222009 20:3829426-3829448 TTGTATTTTTAGAAGAGAGAGGG + Intergenic
1169435998 20:5590902-5590924 ATGTATTTCTACAAAAATGAAGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1173872480 20:46350641-46350663 ACATCTTCCTAGAGGAGTGACGG + Intronic
1175082773 20:56435086-56435108 ATGTCTTTCTGGGTGCGTGAAGG + Intronic
1175759024 20:61548763-61548785 ATTTCTTTTTAGAAGAATAATGG - Intronic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177350442 21:19932600-19932622 GTGTATTTATAGAAGGGTGAGGG + Intergenic
1177411374 21:20734352-20734374 ATGGCTTTCTAGTCGAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181318838 22:21989269-21989291 ATGTCTTTCCAGCAGTGTCAGGG - Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1182589314 22:31366621-31366643 TTGTATTTTTAGAAGAGTCAGGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183978035 22:41524459-41524481 ATGTCTTGCTAAATGGGTGAAGG + Intronic
1184555577 22:45231076-45231098 ATGTATTTTTAGTAGAGAGATGG - Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950199825 3:11034983-11035005 GTATGTTTCTAGAAGAGGGAGGG + Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952217369 3:31290801-31290823 ATGGCTTTCTATAGGAGTGGAGG - Intergenic
956246690 3:67191437-67191459 ATTTCTTTCTAGTATGGTGATGG + Intergenic
956377522 3:68631571-68631593 ATGTTTTGCTAAGAGAGTGAGGG - Intergenic
957406638 3:79780442-79780464 ATGTCTTTCTGCAAGACAGATGG - Intergenic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958584622 3:96069856-96069878 TTGTATTTCTAGAACAGTTATGG + Intergenic
959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG + Intergenic
959976746 3:112469363-112469385 AGGTCTTTCTGGAAGAGAGTAGG - Intronic
960432180 3:117582504-117582526 AAGTCTTGCTAGAATTGTGAGGG - Intergenic
960664952 3:120099720-120099742 TTGTGTTTTTAGTAGAGTGAGGG + Intergenic
961748429 3:129081112-129081134 CTGTATTTCTAGTAGAGTCAGGG + Intergenic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
962850572 3:139305731-139305753 ATGCCTTTCTTGCAGGGTGACGG + Intronic
963543525 3:146625607-146625629 ATATCTTGATAAAAGAGTGAGGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966542139 3:181103733-181103755 TTGTCTTTGAAGAAGAGTCAAGG + Intergenic
967648501 3:191956068-191956090 GCGTATTTCTAGAGGAGTGAAGG + Intergenic
968242943 3:197108526-197108548 ATGTCTTTCTAGAAATGTATTGG + Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969219523 4:5750821-5750843 ATGTTTGTATAGAAGAGGGATGG + Intronic
969603996 4:8193168-8193190 AGGTCGTTCTAGAAGAGGGGAGG - Intronic
969923451 4:10562258-10562280 ATGTATTACTACAACAGTGATGG + Intronic
970040298 4:11789263-11789285 ATGTGTTTCTAGAAGCCAGATGG + Intergenic
972013112 4:34209065-34209087 TTGTATTTTTAGAAGAGTCAGGG + Intergenic
972633795 4:40864697-40864719 ATCTCTTTATAGTACAGTGAAGG - Intronic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
972951072 4:44323319-44323341 TTGTATTTTTAGAAGAGGGAGGG - Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974779613 4:66536659-66536681 ATATCTTTCAAGAAGAGAGCAGG + Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975932360 4:79540228-79540250 TTGTCTTTTGAGAAGAGTGGAGG + Intergenic
978137551 4:105281049-105281071 ATGTCTTTCCAGGAGAGGCAAGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
981742978 4:148022434-148022456 ATGACTTTATTGAAGAATGAAGG + Intronic
981824411 4:148923872-148923894 ATGTCTTATTAGAAGACTGCTGG - Intergenic
982084840 4:151823946-151823968 ATGTTTTTCTGCAAGAGAGAAGG - Intergenic
982931274 4:161410176-161410198 ATGTATTTTTAGAATAGTTAAGG - Intronic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
984115399 4:175674347-175674369 TTGTCTTTTTAGAAGAGGCAGGG + Intronic
984473492 4:180208077-180208099 TTGTCTTTCTAAAAAACTGAAGG - Intergenic
984830416 4:183967498-183967520 GTGTCTTTAAGGAAGAGTGAAGG + Intronic
987535947 5:19187690-19187712 GTGTCTTTATAGAAGAATAATGG - Intergenic
987595068 5:19987698-19987720 ATGTCTATCTGTAAAAGTGAGGG - Intronic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
990963410 5:61418593-61418615 GTGACTATCTAGATGAGTGAGGG + Intronic
991580577 5:68151004-68151026 TTGTATTTCTAGAAGAGACAGGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
994058106 5:95442686-95442708 AAGTCTTTCTATCAGAGTGGAGG + Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
995033009 5:107500520-107500542 ATTTTTTTCTAGAAGAGAGCAGG + Intronic
996532336 5:124539432-124539454 AGGACTTTATAGATGAGTGATGG + Intergenic
998682618 5:144487200-144487222 ATGTCATTCTGGAACAGTGGAGG - Intergenic
998684652 5:144509964-144509986 ATGTCTTTTTAGAGGATTCAGGG + Intergenic
998733930 5:145113134-145113156 ATGTATTTCTAGAGGAATCATGG - Intergenic
1000021866 5:157325186-157325208 ATGGCTTTGTAGGAGAGGGATGG + Intronic
1000382806 5:160644353-160644375 CTGTTTTTTCAGAAGAGTGATGG + Intronic
1000472566 5:161663752-161663774 CTGTCTGTGAAGAAGAGTGAAGG + Intronic
1001815687 5:174667527-174667549 ATGTATTTCAAGGAGAGTTAAGG - Intergenic
1002970669 6:2015190-2015212 AAGTCTTTTTAGCAGATTGATGG - Intronic
1003091653 6:3109000-3109022 ATATCTTTGTAGGAGAGAGAAGG - Intronic
1003349694 6:5304520-5304542 ATTGCTTTCCAGAAGAGTGGAGG + Intronic
1004311848 6:14553062-14553084 AGGACTCTCTAGAAGCGTGATGG - Intergenic
1004314310 6:14572626-14572648 AGGTGTTTCTAGAACAATGAGGG + Intergenic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007847120 6:44768498-44768520 AACTCTTTCTTGAAGAGTGAGGG - Intergenic
1009303280 6:62054565-62054587 ATGTCTTTTTAAAAGAAAGAAGG + Intronic
1009595540 6:65730525-65730547 ATCCCTTGCTAGATGAGTGATGG + Intergenic
1009719694 6:67451694-67451716 AATTCTTTCTAGAATAGTGTGGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011880189 6:92014752-92014774 AAGTCTTCCTAGAAAACTGATGG - Intergenic
1012883448 6:104817636-104817658 CTGTCTTTGTAGAAGAGAGTAGG + Intronic
1013204153 6:107931573-107931595 TTGTCTTTTTAGTAGAGAGAGGG - Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014407969 6:121075061-121075083 ATGTTTTTCTAAATGTGTGATGG - Intergenic
1014646482 6:123980261-123980283 ATGTCTTTTTTGAAGACTGGAGG + Intronic
1015203910 6:130613705-130613727 ATATCTTCCATGAAGAGTGACGG - Intergenic
1015792547 6:136978596-136978618 TTGTATTTCTAGTAGAGTCAGGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017018481 6:150120557-150120579 ATGTATACCTAGAAGAGGGACGG + Intergenic
1017093066 6:150778998-150779020 ATGTGTTTCTAAGAGAGTGCAGG + Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020511401 7:9061489-9061511 ATTTTTTTCCTGAAGAGTGAAGG - Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021327006 7:19284781-19284803 ATGTCTTTTTAGAAGTTTAAAGG + Intergenic
1021362210 7:19729578-19729600 ATCTCATTCTAGAATAGTAAAGG + Intronic
1022761387 7:33356829-33356851 ATTTCTTTATAGAGGAGTCAGGG - Intronic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1023569808 7:41560295-41560317 TTGTGTTTCTAGAAGGGGGAGGG + Intergenic
1024790945 7:52964298-52964320 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1025162478 7:56674249-56674271 TTGTATTTTTAGTAGAGTGAGGG - Intergenic
1025784947 7:64635709-64635731 GTGTCTTCTTAGTAGAGTGATGG - Intergenic
1025817075 7:64923512-64923534 TTGTATTTTTAGTAGAGTGAGGG + Intronic
1026435165 7:70390324-70390346 GTGTCTTTTTAGAAAGGTGATGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1029354461 7:100041359-100041381 AAGTCTTTCTAGAAATGTTAAGG - Exonic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031616907 7:123892330-123892352 TTGTATTTCTAGTAGAGTCAGGG - Intergenic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033056298 7:138058079-138058101 ATGTCTTTATATAAGAGAGAGGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033620970 7:143061780-143061802 ATGACTTTCTATAAGAGGGTTGG + Intergenic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1036902950 8:12685438-12685460 ATCTTTTTCTAAAAGAGAGAAGG - Intergenic
1036924185 8:12888226-12888248 ATGTATTTGTGGAAGATTGAAGG + Intergenic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1038008381 8:23453766-23453788 ATGAATTTCTGGAAGTGTGATGG - Intronic
1038609109 8:29043022-29043044 TTGTCTTTCTAGAAAACAGATGG + Intronic
1038944080 8:32337422-32337444 ATGGCTATGTTGAAGAGTGAGGG + Intronic
1040045470 8:42959118-42959140 CTGTCTTTCCTGAAGAGGGAAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1040775696 8:51040669-51040691 ATGTCTTTTCAGAAGATTGGAGG - Intergenic
1042254118 8:66785903-66785925 CTGACTGTCTAGCAGAGTGAAGG + Intronic
1042893545 8:73640742-73640764 ATGTATTTCTAGATGAGGCAGGG - Intronic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1043771222 8:84203591-84203613 ATATATTACTAGAAAAGTGAGGG - Intronic
1043799027 8:84583669-84583691 TTATATTTCTGGAAGAGTGAAGG + Intronic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044130413 8:88516701-88516723 ATGTATTTCTAGCAGAATGTTGG + Intergenic
1044433201 8:92133102-92133124 ATGTCTTTCTAGCTGTGTTAAGG - Intergenic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1045390035 8:101706024-101706046 ATGTCTGTTTAGGAGAGTAAAGG + Intronic
1045987024 8:108260836-108260858 ATGTTTTTCCAGAAGAGACAAGG + Intronic
1046107719 8:109686387-109686409 ATGTTTTTCCACAAGAGAGAAGG - Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046296834 8:112230614-112230636 ATGTATTTCTAGTAGAGACAGGG - Intronic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047097974 8:121644036-121644058 AAGTCAATCTAAAAGAGTGAAGG - Intergenic
1047144567 8:122183355-122183377 AAGTCTGTCTAGAATCGTGAGGG + Intergenic
1049512122 8:143033437-143033459 ATCTATTTATAGAAGAGTTAAGG - Intergenic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050423190 9:5488113-5488135 ATGTCTTTATTGTAGAGTGTTGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052037469 9:23699056-23699078 ATGTCTTTCTATAGGAGTGAAGG + Intronic
1052622964 9:30937697-30937719 ATGTGTTTTTAGCAGAGGGAAGG + Intergenic
1054770911 9:69083060-69083082 TTCTCTTTCTAGTAGAGGGAGGG - Intronic
1054915957 9:70495455-70495477 ATGTCTTTGGCTAAGAGTGAGGG + Intergenic
1055172974 9:73283565-73283587 AAGTCTTTCTTGATGAGTGGAGG - Intergenic
1055685828 9:78773693-78773715 ATCTCTTTTTAGAGGAGTGAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058151393 9:101467370-101467392 ATTCCTTTCTTGAAGAGTAAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058628592 9:106961785-106961807 ATGTGTATCTAGAAGGGTCAAGG + Intronic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186219531 X:7334620-7334642 GTGGCTTGCTAGAAGAGTGAGGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187014539 X:15313087-15313109 AAGTCTTTCTATAAGAATGTAGG - Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189187686 X:39068333-39068355 ATGACTTTCTAGAAAACTGTAGG - Intergenic
1189592742 X:42532412-42532434 ATGTCTTTTTGGTAGATTGATGG + Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1192317018 X:70061144-70061166 TTGTATTTCTAGTAGAGTTAGGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193186729 X:78522250-78522272 AAGTCTTTCAAGAAGTTTGATGG + Intergenic
1193575293 X:83187739-83187761 ATGTATTTTTAGTAGAGAGAGGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198194615 X:134347553-134347575 TTGTATTTCTAGTAGAGTCAGGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199441447 X:147872845-147872867 CTATCTATCTAGAAGAATGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1201433955 Y:13936609-13936631 ATATCTTTTTAGTAGAGTGGGGG - Intergenic