ID: 1006824097

View in Genome Browser
Species Human (GRCh38)
Location 6:36921447-36921469
Sequence CTGTGGAGATGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1081
Summary {0: 1, 1: 0, 2: 11, 3: 111, 4: 958}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006824089_1006824097 22 Left 1006824089 6:36921402-36921424 CCATGACATGCAAGTTCTATGAT 0: 1
1: 0
2: 2
3: 7
4: 138
Right 1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG 0: 1
1: 0
2: 11
3: 111
4: 958

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006824097 Original CRISPR CTGTGGAGATGGAGGGGAGA GGG Intronic
900577173 1:3389151-3389173 CTGGGGAGAGGCAGGGGACAGGG + Intronic
900788189 1:4662919-4662941 GCCTGGAGGTGGAGGGGAGAGGG + Intronic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901533531 1:9868075-9868097 CTGTGGACTGGGAGTGGAGAGGG - Intronic
901865505 1:12104297-12104319 CTCTTGAGATGAGGGGGAGAGGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902077628 1:13800504-13800526 ATGTGGAGGAAGAGGGGAGACGG + Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902705951 1:18204578-18204600 GAGGGGAGATGAAGGGGAGAGGG + Intronic
902710996 1:18239694-18239716 TTGACCAGATGGAGGGGAGAAGG - Intronic
902729078 1:18356986-18357008 GAATGGAGATGGAGTGGAGATGG + Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903060618 1:20666178-20666200 GTGTGGAGAGGGTGGGGACAGGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903571801 1:24311364-24311386 CACTGGAGAGGGTGGGGAGAGGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904476260 1:30766479-30766501 TGATGGAGAGGGAGGGGAGACGG - Intergenic
904543517 1:31250176-31250198 CTGTGGAGAAGGGAGGGAGCTGG - Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905336312 1:37247110-37247132 CTGTGGAGATGAAAGGGTGGGGG - Intergenic
905349884 1:37338126-37338148 AGGAGGAGAAGGAGGGGAGAGGG + Intergenic
905404834 1:37725710-37725732 GGGTGGAGATGAAGGGGGGAAGG + Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905584577 1:39106265-39106287 CCGGGGAGATGGAGGGGGTAAGG - Intronic
905688852 1:39927963-39927985 CTGTGCAGTTAGAGGGGAGAAGG - Intergenic
905921510 1:41722473-41722495 GAGGGGAGAGGGAGGGGAGAGGG - Intronic
906472999 1:46146668-46146690 GTGTAGAGTTGGAGGGGAGGGGG - Intronic
906686379 1:47765946-47765968 TGGTGGCGATGGCGGGGAGAAGG + Exonic
906819485 1:48914127-48914149 CTGTGGAGAACGAGAAGAGAAGG + Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906974895 1:50559747-50559769 TTGTGAAGAGGGAGGAGAGAAGG - Intronic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907304583 1:53506627-53506649 CTGTGTAGATGGAGGGGATGTGG + Exonic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907413059 1:54295789-54295811 CATTCCAGATGGAGGGGAGAAGG - Intronic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911181567 1:94865127-94865149 CGGTGGAGATGGCGTGGGGAGGG + Intronic
911293407 1:96084355-96084377 CTGAGGAAATGGATGGGAGCTGG + Intergenic
911305596 1:96228282-96228304 CTGTGAAGACTGTGGGGAGAGGG - Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912129087 1:106579248-106579270 CTTTGGAGACTGAGGGGAAAGGG - Intergenic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912680012 1:111723147-111723169 CTCTGGAGAAGGTGGGGACAAGG + Exonic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912860760 1:113211768-113211790 CAGAGGACAGGGAGGGGAGATGG + Intergenic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
915564628 1:156706653-156706675 CAGTGGAGATGGCAGGGAGACGG + Intergenic
915662919 1:157418528-157418550 CTGAGCAGAAGGATGGGAGATGG - Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915940389 1:160115137-160115159 GTTTGGAGATGGAGGCAAGAGGG - Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917042580 1:170822442-170822464 CACTAGAGATGGAGGGGAGATGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917500364 1:175579742-175579764 CCTTGGAAATAGAGGGGAGAGGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
918333167 1:183479791-183479813 AGGTGGAGATGGGGTGGAGAGGG + Intronic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918581462 1:186135766-186135788 CACTGGAAATGGAGGGGAAAAGG - Intronic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
918866943 1:189913734-189913756 ATGAGGAGAGGGAGGAGAGAGGG - Intergenic
919087185 1:192934218-192934240 CTGAAGAGATGGAGTGGAGGTGG - Intergenic
919756167 1:201067414-201067436 AGGTGGAGAGGGAGGAGAGAGGG - Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920212533 1:204338778-204338800 CTGTGGAAATGAAGGGGATGGGG + Intronic
920217083 1:204368568-204368590 CTTTGGAGATGGAGGTGCTATGG - Intronic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
920521825 1:206633563-206633585 CTTGGGAGCTGGAGGGGACAGGG + Intergenic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921254755 1:213329362-213329384 ATGTGGAGCTGGCAGGGAGAAGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922726588 1:227925660-227925682 CAGGGGAGAGGGAGGCGAGAAGG + Intronic
923219431 1:231879783-231879805 CTCTGGAGATGGATCAGAGATGG + Intronic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923467442 1:234261951-234261973 CTGTGGAGATAGAAAGGTGAAGG - Intronic
923918088 1:238530745-238530767 CTGTGGAGATGGTGTGGACCAGG - Intergenic
924090493 1:240496275-240496297 CTGGTGAGATGCAGGGGAGTGGG - Intronic
924101107 1:240603507-240603529 AGGGGGAGATGGATGGGAGATGG - Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924795769 1:247291261-247291283 CTGGGGTGATGGAGGGGTGAGGG - Intergenic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065787569 10:29230383-29230405 CTGTGGAGATAGGAGGCAGAGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067267311 10:44757242-44757264 TGGGGGAGATGGAGGTGAGAGGG - Intergenic
1067267386 10:44757473-44757495 TGGGGGAGATGGAGGTGAGAGGG - Intergenic
1067267396 10:44757499-44757521 TGGGGGAGATGGAGGTGAGAGGG - Intergenic
1067878462 10:50024431-50024453 TTGGGTAGATGGAGGGGGGAAGG - Intergenic
1067893260 10:50153497-50153519 TTGGGTAGATGGAGGGGGGAAGG + Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069734639 10:70645788-70645810 CTTTGGAGATGCAGGGGTGCAGG + Intergenic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1069930798 10:71880433-71880455 GTGGAGAGGTGGAGGGGAGAAGG - Intergenic
1070009207 10:72455877-72455899 CTCTGGAGATGGAAGGGACTGGG + Intronic
1070161317 10:73868309-73868331 GTGTGGGGATGGAGGTGGGAAGG - Intronic
1070488254 10:76951446-76951468 CTATTGAAATGTAGGGGAGAAGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071811798 10:89190132-89190154 CTCTGGAGGTGGGGGGGAAAGGG - Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073968391 10:109017785-109017807 CTATGGAGCTGGGTGGGAGAAGG + Intergenic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074384387 10:113005508-113005530 TTGTCGAGATCAAGGGGAGAGGG - Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1074979408 10:118607824-118607846 CTGTGGAGGTTTTGGGGAGAAGG - Intergenic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075433478 10:122411277-122411299 AGGTGGAGAAGGAAGGGAGAGGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076290706 10:129343457-129343479 GTGTGGAGATAGAGGGGTGAGGG - Intergenic
1076356510 10:129857486-129857508 CTGGGGAGATGGTTGGGAGGTGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077069763 11:663490-663512 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077069780 11:663603-663625 CTGAGGAGATGGAGGAGGAAAGG - Intronic
1077363136 11:2149696-2149718 ATGTGGAGGTGGTGGGGAGTGGG + Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077957151 11:7032964-7032986 CTGTGGAGATGAGGTGGAGGGGG - Intronic
1077980217 11:7292523-7292545 GTGTGGAGTTGGAGGGGAATGGG - Intronic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1078887629 11:15520271-15520293 CAGAGGAGAGGGAGGAGAGAAGG - Intergenic
1079281905 11:19095191-19095213 CTTTCCAGATGGAAGGGAGAAGG + Intergenic
1079284568 11:19117242-19117264 CTGGGGAGATGGAGGGGCCGGGG + Exonic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080192169 11:29564000-29564022 CTGTGCAGATTGTGGGAAGATGG - Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080560267 11:33456860-33456882 CTGAGCAGATGATGGGGAGAAGG - Intergenic
1081409127 11:42735015-42735037 CTTTGCAGAGGGAGGAGAGAAGG + Intergenic
1081412113 11:42772051-42772073 ATGTGGAGATGGAGGAAAAAAGG + Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1082030356 11:47599115-47599137 AAGTGGAGATGGAGGAGTGAGGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083771816 11:64871764-64871786 CTTTGCACCTGGAGGGGAGAGGG + Intronic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084167671 11:67383573-67383595 GGCTGGAGGTGGAGGGGAGATGG - Intronic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084989358 11:72909051-72909073 CCGGAGAGATGGAGGGGGGAGGG - Intronic
1085065899 11:73495437-73495459 CAGTGGTGATGGAGTGGTGATGG - Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085327439 11:75617857-75617879 CAGTTGAGATTGAGGAGAGAAGG + Intronic
1085446362 11:76603661-76603683 GTGGGGAGACGGAGGGGAAAAGG + Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087250701 11:95896049-95896071 CTGGGGAGAGCAAGGGGAGAGGG - Intronic
1087396617 11:97609145-97609167 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1087539568 11:99498565-99498587 CTGTGGAGGTGGGTGGGAGTAGG - Intronic
1087876488 11:103364780-103364802 CTGTGGAGACTGTGGGGAGGAGG - Intronic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089283824 11:117392989-117393011 CTGCTGAGCTGCAGGGGAGATGG - Exonic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1089794541 11:120969699-120969721 CCCTGCAGATGGAGGAGAGACGG - Intronic
1090059157 11:123448815-123448837 CTATGGTGATGGAGCTGAGAAGG - Intergenic
1090109791 11:123894746-123894768 CTTGGGAGAAGGAGGTGAGAGGG + Intergenic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1091004399 11:131939547-131939569 CTGTGCAGATGGAGGGAGTATGG + Intronic
1091146204 11:133282552-133282574 CAGTGCAGAGGGAGGGGAAATGG + Intronic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091305722 11:134535012-134535034 CTGAGGAGCAGGACGGGAGATGG + Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1091903404 12:4163981-4164003 CTGTGGAGCTGAAGGAGACAAGG + Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092875774 12:12846427-12846449 CTCTGGAGATTGAGGTGGGAGGG - Intergenic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1093087971 12:14887706-14887728 TTCTGGAGATGGAGTGGGGATGG - Intronic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093685099 12:22046269-22046291 ATGTGGAGAAGCTGGGGAGAAGG + Exonic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1094038056 12:26091537-26091559 CTGTGGCCATGGAAGAGAGATGG - Intergenic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1095995972 12:48085054-48085076 CTGCAGGGATGGCGGGGAGAAGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097276062 12:57814307-57814329 CGGTGCAGGTGGTGGGGAGAAGG + Intronic
1099159140 12:79218524-79218546 CTGTGGTGATTGTGGGGAGGTGG - Intronic
1099293741 12:80804400-80804422 CCATGGAGATAGAGGGTAGAAGG - Intronic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100246419 12:92762326-92762348 ATTTGGAGGTGGAGGAGAGAGGG + Intronic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1100648471 12:96558040-96558062 TTGTGGAGGTGGCAGGGAGATGG + Intronic
1100964530 12:99998397-99998419 CTTGGGAGATGGAGGTGGGAGGG + Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1102191681 12:110993470-110993492 CTGGGGTGAGGGAGGGGTGAGGG - Intergenic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102657204 12:114492050-114492072 CTTTGGAGAGGAAGGGGAGTGGG + Intergenic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102866902 12:116381891-116381913 CCCTGGAGATGCTGGGGAGAGGG - Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103561659 12:121796051-121796073 TTGTGGTGATGGAGGGGGGCTGG + Intronic
1103578866 12:121899509-121899531 ATGTGGAGCTAGAGGTGAGAAGG - Intronic
1103948730 12:124540690-124540712 GGGTGGAGATGGAGGGGGGTGGG + Intronic
1104006772 12:124898540-124898562 GTGCGGAGATGGAGGGGTGCAGG + Intergenic
1104053296 12:125210631-125210653 CAGGGGAGGTGGAGGGGACAGGG + Intronic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1104636533 12:130440975-130440997 CTGGGGAGATGGTAGGGAGGTGG - Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105274913 13:18911764-18911786 CTGGTGAGATTGTGGGGAGAAGG - Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1106263842 13:28092234-28092256 TTGGGGAGAGGGAGGAGAGAGGG - Intronic
1107823384 13:44306194-44306216 TTGAGAAGATGGAGGTGAGAGGG + Intergenic
1108165774 13:47691833-47691855 GTGTGAAGATGGAGAAGAGAGGG - Intergenic
1108664404 13:52615536-52615558 GTGGGGAGTTGGAGGGGAGGTGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1113375613 13:109762699-109762721 CTGGGGACAGGGAGGTGAGAAGG - Intronic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1114376645 14:22153518-22153540 CTATGGACATAGAGGGTAGAAGG + Intergenic
1114454248 14:22845134-22845156 CTGTGGACAGGGTGGGGACAGGG - Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117029121 14:51651533-51651555 CTGTGGAGACGGAGGTGCGAGGG - Intronic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118576336 14:67245009-67245031 CTTTGAAGATGGAGGAGAGCAGG + Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1120068285 14:80072054-80072076 CTTTGGAGAAAGAGGGGCGATGG - Intergenic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120901912 14:89582766-89582788 CAGGGGAGATGGCTGGGAGAAGG - Intronic
1121108165 14:91294129-91294151 CTGTGGTGAGGGTGCGGAGAGGG + Intronic
1121353886 14:93196822-93196844 CTGGGAAGAGGGAGGGGAGTAGG - Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121823847 14:96994221-96994243 GTCTGGAGCTGGTGGGGAGATGG + Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1121991972 14:98567074-98567096 GGCTAGAGATGGAGGGGAGAGGG - Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122268683 14:100558620-100558642 CTGTGGATTTGTAGGGGCGATGG - Intronic
1122356474 14:101125916-101125938 CTGGGCAGACGGCGGGGAGATGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1122887228 14:104715507-104715529 CTGCGGAGAGGGAGGGGATGGGG - Intronic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1124866129 15:33493134-33493156 GGGTGAAGATTGAGGGGAGAGGG - Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125976135 15:43953383-43953405 TGGTGGAGATGGGTGGGAGAGGG + Intronic
1125983242 15:44023229-44023251 CTGGGGAAATTGAGGGGAAATGG - Intronic
1126353232 15:47767159-47767181 CTGCGCAAAAGGAGGGGAGAAGG - Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126567213 15:50113035-50113057 CTGGGCAGCTGGAGGAGAGAAGG - Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1127993457 15:64137398-64137420 CTGTCGAGAGGGAGGTGTGAAGG + Intronic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1128697927 15:69782225-69782247 CTGTGGACATGAGAGGGAGATGG + Intergenic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1128963764 15:72036900-72036922 CTGTAGAGATGGTGGGGGAAGGG + Intronic
1129058384 15:72838863-72838885 CTGGGGAGGTGGGGGGGATAGGG - Intergenic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129309606 15:74696785-74696807 CTCTGGTGATGGAGGGGGAAGGG - Intergenic
1129674244 15:77623684-77623706 CTGAGGAGGAGGAGGGGAAAGGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1129908558 15:79207232-79207254 CTGTAGACATTGAGGGGAGAGGG - Intergenic
1130013772 15:80172270-80172292 CTGTAGAGATGACGGGGAGGAGG + Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131178298 15:90223758-90223780 CGCTGGAGATGGAAGGGTGAAGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131314237 15:91318814-91318836 ATGGGGAGAGGGACGGGAGAGGG - Intergenic
1131354419 15:91732285-91732307 TTGTGGAGATGGAGGGTTTAGGG + Intergenic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1132083934 15:98891302-98891324 CTGTGGAGAGAGAGGAGAGACGG - Intronic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132212784 15:100036771-100036793 CGGTAGAGATGGAAGGTAGATGG - Intronic
1132285924 15:100662275-100662297 CTGTCAAGATGTAAGGGAGAGGG + Intergenic
1132574699 16:659065-659087 CGCTGGAGAGGGAGGAGAGAGGG - Exonic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132891239 16:2205794-2205816 CTGCGGAGGTGGGGGGGGGACGG + Intronic
1133215630 16:4290602-4290624 GTGAGCTGATGGAGGGGAGACGG - Intergenic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133721556 16:8499002-8499024 TTGTGGAGTTGGAGTTGAGATGG - Intergenic
1133933646 16:10252102-10252124 CTGTGGAGGTGGCAGAGAGAAGG - Intergenic
1134213951 16:12301430-12301452 ATGTGGAGATTTGGGGGAGAGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135779032 16:25282766-25282788 ATGTGGAGATCGGGGGGAAAAGG - Intergenic
1135829118 16:25757998-25758020 CTGGAGAGAGGCAGGGGAGAAGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136068730 16:27775657-27775679 TGGTGGAGAGGAAGGGGAGAGGG + Intronic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137639699 16:50017817-50017839 CTGGGGAGGTGGTGGGGGGATGG - Intergenic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1138197544 16:55062701-55062723 ATGTGGAGATGGAAGGGGAAAGG + Intergenic
1138534753 16:57653945-57653967 CGGTGGTGATGGTGGGGAGGGGG - Intronic
1139422298 16:66856168-66856190 TTGAGGAGATGGTGAGGAGAGGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140888093 16:79261907-79261929 CAGTGGAGAGGGCTGGGAGAAGG + Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141515251 16:84539763-84539785 CAGTGGAGAATGAGGGGTGAGGG + Intronic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141675267 16:85514272-85514294 CAGTTGAGATTCAGGGGAGAAGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1142014947 16:87740427-87740449 CTCTGGAGCAGGAGGGGAGGCGG - Intronic
1142254429 16:89006954-89006976 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142254457 16:89007032-89007054 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142254495 16:89007145-89007167 GGGAGGAGATGGAGGGGAGTGGG - Intergenic
1142313181 16:89326041-89326063 CTGTGAAGACGAAGGGGAGGAGG + Intronic
1142706395 17:1697688-1697710 CTGGGGAGATGGAGGAGATGGGG - Intergenic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1142797970 17:2323632-2323654 CTGTTGATATGGAAGGGAGTAGG - Exonic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143370009 17:6433748-6433770 ATGTGAAGATGGAGGGAACAAGG - Intronic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143620090 17:8075747-8075769 CTGAGGAGTGGGAGGGGAGGAGG - Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1143668056 17:8376016-8376038 TTGTTGAGATGAAGGAGAGATGG - Exonic
1144110168 17:12022716-12022738 CTGTGAAGATGGGGGAGGGAAGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1146351856 17:32101933-32101955 ATGTAGAGATGTAGGGGAGGAGG + Intergenic
1146630008 17:34463038-34463060 GTGTTGATATGGAGGGGAGTTGG + Intergenic
1146683969 17:34827967-34827989 CTGAGCAGGTGGAGGGGTGATGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147137912 17:38444682-38444704 CTGAGGAGGTGCAGTGGAGAAGG + Intronic
1147363692 17:39946671-39946693 CTGGGGAGCAGAAGGGGAGATGG - Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148625549 17:49066466-49066488 ATGTTGAGAAGGAGGGGACAAGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148786781 17:50149593-50149615 CGGTGGAGGTGGAGGAGAGCGGG - Exonic
1148846756 17:50534182-50534204 CTCTGGAGTTTGAGGGGACAAGG - Intronic
1149097976 17:52867950-52867972 CTGGGGAGGTGGAGGGGATTGGG - Intronic
1149109135 17:53005848-53005870 CAGTGGAGTTGGAAGGGAGAAGG + Intergenic
1149109906 17:53016175-53016197 GTGTGGATTTAGAGGGGAGAGGG - Intergenic
1149328301 17:55555735-55555757 CTCTGAAGATGGTGGGAAGATGG - Intergenic
1149575369 17:57708089-57708111 CTGTGGAGGAGGCGGGGAGCAGG - Intergenic
1149869257 17:60168077-60168099 ATGTAGAGATGTAGGGGAGGAGG + Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150569112 17:66370153-66370175 CTGTGGAGGTTGAGGGGATGTGG - Intronic
1150703271 17:67466180-67466202 CTGTAGAGATGGTGGGGTGGGGG + Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151730773 17:75910015-75910037 CTGTGGCGATGGTGGGGTGTGGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152407567 17:80106420-80106442 CTGTGCAGACGCAGGGGACAGGG + Intergenic
1152407600 17:80106548-80106570 CTGTGCAGATGCAGGGGACAGGG + Intergenic
1152441632 17:80313407-80313429 CTGTGGTGATGGAGGTGTGGAGG + Intronic
1152798095 17:82317737-82317759 CTGTGGAGATGCAGGGGCAGTGG - Intergenic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152875067 17:82781742-82781764 CTGTGGAGATCGCAGGGAAATGG + Intronic
1153230821 18:2933856-2933878 CTGTGGAGCTGCAGGGGATGTGG + Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1154155925 18:11944057-11944079 ATGGGGAGCTGGAAGGGAGATGG + Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155249721 18:23942968-23942990 ATGTAGAGATGGGTGGGAGAAGG + Intronic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156525112 18:37759647-37759669 CTGTGGTGATGTGGGGTAGATGG - Intergenic
1156866070 18:41890184-41890206 CTGTGGAAATGGACTGGAGTGGG - Intergenic
1156887734 18:42155224-42155246 CCCTGGAGAGGGAGTGGAGAGGG - Intergenic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157408090 18:47440644-47440666 CTGTGGAGTTTGAGGGGTCAAGG + Intergenic
1157475251 18:48019872-48019894 ATGTGGTGATGGGGGAGAGATGG + Intergenic
1157552076 18:48588932-48588954 ATGTAGAGAGGGAGGGGAAAGGG - Intronic
1157725231 18:49958939-49958961 CAGGGGAGAAGCAGGGGAGAGGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158907676 18:62029665-62029687 GTGGGGAGGCGGAGGGGAGAAGG + Intergenic
1158938015 18:62383048-62383070 GTGTGGAGAGGGGGTGGAGAAGG + Intronic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159617953 18:70603382-70603404 CTGTAAAGATTGAGGAGAGAGGG + Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160789939 19:918674-918696 CTCCGGAGCAGGAGGGGAGAGGG + Intronic
1160790023 19:918924-918946 CTCTGGAGCAGGAGGGGAGGAGG + Intronic
1161010747 19:1958459-1958481 ATGGGGAGATGGGGGGGACAGGG - Intronic
1161839718 19:6672201-6672223 CTTTGGAGATCTAGGGAAGATGG - Intergenic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1162805719 19:13137115-13137137 GGGTAGAGATGTAGGGGAGAAGG + Intronic
1162934755 19:13976392-13976414 CTGTGGAGATGGGAGAGGGAAGG + Intronic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163664003 19:18594623-18594645 CTGGGGAGGTGGGGGGGAGGGGG + Intronic
1164025692 19:21350120-21350142 TTGAGGAGAAGGATGGGAGAGGG - Intergenic
1164463515 19:28468405-28468427 ATGAAGAGAAGGAGGGGAGAAGG + Intergenic
1164463519 19:28468416-28468438 GAGGGGAGAAGGAGGGGAGAAGG + Intergenic
1164618113 19:29678602-29678624 CTGTGGCGAAGCAGGAGAGACGG - Intergenic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1165104389 19:33460489-33460511 CTCTGAAGATGGTGGGAAGATGG - Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165282615 19:34810038-34810060 CGGGGGTGGTGGAGGGGAGAAGG - Intergenic
1165319232 19:35075566-35075588 CTGTGGACATGGTGTGGACAGGG + Intergenic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166679429 19:44758004-44758026 CGGGGGAGCTGGAGGGGGGAAGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166840695 19:45695378-45695400 CTGGGGAGGAGGTGGGGAGAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
925618714 2:5769164-5769186 CAGTGAAGAGGGAGGAGAGAGGG + Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926311163 2:11677280-11677302 CTGAGGAGCTGGAGTGGGGAGGG + Intergenic
926463120 2:13158287-13158309 CTGTGGCGATTGAGGGGAAACGG + Intergenic
928656296 2:33455041-33455063 ATGTGGTGATGGAGGAGAGTGGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
929671391 2:43878628-43878650 CTTTGGAGTTAGAGGGCAGAAGG + Intergenic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930730325 2:54723215-54723237 CGGTGGAGTTGGAATGGAGACGG - Intergenic
930836357 2:55797962-55797984 CTTTGGGGATGTAGGGGAAAGGG + Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931287605 2:60845830-60845852 CTGTGCCAATGGAGTGGAGAGGG - Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932594211 2:73084081-73084103 CTGGGGAGCTGGCCGGGAGAGGG - Intronic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933665463 2:84961046-84961068 GGTGGGAGATGGAGGGGAGAAGG - Intergenic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934854227 2:97718918-97718940 TGGAGAAGATGGAGGGGAGAGGG + Intronic
935281969 2:101526131-101526153 AAGTGGAGATGAAGGGGAAAAGG + Intergenic
935312832 2:101802450-101802472 CTGTGTAGAAGGAGGAGAGGAGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936388085 2:112048175-112048197 CTTGGGAGGTGGAGGGGACAGGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936981478 2:118269181-118269203 CGGGAGAGATGGAGGGGAGGAGG + Intergenic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
938292469 2:130157399-130157421 GGGTGGAGAAGGAGGGGTGAGGG + Intronic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938464085 2:131515577-131515599 GGGTGGAGAAGGAGGGGTGAGGG - Intergenic
939549736 2:143599524-143599546 CTGTGTAGATGGCGGGGGTAGGG - Intronic
940472601 2:154117426-154117448 CTTTGGAGATGCAGGGTAAAGGG - Intronic
940818529 2:158325007-158325029 CTCTGAAGATGCAGGCGAGAGGG - Intronic
940848661 2:158667477-158667499 CAGGGGAGAAGGAGGGGAAATGG + Intronic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
943733280 2:191325958-191325980 ATCTGGAAATGAAGGGGAGATGG + Intronic
945213619 2:207410221-207410243 CAGTGAAGATGAATGGGAGATGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946353439 2:219170072-219170094 GTGGGGAGAAGGTGGGGAGAGGG + Intronic
946519973 2:220453821-220453843 CTGTGCTGATGTAGGGGAAAGGG + Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947190964 2:227504141-227504163 CTGGAGAGGTGGAGGGGAGGCGG + Intronic
947322820 2:228941133-228941155 AGTGGGAGATGGAGGGGAGAGGG - Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
949057205 2:241934618-241934640 CTGTGAAGTTGGCGGGGGGATGG + Intergenic
1168922527 20:1552406-1552428 CAGTGGAGATGTAGGGTTGAAGG - Intronic
1169192971 20:3669503-3669525 AGGTGGAGAGGGAAGGGAGAAGG - Intronic
1169230921 20:3888689-3888711 CTGTGGCGAAGGAGGGGAAGTGG - Intergenic
1169268041 20:4179367-4179389 TTGTGGATATGGAGTGGATATGG + Intronic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1169811178 20:9610889-9610911 CAGAAGAGATGGAGGGGAAATGG - Intronic
1170123438 20:12935990-12936012 CTGGGCAGATGGTGGTGAGATGG - Intergenic
1170124745 20:12950391-12950413 CTGGACAGATGGAGGTGAGATGG - Intergenic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170842971 20:19939009-19939031 ATTTGGAGATGGATGGGAGGAGG - Intronic
1170906920 20:20524462-20524484 CTGTGGACACGGGGTGGAGAAGG + Exonic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1171293697 20:23998072-23998094 AAGTGGAGAGGGAAGGGAGAAGG - Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171960037 20:31486664-31486686 ATGGAGAGATGGAGGGGAGCGGG - Intergenic
1172285010 20:33734139-33734161 CTGTGGAGATCTAGGGGAGGAGG + Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172629015 20:36365965-36365987 CTGTAAAATTGGAGGGGAGAGGG + Intronic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1173183303 20:40820708-40820730 CTGTCGGGGTGGAGGGGACAGGG - Intergenic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173648502 20:44648509-44648531 AGGTGGAGATGGTTGGGAGAAGG + Intronic
1173966861 20:47119117-47119139 GTGAGTAGTTGGAGGGGAGACGG - Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174147911 20:48464951-48464973 GTGAGGAGGTGGAGGGGAGGGGG - Intergenic
1174198423 20:48789873-48789895 GTGGGGAGATGGATGGGTGATGG + Intronic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174896065 20:54451504-54451526 GCGTGGAGAAGGAAGGGAGAAGG - Intergenic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1175216355 20:57393367-57393389 CCGTGGAGATGAAGTGGAGAGGG + Intronic
1175934806 20:62509746-62509768 GGGTGGAGATGGAGGGGTGGAGG - Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176383960 21:6127769-6127791 AGGGGGAGAGGGAGGGGAGAGGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176669783 21:9722473-9722495 CAGGGGAGAGGGATGGGAGAAGG - Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1178127505 21:29530896-29530918 CTGGAGAGATGGAGGTGGGAAGG + Intronic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179029677 21:37709849-37709871 CTGTGGTGAAGGATGGGTGATGG + Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179502659 21:41819886-41819908 CTGAGGACCTGGAGGGGTGAGGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179714324 21:43279931-43279953 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714381 21:43280084-43280106 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714404 21:43280129-43280151 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714452 21:43280232-43280254 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714501 21:43280349-43280371 AGGTGGAGGTAGAGGGGAGATGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179739514 21:43410469-43410491 AGGGGGAGAGGGAGGGGAGAGGG - Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1180667775 22:17528368-17528390 CCGTGGAGATAGAGGGGAAAAGG + Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181130163 22:20726542-20726564 CTGTGGAGGTGGAGCAGAGTTGG + Intronic
1181150347 22:20878750-20878772 CTGTTGAGATAGAGGAGAGCAGG + Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1181781193 22:25194748-25194770 CTGTGGTGCTGGAGGAGACAAGG - Exonic
1181910737 22:26236205-26236227 CTTTGGAGTTTGAGGGCAGATGG + Intronic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182453539 22:30435268-30435290 GGGAGGAGAGGGAGGGGAGAAGG - Intergenic
1182466209 22:30518190-30518212 CTGTAGAGTTGGTGGGGGGAGGG + Intergenic
1182501779 22:30753306-30753328 ATATGGAGATGGAGGTGAGGAGG + Intronic
1182515465 22:30856208-30856230 ATGGAGAGATGGAGGGGTGAAGG - Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182944862 22:34312349-34312371 GCCTGGAGATGAAGGGGAGAAGG - Intergenic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183095642 22:35550539-35550561 CTGTGGAGACGGTGGGGTGGTGG - Intronic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183473222 22:38020795-38020817 GGGTGGAGGTGGAGGGGAAAAGG - Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1183799196 22:40147358-40147380 TTGTGGAGATGGATGGTTGATGG + Intronic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184464475 22:44660703-44660725 CTGGGGAGATGGCTGGGAGCAGG + Intergenic
1184766768 22:46576467-46576489 CTGGGGAGATGCAGGGGTGTGGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949152069 3:781362-781384 CAGGGGAGAAGGATGGGAGAAGG - Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950256446 3:11510523-11510545 CTTTGGAGATGGGGGGTTGAGGG - Intronic
950326443 3:12114778-12114800 CTGTGGAGAAGGTGGGGAAGAGG - Intronic
950465796 3:13153079-13153101 GAGGGGAGAAGGAGGGGAGAGGG - Intergenic
950465803 3:13153097-13153119 GAGAGGAGAGGGAGGGGAGAGGG - Intergenic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
953040706 3:39252774-39252796 CAATGGCGATGGAGGGGTGAAGG + Intergenic
953486499 3:43302574-43302596 CTGGGGATATTGAGGAGAGAAGG + Intronic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954387403 3:50251514-50251536 CTGAGCAGATGGAGGCTAGAAGG - Intronic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
954907466 3:54075069-54075091 GTCTGGAGATGGAGGCTAGATGG - Intergenic
955182401 3:56683888-56683910 CTGGGGAGTTTGAGGGGAGGAGG + Intergenic
955333734 3:58068409-58068431 CTGTGTGGATGGAAGGGATATGG + Intronic
955589048 3:60514487-60514509 CTGTCGAGGAGGTGGGGAGAAGG + Intronic
956046252 3:65199255-65199277 CCAGGGAGATGGAGGGGCGATGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
960124806 3:113986810-113986832 GTTTGGAGACAGAGGGGAGAGGG - Intronic
960431902 3:117579727-117579749 GAGTGGAGAGGGAGGTGAGAGGG + Intergenic
960519487 3:118638588-118638610 CTGTGGAGCTGGAAGGGATGAGG + Intergenic
960650379 3:119941788-119941810 CTGTGCAGATGGCGGGGAGGAGG + Intronic
961027185 3:123568573-123568595 CCATTGAGATGGAGTGGAGATGG - Intronic
961113460 3:124305680-124305702 CTGTGGAGCTGTGGGGGAGTGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961545548 3:127630171-127630193 CTATGGAAATGGCGGGGAGAAGG + Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961597365 3:128029109-128029131 CTGTGGAGAGGGTGGAGAGGAGG - Intergenic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
963015958 3:140824013-140824035 CTGAGTAGATGGAGGAGAAAGGG - Intergenic
963286585 3:143439695-143439717 CTCTGGAGAATGAGGGGAGTTGG - Intronic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963612789 3:147493108-147493130 GTGTGGAGATGTTGGAGAGATGG + Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
963828075 3:149977058-149977080 TTGTGGAGCAGGAGGGGAAAGGG + Intronic
963837546 3:150072216-150072238 CTGTGGAGGTGTCTGGGAGATGG - Intergenic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964887691 3:161503237-161503259 CTGTGGAGATTCTGGGGAGAGGG + Exonic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
967452964 3:189647765-189647787 CTATAGCGATGGATGGGAGAAGG - Intronic
967784837 3:193481108-193481130 CTTTGGAGATTCAGGGGAAAGGG + Intronic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968594250 4:1474166-1474188 CCCTGGTGATGGAGGGGTGAGGG + Intergenic
968631217 4:1653180-1653202 TTGGGGAGATGGGTGGGAGAAGG - Intronic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968815481 4:2819561-2819583 CAGTGGAGTTGGATGGGAGCAGG - Intronic
969094344 4:4720532-4720554 CTGTGCTGATAGAAGGGAGAGGG - Intergenic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969244479 4:5923583-5923605 GGGTAGGGATGGAGGGGAGAAGG + Intronic
969269599 4:6090254-6090276 CTGCAGACATGCAGGGGAGAAGG + Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969424852 4:7118201-7118223 ATGGAGAGATGGATGGGAGATGG + Intergenic
969686721 4:8679601-8679623 CTGTGGTGAGTGAGGGGTGAGGG - Intergenic
970143019 4:13003215-13003237 CTTTGGAGATGGAGGAATGAAGG - Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
970554828 4:17220692-17220714 ATGTGAAGATGGAAGGGGGATGG + Intergenic
971264808 4:25088244-25088266 CTGGAGAGATGGAGGGGACAGGG - Intergenic
971555399 4:28007611-28007633 CTTTGGAGAAGACGGGGAGACGG + Intergenic
971831741 4:31704193-31704215 CTGTGAAGATAGAGGGGCCAGGG - Intergenic
972410070 4:38784673-38784695 GTTTGGAGATGGAGGAGAGATGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973146972 4:46839382-46839404 CTGTGGAGAAGGAGGGGCTGGGG - Intronic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973903159 4:55498703-55498725 CTGTGGAGTGGCAGGGGAGATGG + Intronic
975520026 4:75290527-75290549 CTATGGAGATGTAAGGCAGAGGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975880001 4:78893805-78893827 CTCTGGAGGTTGAGGTGAGAGGG - Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
977765122 4:100788520-100788542 ATCTGGAGATGGGGAGGAGATGG - Intronic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
978721179 4:111911457-111911479 CTGCGGAGAGAGAAGGGAGATGG + Intergenic
978859534 4:113431600-113431622 CACTGGAGTGGGAGGGGAGACGG + Intergenic
979562775 4:122119161-122119183 CTGTGGAGTAAGAGTGGAGAAGG + Intergenic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981672291 4:147300718-147300740 CTTTTGAGATGGGGGAGAGATGG + Intergenic
982341038 4:154299216-154299238 CTGTGGACATGTAGAAGAGAAGG - Intronic
982979569 4:162115592-162115614 CTGTGAAGATGGAGGTTACAAGG - Intronic
983544384 4:168947533-168947555 TTGGGGAGAAGGATGGGAGAGGG - Intronic
983595130 4:169457700-169457722 GAGGGGAGAAGGAGGGGAGAGGG + Intronic
984037710 4:174691373-174691395 GTGGGGAGAGAGAGGGGAGAGGG - Intronic
984326588 4:178262077-178262099 CTGTGGAGGTTATGGGGAGAAGG + Intergenic
984691898 4:182735500-182735522 ATGTGGAGGTGGTGGGGAAAGGG + Intronic
984846183 4:184109987-184110009 TGGGGGAGATGGAAGGGAGAAGG + Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985091323 4:186365110-186365132 ACGTGGTGATGGAGGAGAGAGGG - Intergenic
985730341 5:1543945-1543967 CTGAGGCGAGGGTGGGGAGATGG - Intergenic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
985986874 5:3523314-3523336 CTATGGAGATGGCAGGAAGATGG - Intergenic
986233989 5:5890750-5890772 ATTGGGAGAGGGAGGGGAGAAGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
987032299 5:13987155-13987177 GTGTGGAGAAGCAGGGGAGGAGG - Intergenic
987087649 5:14485311-14485333 CTATGGATATGAATGGGAGAGGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987259595 5:16189916-16189938 CTGGGGAGAAGGTTGGGAGAAGG + Intergenic
987288671 5:16487327-16487349 CTGGCGAGAGGGAGGGGAGATGG - Intronic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989122749 5:38020656-38020678 ATGTGGGGATGGATGGGAGTAGG - Intergenic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
990356303 5:54969641-54969663 CTGTGGAGAAGCTGTGGAGATGG - Intergenic
990556745 5:56944037-56944059 GTGAGGAAATGGAGGTGAGAGGG - Intronic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
992395779 5:76368412-76368434 ATGTAGAGTTGGAGGAGAGAAGG + Intergenic
992753861 5:79886083-79886105 CTGTGGAGATGGGAGGGTGGCGG + Intergenic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
993667769 5:90722260-90722282 TTGTGCAGTTGGATGGGAGAAGG + Intronic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
993882294 5:93377449-93377471 GGGGAGAGATGGAGGGGAGAAGG + Intergenic
994497043 5:100526035-100526057 CTTTGGAGATGTAGGGGAAAGGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994615620 5:102100580-102100602 GTGGGAACATGGAGGGGAGAAGG - Intergenic
995809844 5:116093360-116093382 CTGAGGAGAGGGAGGAGAGGTGG + Intronic
996078290 5:119224080-119224102 TTGTGGAGAAGGTGGGGAGTTGG - Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996942965 5:129031900-129031922 CAGGGGAGATGGAGGAGGGAAGG + Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998136262 5:139676201-139676223 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998136273 5:139676237-139676259 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
999620001 5:153463251-153463273 TTCTGGAAATGGAGGGGAAATGG + Intergenic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000725995 5:164771619-164771641 GGGTGAAGATGGAGGGGAGCAGG - Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002300664 5:178255772-178255794 CTGTGCAGGTGGTGGGGAGCGGG - Intronic
1002364106 5:178696790-178696812 CTGGGGAGAGGGTGGAGAGAGGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002606435 5:180385499-180385521 TTGGGGAGAGGGAGTGGAGAGGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003245393 6:4378272-4378294 CAGGGAAGATGGAGGGGACAGGG + Intergenic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005001311 6:21244521-21244543 TTAGGGAGATGGAGGGGAGAGGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005375733 6:25180469-25180491 CTCTAGAGCTGGAGGTGAGAAGG - Intergenic
1005843944 6:29763058-29763080 CTCTGGAGGGGGTGGGGAGAGGG + Intergenic
1005980280 6:30831241-30831263 CTGGGGAGTGGGAGGGGAGGAGG - Intergenic
1006067808 6:31474969-31474991 GAGAGGAGATGGAAGGGAGATGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007207594 6:40165173-40165195 CTGAGGAGGTGGTGGGGTGACGG - Intergenic
1007236941 6:40397303-40397325 ATGTGGAGTTGGAAGGCAGAGGG - Intronic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1007409865 6:41655252-41655274 GCGTGGAGATGGAGTGGGGAGGG - Intergenic
1007494686 6:42251766-42251788 TTGTGGAGATGGAGGAGACCTGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007795440 6:44343137-44343159 TGCTTGAGATGGAGGGGAGACGG - Exonic
1009943006 6:70311001-70311023 ATGTGCATATGGAAGGGAGAAGG - Intergenic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010761116 6:79724471-79724493 ATCTGGAGATGGAGCAGAGAAGG - Intergenic
1010770829 6:79828008-79828030 CTGTGCAGGTGTAGGGGAGCGGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1012945748 6:105463845-105463867 GTGGGGGGATGGGGGGGAGAGGG - Intergenic
1013010595 6:106116520-106116542 CTGTGGAGTTAGAAGTGAGATGG - Intergenic
1013304889 6:108838682-108838704 CTGGGGAGGCGGAGGCGAGAGGG + Intergenic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016696635 6:147003849-147003871 ATGTGGAGATGGTGGAGATATGG - Intergenic
1016863722 6:148746892-148746914 GAGCGGAGAGGGAGGGGAGAGGG + Intergenic
1017388203 6:153909926-153909948 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018690227 6:166338668-166338690 CTGGGGAGAGGGTGGGGAGGCGG + Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018948455 6:168363369-168363391 AGGGGGAGATGGAGGGGAGGGGG + Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019271201 7:150078-150100 TGGTGGCGGTGGAGGGGAGATGG + Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1019887478 7:3918115-3918137 CTGTTGAGTTTGAGGTGAGAGGG - Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020283538 7:6663771-6663793 ATGTGGAGGTGGGGGGGTGAAGG + Intergenic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021300020 7:18961135-18961157 CTATTGAGATCCAGGGGAGAAGG + Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022236882 7:28470252-28470274 CCATGGAGATAGAGGGTAGAAGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022509352 7:30925359-30925381 GAGTTGTGATGGAGGGGAGAGGG + Exonic
1022585330 7:31603396-31603418 CTGTGGAGTGGGTGGGGAGGGGG - Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023486982 7:40698115-40698137 TCCTGGAGATGGAGGAGAGATGG + Intronic
1024742713 7:52372359-52372381 ATGCTGAGGTGGAGGGGAGATGG + Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026407641 7:70084018-70084040 GGGTGGAGATGGAAGGGAGGTGG - Intronic
1026603585 7:71797108-71797130 ATGTGGAGATTGAAGGCAGAGGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026910601 7:74089681-74089703 GTGTTGAGCTGGAGGGGACATGG + Intronic
1027231221 7:76273846-76273868 AGGTGAAGAAGGAGGGGAGATGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029538106 7:101167478-101167500 CTGGGAAGATGAAGGGGACATGG - Intergenic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030093316 7:105876629-105876651 CGGCGGAGGAGGAGGGGAGAGGG + Intergenic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030871789 7:114764790-114764812 CTCTGGAGGTGGAGGTGGGAGGG + Intergenic
1031414497 7:121479387-121479409 GGGTGGAGAGAGAGGGGAGAGGG + Intergenic
1031761281 7:125716159-125716181 CTGTGCTGTTGGAGGGGACACGG - Intergenic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032545615 7:132739259-132739281 CTGGAGAGGTGGTGGGGAGAGGG - Intergenic
1032549133 7:132768025-132768047 CTTTGGAGACCGAGGGGAGAGGG - Intergenic
1032896502 7:136256869-136256891 CTCTGTAGATGGAGGTGAGAAGG + Intergenic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033806143 7:144956105-144956127 CTGCATAGATGGAGGGGACAGGG - Intergenic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1034999934 7:155604399-155604421 CTCTGAGGATGGAGGTGAGAGGG + Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035622485 8:1044381-1044403 CTGGGCAGGTGGAGGAGAGATGG - Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1036575851 8:10027172-10027194 GTGAGGAAATGGCGGGGAGAAGG - Intergenic
1036588876 8:10149483-10149505 CTGTGCTGATTGAAGGGAGAAGG + Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037575925 8:20202821-20202843 CTGGGGTGAGGGAGGGGATATGG - Intronic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037886569 8:22599169-22599191 CAGAGGAGAGGGAGGGGAGAGGG - Intronic
1037886586 8:22599213-22599235 GAGGGGAGAGGGAGGGGAGAGGG - Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1038328548 8:26590312-26590334 ATGTGGAGACTGAGGGGACAAGG - Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038510579 8:28130666-28130688 TTGTGCAGATGGAGGGGAAGGGG + Intronic
1039089439 8:33812716-33812738 CAGTGAAGATGGGGGTGAGAGGG + Intergenic
1039532537 8:38276368-38276390 ATGTGGAGATGGTGGAGAGCTGG - Exonic
1039539823 8:38356042-38356064 CTGGGGAGTGGGAGTGGAGAAGG - Intronic
1039994843 8:42522892-42522914 CTGTAGAGATGGCGGGGTGGGGG + Intronic
1040440092 8:47432380-47432402 CAGTTGAGATGAAGGGGAGATGG + Intronic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1041110440 8:54477966-54477988 CCTTAGAGAGGGAGGGGAGAAGG - Intergenic
1041313656 8:56540415-56540437 CGATGGACATGCAGGGGAGAGGG + Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1043989726 8:86738234-86738256 CTGGGGAGAAGTAGGAGAGAAGG + Intronic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045773017 8:105767119-105767141 CAGTGGAGATGGAGGGGTTAGGG + Intronic
1046514809 8:115244732-115244754 GTGTTGAGATGGTGGGGAGGTGG - Intergenic
1047327185 8:123851131-123851153 CGGGGGAGCAGGAGGGGAGAGGG + Intergenic
1048361624 8:133701989-133702011 CTGAGGTGATGGTGGGGAGGGGG + Intergenic
1048569579 8:135640442-135640464 CTCTGTAGATGTAGGGTAGAAGG + Intronic
1049272905 8:141705528-141705550 ATGTGGAGATGATGGGGAGATGG + Intergenic
1049272968 8:141705843-141705865 ATGAGGAGATGATGGGGAGATGG + Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049500271 8:142959472-142959494 GTGTGGAGGTGGAGGCGCGAGGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1051349306 9:16184122-16184144 GTGTGGAGGTGGAGGTGAGGAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051798270 9:20900879-20900901 CAGTGGAGAGGTAGGAGAGAAGG + Intronic
1051855779 9:21563278-21563300 CTGTGAAGAGCGAGGTGAGAAGG + Intergenic
1051907985 9:22118334-22118356 CTGTTGAGAGGGAGTGGAGTGGG - Intergenic
1052457454 9:28718524-28718546 ATGTTGTGATGAAGGGGAGAAGG - Intergenic
1052750471 9:32484622-32484644 CAGTAGAGATGGATTGGAGAAGG - Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053293946 9:36899948-36899970 CTGTGGAAATGGATGGGCTATGG + Intronic
1053311837 9:37025413-37025435 CTGTTGGGATGGGGGGGAGCGGG + Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1055080643 9:72265081-72265103 CAGGGGAGATGGGTGGGAGAAGG + Intergenic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055520732 9:77078378-77078400 CTATGGAGCTTGAGGGGAAAGGG - Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1056810263 9:89758346-89758368 CTGTGGAAACGCAGGGGACACGG - Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057407725 9:94788820-94788842 CTGTGGTGCTGGAGGAGAAATGG - Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058219830 9:102284792-102284814 CTTTGGGGATTGAGGGGAAAAGG + Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059104661 9:111501252-111501274 CTGTGGAGCTGGCTGGGAGCAGG + Intergenic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059166925 9:112086134-112086156 TTGTAGAGATGGTGGTGAGAGGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059394421 9:114025209-114025231 AGGTGGAGATGAATGGGAGATGG - Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060204240 9:121673240-121673262 CAGAGAAGATGGAGGGGACATGG - Intronic
1060294192 9:122332232-122332254 AGCTGGAGATGTAGGGGAGAGGG + Intergenic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060405237 9:123369760-123369782 TGGTGGAGATGGATGGGAAAGGG + Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060683693 9:125588589-125588611 CAGTGGAGATAGAAGTGAGATGG - Intronic
1060804366 9:126565185-126565207 CTGTGGAGATGGTGGGGTTGGGG - Intergenic
1060919338 9:127409186-127409208 CGGGGGAGATGATGGGGAGATGG + Intergenic
1061623637 9:131827583-131827605 TTCTGGAGATGGATGGGTGATGG + Intergenic
1061942541 9:133891387-133891409 GAAGGGAGATGGAGGGGAGATGG + Intronic
1061942547 9:133891398-133891420 GAGGGGAGATGGAGGGGGGATGG + Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062016907 9:134295672-134295694 TGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016915 9:134295699-134295721 CGGTGGAGATAGAGGGGACCTGG - Intergenic
1062016924 9:134295726-134295748 CGGTGGAGATAGAGGGGACCTGG - Intergenic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062147383 9:134997182-134997204 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062147392 9:134997219-134997241 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062200545 9:135300570-135300592 ATGTGGAGGGGGAGGGGACAAGG + Intergenic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1062441283 9:136570871-136570893 CTGTGGAGAGGCTGGGGAGTGGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1186364573 X:8877853-8877875 CTTTGGAGACCCAGGGGAGAAGG - Intergenic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186833290 X:13412415-13412437 CGGGGGAGTTGGAGGGGGGAAGG + Intergenic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187132222 X:16514086-16514108 ATGTGGAGAAGGAAGGAAGAAGG + Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1189838245 X:45042250-45042272 CCGTGGAGGGAGAGGGGAGAGGG + Intronic
1189880876 X:45491080-45491102 CAGTGGAGCTGGTGGGGGGAAGG - Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191150481 X:57216271-57216293 TTGTGGAGAAGCATGGGAGAGGG - Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1191704199 X:64076484-64076506 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192173966 X:68874484-68874506 CTGGGGACATCAAGGGGAGAAGG + Intergenic
1192184653 X:68938865-68938887 CTGAGAAGAGGGAGGGGAAAGGG - Intergenic
1192869104 X:75168936-75168958 CTTTGGAGATTCAGGGGAAAAGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195238379 X:102925400-102925422 CCATGGAGATAGAGGGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1195678449 X:107525264-107525286 AGGTGGAGATGGAGGAGAGAGGG - Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197637902 X:128936447-128936469 CTATGCAGAGTGAGGGGAGAAGG + Intergenic
1198383474 X:136105530-136105552 CCAGGCAGATGGAGGGGAGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199492233 X:148413066-148413088 CTGAGGGGATTGAGGGGAAATGG + Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1199940122 X:152617915-152617937 CTGTCGAGAGGGCGGGGAAAGGG + Intergenic
1200036571 X:153334939-153334961 CTGTGGAGAGGCAGGGGAAAGGG + Intronic
1200071422 X:153531257-153531279 CTGGGGAGCAGGTGGGGAGAGGG - Intronic
1200077248 X:153557259-153557281 CTGTGGAGAGGAAGGGGAATGGG + Intronic
1200945070 Y:8826804-8826826 CTGGGATGATAGAGGGGAGAGGG + Intergenic
1201594268 Y:15650453-15650475 CTTTTGAGATGAAGTGGAGAAGG - Intergenic