ID: 1006824328

View in Genome Browser
Species Human (GRCh38)
Location 6:36923321-36923343
Sequence GAGGGGAAATAGCAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 1, 1: 0, 2: 2, 3: 79, 4: 936}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006824328_1006824339 26 Left 1006824328 6:36923321-36923343 CCTTCCTCTTGCTATTTCCCCTC 0: 1
1: 0
2: 2
3: 79
4: 936
Right 1006824339 6:36923370-36923392 AAGGTCTACGTTATAGCCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
1006824328_1006824341 28 Left 1006824328 6:36923321-36923343 CCTTCCTCTTGCTATTTCCCCTC 0: 1
1: 0
2: 2
3: 79
4: 936
Right 1006824341 6:36923372-36923394 GGTCTACGTTATAGCCAGAGGGG 0: 1
1: 0
2: 2
3: 2
4: 41
1006824328_1006824340 27 Left 1006824328 6:36923321-36923343 CCTTCCTCTTGCTATTTCCCCTC 0: 1
1: 0
2: 2
3: 79
4: 936
Right 1006824340 6:36923371-36923393 AGGTCTACGTTATAGCCAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1006824328_1006824335 7 Left 1006824328 6:36923321-36923343 CCTTCCTCTTGCTATTTCCCCTC 0: 1
1: 0
2: 2
3: 79
4: 936
Right 1006824335 6:36923351-36923373 TGTCGACACCACCCACTGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 87
1006824328_1006824334 3 Left 1006824328 6:36923321-36923343 CCTTCCTCTTGCTATTTCCCCTC 0: 1
1: 0
2: 2
3: 79
4: 936
Right 1006824334 6:36923347-36923369 GCTATGTCGACACCACCCACTGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006824328 Original CRISPR GAGGGGAAATAGCAAGAGGA AGG (reversed) Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900406728 1:2496075-2496097 GAGGGGAGACGGCAATAGGAGGG - Intronic
900696222 1:4012203-4012225 GAGGAGGAAAAGGAAGAGGAGGG - Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900878297 1:5361897-5361919 GAGGGGAAAGGGGAAGAGAAAGG - Intergenic
901409785 1:9074393-9074415 GAGGGGAAAGAGGGAGAGTATGG + Intronic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901554509 1:10020949-10020971 GGGGGGAAAAAGGGAGAGGAAGG + Intergenic
901724483 1:11230068-11230090 GAGGGGGAATAGGGAGAGGTTGG - Intronic
902051701 1:13568204-13568226 GAGGGGAAAGAGGCAGAGGGGGG + Intergenic
902785436 1:18730067-18730089 GAGGTGAAAAAGGAAGGGGAGGG + Intronic
902837808 1:19058165-19058187 GAGGGGGAAGAGAAAGAGGCTGG + Intergenic
903009913 1:20322407-20322429 GAGGGGGAGAAGCAAGGGGAAGG + Intronic
903177384 1:21589151-21589173 GGGAGGAAATAGAAAGATGAGGG + Intergenic
903982215 1:27197368-27197390 GAGAGGAAACGGCAGGAGGAAGG - Intergenic
904071996 1:27807374-27807396 GAGTGTAAATATCAACAGGACGG - Intronic
904338825 1:29819165-29819187 GAGGGGAAAGAGAAAGGGGGTGG - Intergenic
905256467 1:36688553-36688575 GAAGGGAAATGGGAAGGGGAAGG + Intergenic
905256488 1:36688607-36688629 GAAGGGAAATGGGAAGGGGAAGG + Intergenic
905256509 1:36688661-36688683 GAAGGGAAATGGGAAGGGGAAGG + Intergenic
905319057 1:37102875-37102897 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
905866129 1:41377709-41377731 GAGGTGAAAGAGGCAGAGGAGGG - Intronic
905943895 1:41885728-41885750 GAAGGGAAAGGGGAAGAGGAGGG - Intronic
905975709 1:42172230-42172252 TAGGGGAATTTGCAGGAGGAGGG - Intergenic
906274700 1:44507226-44507248 GAGGAGGAATGGCAAGAGAAAGG - Intronic
906276025 1:44516642-44516664 GAAGGGAAAGAGGAAGAGAAGGG + Intronic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
907660968 1:56392082-56392104 GAAGTGAAAGAGCCAGAGGAAGG - Intergenic
907692150 1:56679830-56679852 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
908528257 1:65008647-65008669 GAAGGGAAAGGGGAAGAGGAAGG - Intergenic
909304682 1:74058576-74058598 GAAGGGAAATAGTCAGAGGTTGG + Intronic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
909987173 1:82175227-82175249 ATGGGAAAATAGCAAGAAGATGG + Intergenic
910111633 1:83689774-83689796 GTGAGGACATAGCAAGAAGATGG + Intergenic
910328505 1:86040186-86040208 GAGGGCAAATGGCAAGAATAAGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
911145368 1:94547249-94547271 GTGAGGACATAGCAAGAAGACGG + Intergenic
911159380 1:94669215-94669237 GAGGGGAAAGAGGAAGGGTATGG + Intergenic
911374670 1:97037401-97037423 AAGGGGAAAGAGCAAGCGGGAGG - Intergenic
911809708 1:102260424-102260446 GAGAGGAAGTACGAAGAGGAGGG + Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912069479 1:105791204-105791226 GAGGGGAAATGGCCTTAGGATGG - Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913242631 1:116842840-116842862 GGAGGGAAATTGCAGGAGGAAGG + Intergenic
913296378 1:117324682-117324704 GAAGAGAAGGAGCAAGAGGAGGG - Intergenic
914339341 1:146745707-146745729 AAGGGGAAAAAGCAAATGGATGG - Intergenic
914942578 1:152036296-152036318 GTGGGGTAAAAGGAAGAGGAAGG + Intronic
915109254 1:153552705-153552727 GAGGGCAGGTGGCAAGAGGAAGG - Intergenic
915318450 1:155042913-155042935 GAGGGAATAGAGCTAGAGGAAGG + Intronic
916043431 1:160980870-160980892 CATGAGGAATAGCAAGAGGATGG - Intergenic
916126882 1:161579625-161579647 GAGGGGAAAGAGGAAGAGTATGG - Intergenic
916136801 1:161661429-161661451 GAGGGGAAAGAGGAAGAGTATGG - Intronic
916620201 1:166488792-166488814 GTGGGGAAGTTGGAAGAGGATGG - Intergenic
916875463 1:168963991-168964013 GAGGAGAAACAGGAAAAGGAAGG - Intergenic
916885338 1:169061878-169061900 GAGGAGGAAAAGGAAGAGGAGGG + Intergenic
916946839 1:169737809-169737831 GAGGGGAAAGAGCAAGCAGGAGG - Intronic
917638049 1:176956180-176956202 GAGGGGAAAGAAGAACAGGAAGG - Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918199368 1:182252911-182252933 GAGGGGAAATAAAGAGAAGATGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918457942 1:184744409-184744431 GACTGGAAATACCAAGTGGAAGG + Intronic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918668873 1:187187580-187187602 GAGGGGGGAAAGCAGGAGGAGGG + Intergenic
919133279 1:193477288-193477310 GAGGGGAAGTAGAAAGATGATGG + Intergenic
919230940 1:194773358-194773380 AAGGGTAAATAGCATCAGGAGGG + Intergenic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
920173041 1:204083453-204083475 GATGGGAGATAGAGAGAGGAAGG - Intronic
920187780 1:204172366-204172388 GAGGGGGAAGAGGAAGAGGTTGG - Intergenic
920245658 1:204585708-204585730 GAAGGGAAAGAGGTAGAGGAGGG - Intergenic
920569215 1:207003551-207003573 GAGGGGAAAGAGCTTAAGGAAGG - Intergenic
921218505 1:212956549-212956571 GCAGGAAAATAGCATGAGGAGGG + Intronic
921617290 1:217284571-217284593 GAGGGGGGATAGGGAGAGGATGG - Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922001372 1:221481869-221481891 GAGGAGGAAGAGGAAGAGGAAGG - Intergenic
922080064 1:222287308-222287330 GTGGGGAAATAGCAGGAGCTCGG - Intergenic
922331806 1:224583535-224583557 TAGGGAAGATAACAAGAGGATGG + Intronic
922514905 1:226200068-226200090 AAGAGGAAATAAAAAGAGGAAGG - Intergenic
922574886 1:226654937-226654959 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
922990889 1:229910175-229910197 GTGTGGAAACAGCAAGAAGAAGG + Intergenic
923334777 1:232958637-232958659 GAGGGTAAGTTCCAAGAGGAAGG - Intronic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923689503 1:236178492-236178514 GACGGGAAATTGGGAGAGGAAGG + Exonic
923769687 1:236927603-236927625 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
923801042 1:237208852-237208874 GAGGGGAAATACAAAGATGTTGG - Intronic
923981170 1:239325884-239325906 GAGGGTAAATGGTAAGAGAAAGG + Intergenic
924057137 1:240134882-240134904 GAAGGGAAATGGAAAGAGTAGGG + Intronic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924675942 1:246178127-246178149 AAGGTGAAATGGCAGGAGGAGGG + Intronic
924886068 1:248218173-248218195 CTGGGGAAATAGCAACAGGGTGG + Intergenic
1062951124 10:1504362-1504384 GAGGGGAAAAAGTAAGGGGTGGG - Intronic
1063430983 10:5988064-5988086 TAGGGGAATTACAAAGAGGAGGG - Intergenic
1063802229 10:9593380-9593402 GAGAAGAAATAGCGAGAAGAGGG + Intergenic
1063850838 10:10188154-10188176 GAGAGGAAATTGCAGGGGGAAGG + Intergenic
1063880378 10:10525481-10525503 GAGGGGAATTAGAAAGATGTTGG - Intergenic
1063905859 10:10779481-10779503 GAAGGGAAAAAAAAAGAGGAAGG - Intergenic
1065072673 10:22042583-22042605 GAGAGAAAAAAGCAAGGGGAAGG + Intergenic
1065098703 10:22311116-22311138 GGGGGGAAAGAGGAAGAGGAAGG - Intergenic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065858654 10:29851573-29851595 GAGGGAGAAGAGTAAGAGGAGGG + Intergenic
1065996965 10:31068532-31068554 GAGGTGAACTAGTAATAGGAGGG + Intergenic
1066194874 10:33089558-33089580 GAGGGTAAAACTCAAGAGGAAGG - Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067120944 10:43471626-43471648 GAGGGGAACTGGAAAGGGGACGG + Intronic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068226605 10:54114777-54114799 TAGTGGAAATAGCAAGTGAACGG + Intronic
1068243118 10:54330991-54331013 GAGAGGAAAAGGCAAGGGGAAGG + Intronic
1068482773 10:57614948-57614970 GAGGGAAGATAGGAAGAGGTTGG + Intergenic
1068711597 10:60141064-60141086 GAGGGGAAAAAGAGAGAGGGAGG + Intronic
1069635986 10:69925200-69925222 GAGGGGAAAGAGGAAGGGTATGG + Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069874935 10:71556009-71556031 TAGGGGAAATATCCAAAGGAAGG + Intronic
1070191522 10:74115919-74115941 GAGGGGAAATAAGGAGAGTAAGG - Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070873332 10:79777903-79777925 GATAGGAAATTGAAAGAGGAGGG - Intergenic
1071024344 10:81094026-81094048 GAGGGGAGGTAGGAAGAGGTTGG - Intergenic
1071203360 10:83246060-83246082 GAGGGGAATTAACAAGATGATGG - Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071383999 10:85101426-85101448 GAGGAGGTAGAGCAAGAGGAAGG - Intergenic
1071640260 10:87300054-87300076 GATAGGAAATTGAAAGAGGAGGG - Intergenic
1071654971 10:87437892-87437914 GATAGGAAATTGAAAGAGGAGGG + Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072085799 10:92077891-92077913 GAGGGGAAAAAGGGAGAGTAGGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072411955 10:95210991-95211013 GAGGGAAAAGAGGAAGAGCAGGG + Intronic
1072423664 10:95310859-95310881 GAGGGGCAATAGCAGAAGCAGGG + Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1073079357 10:100848719-100848741 GAGGGGAGAGAAAAAGAGGATGG + Intergenic
1073118455 10:101106907-101106929 GATGTGAAATAGAAAAAGGAGGG - Intronic
1073249943 10:102115059-102115081 GAGAGGAAAGAGGAAGAGCAAGG + Intronic
1073597757 10:104817514-104817536 GAGGGGGAAGCGGAAGAGGAGGG - Intronic
1073911219 10:108347047-108347069 GAGGGGAGAGGGAAAGAGGAGGG + Intergenic
1073920044 10:108448382-108448404 GATGGAAAAGAGGAAGAGGAGGG + Intergenic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1074831844 10:117254904-117254926 GGCGGGAAATCGGAAGAGGAAGG - Intronic
1075066500 10:119292249-119292271 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1075244622 10:120810357-120810379 GAGGGAAACTGGCAGGAGGAGGG - Intergenic
1075922882 10:126227722-126227744 GAGGGGAAAGAGAAAGGTGATGG - Intronic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1077481253 11:2815689-2815711 GAGGGGCAATTGGAAGAGGCTGG + Intronic
1078283470 11:9926381-9926403 GTAGGGAAAAAGCAAAAGGATGG + Intronic
1078975064 11:16464479-16464501 GAGGGGAGAAAGGAAAAGGAAGG + Intronic
1079036502 11:17024709-17024731 GAGTGGAAATGACAATAGGATGG - Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080186890 11:29500380-29500402 TTGGGGAAATATCAAGAGAAAGG + Intergenic
1080832294 11:35906835-35906857 GAGGGGACTTAGCATGAGAATGG - Intergenic
1081762249 11:45584615-45584637 GAAGGGAAAGAGCCACAGGAGGG - Intergenic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082615584 11:55356155-55356177 GCAGGCCAATAGCAAGAGGAAGG - Intergenic
1082990726 11:59205295-59205317 GAGTGGAAGTAGCAAGAAGCCGG - Exonic
1083010663 11:59395269-59395291 GAGGAGGAAGAGTAAGAGGAGGG - Intergenic
1083061436 11:59876948-59876970 GAGTGGGGTTAGCAAGAGGAAGG - Intergenic
1083067469 11:59939707-59939729 GAAGAGAAAGAGAAAGAGGAAGG - Intergenic
1083605455 11:63975981-63976003 GAGGGGGAAGAGTGAGAGGAAGG - Intronic
1083636654 11:64124526-64124548 GAGGGGGAAGAGCAAAGGGAGGG - Intronic
1084695243 11:70749230-70749252 GAGGGAGAAGAGCCAGAGGAAGG + Intronic
1084742715 11:71149938-71149960 GAGGGGAAGGAGGGAGAGGAGGG + Intronic
1084857431 11:71998010-71998032 GGGGGGAAAAAGTAAAAGGAAGG - Intergenic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1085325967 11:75606808-75606830 AAGGGGACAGAGCTAGAGGAGGG - Intronic
1085440571 11:76558930-76558952 GAGCAGAAGTAGCCAGAGGATGG + Intergenic
1085478953 11:76806119-76806141 GAGGGGAAAAAGAGAGAGCAGGG - Intergenic
1086154243 11:83648236-83648258 GAGAGGAAGTACAAAGAGGATGG + Intronic
1086372833 11:86171884-86171906 GAGGGGGAATAGCCAAAGGTTGG + Intergenic
1086775519 11:90827330-90827352 GAGGAGGAATACAAAGAGGATGG - Intergenic
1087078918 11:94151223-94151245 GAAGGAAAATAGAGAGAGGAGGG - Intronic
1087526061 11:99314746-99314768 GAGGAGAAAGAAGAAGAGGATGG + Intronic
1087879182 11:103394524-103394546 GAGGCTCAATACCAAGAGGAGGG + Intronic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1088971003 11:114774728-114774750 GAAGGGAAAAAGCAAGAGATGGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089134503 11:116238402-116238424 TGTGGGACATAGCAAGAGGAAGG + Intergenic
1089224046 11:116900633-116900655 GAGAGGAAATAGCATGTGGAAGG - Intronic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089269916 11:117295036-117295058 AAGGGGAATTAGCAGAAGGAGGG - Intronic
1089546990 11:119235524-119235546 GAGGAGGAGTAGGAAGAGGAGGG + Intronic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1090212224 11:124929267-124929289 GAGGGGACTTATCTAGAGGAGGG - Intronic
1090598552 11:128345757-128345779 GATGGGAAATATAAAGACGATGG - Intergenic
1091046538 11:132330591-132330613 GAAGGGAAGTGGCAAGGGGAGGG + Intronic
1091580564 12:1785918-1785940 GAGGGGAAAAAAGAAGAGAAGGG - Intronic
1091763639 12:3104143-3104165 GAGGGGAGTGAGCAAGGGGAAGG + Intronic
1091842061 12:3628359-3628381 GAGGAGGAATAGGAGGAGGAGGG + Intronic
1092666751 12:10809205-10809227 TATGGGAAATAGCAAGTTGAGGG - Exonic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1093113892 12:15185681-15185703 GAGGGGGAAAGGTAAGAGGAGGG + Intronic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093530403 12:20155046-20155068 GAGGGGGAAGAGAAAGAAGAAGG + Intergenic
1093846687 12:23980678-23980700 GAGGGGAAAACGGAAGAGGGGGG - Intergenic
1094086679 12:26600877-26600899 CAAGGTAAATAGCAAAAGGAAGG - Intronic
1094263840 12:28531907-28531929 GATGGTAAATAGCATAAGGAAGG + Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094390949 12:29949913-29949935 GGGGCGTAATAGCAACAGGATGG - Intergenic
1094641757 12:32282638-32282660 GTGAGGAAACAGCAAAAGGAGGG + Intronic
1094691315 12:32772067-32772089 GAGGGGAAAGGGAAAGAGAAAGG + Intergenic
1094716426 12:33018995-33019017 GATGGGAACTAGAAAGAAGATGG - Intergenic
1095048912 12:37540529-37540551 GAGGTGAAATACGGAGAGGAAGG - Intergenic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1095463866 12:42470226-42470248 GAGGTAAAATAGCAGGAAGAAGG - Exonic
1096040927 12:48516750-48516772 GAGGAGGAATAGGAAGAGGAGGG - Intronic
1096066488 12:48744762-48744784 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096925747 12:55143693-55143715 GAGGGAAAAAAACAAAAGGAGGG - Intergenic
1097340569 12:58433040-58433062 TGGGGGAAAGAGCAAGTGGAGGG - Intergenic
1097340623 12:58433726-58433748 TGGGGGAAAGAGCAAGTGGAGGG + Intergenic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1098041611 12:66358807-66358829 GAGGAGAAATAGTGAGAGAAGGG + Intronic
1098079635 12:66770520-66770542 TATGGGAAATAGCAAGCTGACGG + Intronic
1098534418 12:71578364-71578386 GAGAGGAAGGAGCAAGAGGTGGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098586315 12:72157924-72157946 GATGGGAAAAGGCAAGAGGTAGG + Intronic
1098606104 12:72392056-72392078 GTGAGGACAAAGCAAGAGGATGG + Intronic
1099246975 12:80203684-80203706 GAGGGGAAAGAAACAGAGGATGG - Intergenic
1099840683 12:87961856-87961878 GAGGGGAGACAGCCAGAGGTTGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100457564 12:94767368-94767390 GAGGGCAGCAAGCAAGAGGAGGG + Intergenic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1101285630 12:103309263-103309285 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102097351 12:110251001-110251023 GCTGGGAAATGGCAAGAGTAGGG - Intergenic
1102275764 12:111580805-111580827 GAGGGGAAAAAAGGAGAGGAGGG + Intronic
1102658540 12:114504433-114504455 GACAGGAAATACCAAGAGGAAGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103200972 12:119087674-119087696 GAGAGGAAATAGGGAGAAGATGG + Intronic
1104075839 12:125388971-125388993 GAGGGGCAATAGAAAGACAAAGG - Intronic
1104417484 12:128607255-128607277 GAGGAGAATGAGCAAGGGGAGGG + Intronic
1104488825 12:129176508-129176530 GAAGGCGAATAGCAAGAAGATGG + Intronic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1105551673 13:21402726-21402748 GATGGGAAAGTGCAAGGGGAAGG - Intronic
1105842909 13:24270868-24270890 GAGGGGAGATAGCAAGATTCTGG + Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106189746 13:27441080-27441102 GAGGAGGAGGAGCAAGAGGAGGG + Intronic
1106243086 13:27925474-27925496 GAGGAGGAAGAGGAAGAGGAGGG - Exonic
1107655821 13:42591376-42591398 GAGGGGAAAAATCATGAGGTGGG - Intronic
1107772719 13:43806098-43806120 GAGGTGGAGTATCAAGAGGAAGG - Intergenic
1107796307 13:44055628-44055650 GAGTGGAAAGAGGAAGGGGATGG + Intergenic
1108045174 13:46377044-46377066 GAGTGGAACTAGTAAGAGAAAGG - Intronic
1108283962 13:48887283-48887305 GAAGGGACATAGCCAGAGCAGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1108755599 13:53498261-53498283 GAGGGGAAGCAGCAATAGGGAGG + Intergenic
1108790233 13:53961412-53961434 GAAGGGGAAGGGCAAGAGGAAGG - Intergenic
1109369196 13:61399146-61399168 GAAGAGAAAGAGGAAGAGGAAGG + Intergenic
1109477643 13:62903718-62903740 GATGGGTAATAAAAAGAGGATGG + Intergenic
1109714834 13:66207658-66207680 AAGTTGAAATAGCAAGAAGAAGG - Intergenic
1109900700 13:68765727-68765749 CAGGGGAAATGGGAAGATGATGG + Intergenic
1110168434 13:72471549-72471571 GAGTGGCAATTGGAAGAGGATGG - Intergenic
1110268729 13:73569221-73569243 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112146453 13:96705637-96705659 GATGAGAAATAGGGAGAGGATGG - Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112393100 13:99003030-99003052 GAGGGGAAAGAAGAAGAGAATGG + Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114285464 14:21238663-21238685 GAGGGGAAATATGATGATGAGGG - Intronic
1114400443 14:22405397-22405419 GGGAGGGAAGAGCAAGAGGAGGG - Intergenic
1114563734 14:23612549-23612571 GAGGGGAAAGTGCAGTAGGATGG + Intergenic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1114967660 14:27983226-27983248 GTGGAGAAAGAACAAGAGGAGGG - Intergenic
1115350948 14:32395171-32395193 GAGGTGAAAGAGAAAGAAGATGG - Intronic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115505178 14:34086913-34086935 GAGGGGGAATAGGAATAGAAGGG - Intronic
1115519696 14:34221127-34221149 GAGAGCAGAGAGCAAGAGGAGGG + Intronic
1115654514 14:35430656-35430678 GAAGGGAGATAGCAGGGGGAAGG - Intergenic
1116013322 14:39376763-39376785 GAGGGGAAATAGGAAGTGTAGGG + Intronic
1116013840 14:39382525-39382547 GAGGGGAAATTGGGAGAGTATGG + Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116916338 14:50529781-50529803 GAGAGGAAATAGCAAGAACAAGG + Intronic
1117331004 14:54711939-54711961 GAAGGGCAAAAGGAAGAGGAAGG - Intronic
1117481809 14:56153403-56153425 GAGAGAAAGTAGCAAGAAGATGG + Intronic
1117676054 14:58155940-58155962 GAAGAGAGACAGCAAGAGGAAGG + Intronic
1117866996 14:60160431-60160453 AAGGGAAAATAGAAATAGGATGG + Intronic
1117978144 14:61318585-61318607 GAAGGGAATGAGGAAGAGGACGG - Intronic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118650452 14:67886703-67886725 GATGCAAAATACCAAGAGGAGGG + Intronic
1118696686 14:68393010-68393032 TAGGGGAAATAGACAAAGGAAGG - Intronic
1118720177 14:68588382-68588404 AAAGTGAAATAGCAAGAGGACGG - Intronic
1118791441 14:69096923-69096945 GAAGGAAAAAAGCAAGGGGAAGG + Intronic
1119421877 14:74512068-74512090 GAGTGGCAACAGGAAGAGGAGGG + Intronic
1119542793 14:75451629-75451651 GATGGGAAATAGCAGGAGACTGG + Intronic
1119616100 14:76100111-76100133 GAGGCAAAAAAGCAAGAGCATGG - Intergenic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120383852 14:83819086-83819108 GTGGGGAAATAGAAAAAAGAGGG - Intergenic
1120527581 14:85595044-85595066 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1120923170 14:89773204-89773226 AAGGGGAAAGAGCACGTGGAGGG + Intergenic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121949917 14:98162819-98162841 CACGAAAAATAGCAAGAGGAGGG - Intergenic
1122024882 14:98868436-98868458 GAGGGGAAATGGCAGGTGCAAGG + Intergenic
1122085328 14:99296996-99297018 GAGTGGAGAGAGGAAGAGGAGGG - Intergenic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122469031 14:101953549-101953571 GATGAGGACTAGCAAGAGGAAGG + Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122755504 14:103976021-103976043 GGGGGGAAATAGGAAGAGGTTGG - Intronic
1124694015 15:31848288-31848310 GAGGGGCAATAGCAAAAACAGGG + Intronic
1124843024 15:33262526-33262548 CAGAGGAGATAGCAAGAGGCAGG - Intergenic
1125090586 15:35787169-35787191 CAGGGGAAATAAAAAGAGGTTGG - Intergenic
1125359367 15:38849520-38849542 CAGGGGAAATAGCAAGGTAAAGG + Intergenic
1125492104 15:40155898-40155920 TAGGGGAACTTGAAAGAGGATGG - Intergenic
1125872597 15:43115587-43115609 GAGAGAAAATAGAAAGGGGAAGG + Intronic
1126404094 15:48304936-48304958 GAGGGCTAGTAGCAAGAAGATGG + Intergenic
1127077818 15:55345274-55345296 GAGAGGAAATAGGGAGAGCAGGG - Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1127964330 15:63912458-63912480 GAAGGGGAATAGCAGGAGGCAGG + Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128572255 15:68742322-68742344 GAAGGGAAATAGAAAGGGGATGG + Intergenic
1128608897 15:69058372-69058394 AAGGGGCAATAGGAAGGGGATGG + Intronic
1128789702 15:70423913-70423935 GAGGGGCAAAAGGAAGATGAGGG - Intergenic
1128870956 15:71154835-71154857 AAGGGAAAATAGCAACAGGCAGG - Intronic
1129659726 15:77546448-77546470 AAGGGGAAATGGAAACAGGAAGG - Intergenic
1129874995 15:78968947-78968969 AAGAGGAGATAGCAAGAGTAGGG - Intronic
1129983997 15:79900322-79900344 GAAGGGAAAGAGGAAGAAGAGGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130461674 15:84163948-84163970 GAGGAGGATTAGTAAGAGGAAGG - Intergenic
1130975413 15:88769694-88769716 TACTGGAAATATCAAGAGGAGGG - Intergenic
1131002361 15:88949101-88949123 GAGGGGAAAGAACAAAAGTAGGG + Intergenic
1131105689 15:89732766-89732788 GAGGGGGAGAAGCAAGAGCATGG - Intronic
1131197161 15:90364811-90364833 AAGGGGATATCACAAGAGGATGG - Intronic
1131635684 15:94231257-94231279 GTGAGGAAATAGGACGAGGATGG - Intergenic
1132220293 15:100100256-100100278 GAGTCGAAGAAGCAAGAGGAGGG - Intronic
1132866788 16:2097104-2097126 GAGGGGGGATTGCCAGAGGAGGG - Intronic
1133050619 16:3115472-3115494 GAGGGGGCATCGCAGGAGGATGG + Exonic
1133095438 16:3442069-3442091 GAGAGGAAATAGCAAAGGGAAGG - Intronic
1133392405 16:5420937-5420959 GAGGAGGAAAAGCAGGAGGAAGG - Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133668111 16:7990690-7990712 AAGGGGAAATAAACAGAGGATGG - Intergenic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1135161589 16:20101405-20101427 GAGGTGATAGAGAAAGAGGAAGG + Intergenic
1135174301 16:20214584-20214606 GTGGGGAAACTGCAAGGGGATGG + Intergenic
1135605310 16:23819393-23819415 GAGGGGTACTAGCCTGAGGATGG - Intergenic
1135891777 16:26363797-26363819 GAGGAGAAAGAGAAAGAAGAAGG - Intergenic
1135932205 16:26747692-26747714 GAAGGGAAAGAGAAAGAGTAGGG - Intergenic
1136027315 16:27477202-27477224 GAAGGGACAGAGGAAGAGGAGGG - Intronic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136974219 16:34999239-34999261 GAGGAGGATTAGTAAGAGGAAGG + Intergenic
1137546481 16:49408069-49408091 GAAGGGGAAGGGCAAGAGGAGGG - Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1138084683 16:54122766-54122788 GAGGTGAAATTGTAAGAGGCGGG - Intergenic
1138103499 16:54273794-54273816 AATGGGAAAGAGGAAGAGGAAGG - Intergenic
1138339249 16:56278098-56278120 GAGGAGAAATAGCCAGAGAAGGG - Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138946543 16:61858136-61858158 GAGGGGGAATAAGAGGAGGAAGG + Intronic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139606128 16:68019954-68019976 GAGGTAAAATATCAAGGGGATGG + Intronic
1139947039 16:70648611-70648633 GAGGGGAAAAAGCTCCAGGAGGG + Intronic
1139994933 16:70971642-70971664 AAGGGGAAAAAGCAAATGGATGG + Intronic
1140209664 16:72960228-72960250 GAGGGGAAAGAGAGAGAGAAAGG + Intronic
1140332549 16:74072031-74072053 GAAGAGAAATAGGAAGAAGAAGG + Intergenic
1140777665 16:78264926-78264948 GAGGGGAAAAAGAAAAAGAAAGG - Intronic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1142265163 16:89061097-89061119 GAGGGGGATTTGCAGGAGGAGGG - Intergenic
1142499522 17:324388-324410 GAGGGGACATTGCAAGGGGGTGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142850841 17:2704056-2704078 GAGGGCACAGAGCAAGAGGCTGG + Intronic
1143249430 17:5511835-5511857 GAAGAGAAAGAGGAAGAGGAAGG - Intronic
1143272543 17:5686461-5686483 GGGGGGATACAACAAGAGGACGG + Intergenic
1143284198 17:5777038-5777060 GAGGGGAAAGAGCACCAGGCTGG - Intronic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1143702571 17:8672203-8672225 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1143728839 17:8868403-8868425 GAGGGGATAAAGCATGAGGTTGG - Intergenic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144178042 17:12727527-12727549 GAGGGAAAATACCCAGAGGCTGG - Intronic
1144876844 17:18401589-18401611 CTGGGGAGATAGCAAGAGAAAGG - Intergenic
1145155386 17:20542829-20542851 CTGGGGAGATAGCAAGAGAAAGG + Intergenic
1145293229 17:21566708-21566730 GAGGGGAAAGAGGAAGGGTATGG + Intronic
1145386738 17:22419229-22419251 GAGGGGAAAGAGGAAGGGTATGG - Intergenic
1145760283 17:27421645-27421667 GAGATGAAAGAGCAAGTGGATGG + Intergenic
1145798769 17:27670681-27670703 GAGATGAAAGAGCAAGTGGATGG - Intergenic
1146118774 17:30170437-30170459 GAGAGGAAATGGGAAGAGGTAGG - Intronic
1146274028 17:31503475-31503497 AAGGGGGAAGAGGAAGAGGAGGG + Intronic
1146297786 17:31663168-31663190 AAGGGGAATTTGCAAGAGTAGGG - Intergenic
1147847002 17:43411582-43411604 AAGGAGAAAGAGCAAGAGAAGGG - Intergenic
1148237021 17:45975813-45975835 GAGGGGTAAGAGAAACAGGAAGG + Intronic
1148493499 17:48037892-48037914 GGGGAGAACGAGCAAGAGGACGG - Intronic
1148910559 17:50940182-50940204 GAGGGGAGGTAGGAAGAGGCTGG + Intergenic
1149313419 17:55417981-55418003 GAGGTGGTATAGCCAGAGGATGG - Intronic
1150023354 17:61644193-61644215 GAGAGGAAAAAGGAAAAGGAAGG - Intergenic
1150427296 17:65086748-65086770 GAGGGGAAATGGGAAGGGGAAGG - Intergenic
1151098071 17:71522178-71522200 GAAAGAAAATAGCAAGAGAAGGG + Intergenic
1151145565 17:72037338-72037360 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1151396297 17:73825286-73825308 GGGGAAAAAAAGCAAGAGGAAGG + Intergenic
1151470383 17:74314261-74314283 GCGGGGCAATACCAAGAGGTGGG - Exonic
1151765340 17:76130811-76130833 GAGAGGGAAGAGGAAGAGGATGG - Intergenic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1153046586 18:860857-860879 GATGTGAAATAGAAAGAGGGTGG + Intergenic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153682664 18:7515191-7515213 GAGGGAAAAGAAGAAGAGGAAGG - Intergenic
1153987662 18:10367867-10367889 GAGGGGAAAAAGGAAAGGGAAGG + Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155789361 18:29946171-29946193 GAGGGGAAAGAGGAAGGGAAGGG + Intergenic
1155836224 18:30588237-30588259 GAGGGGGAAAAGCAAGAGATGGG + Intergenic
1156351932 18:36309344-36309366 AATGGGAAATTCCAAGAGGAAGG + Intronic
1156463242 18:37333362-37333384 GAGGGGAAGAAGGGAGAGGAGGG - Intronic
1157398775 18:47368230-47368252 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1158063383 18:53375378-53375400 GAAAGGAAATGGGAAGAGGAAGG + Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1159727211 18:71976038-71976060 GAGGGAAAATAAAAAGATGAAGG - Intergenic
1159754742 18:72350530-72350552 GAGGGGAGAAAGAAAAAGGATGG + Intergenic
1159883875 18:73885879-73885901 GGGGGAAGATAGCAAGAGGTTGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160173990 18:76578658-76578680 GAGGGGAAAGAGGAAGACTAGGG - Intergenic
1160173994 18:76578676-76578698 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160174579 18:76582225-76582247 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160606062 18:80050193-80050215 GAAGGGACAGAGCTAGAGGAAGG + Intronic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160925356 19:1542255-1542277 GAGGAGAAAGAGGAAGAGAAGGG - Intergenic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162297852 19:9825812-9825834 GAGGGGAAAGAGGGAGAGTATGG - Intronic
1162428989 19:10615610-10615632 GAGGAGGAAGAGGAAGAGGAAGG + Intronic
1162616398 19:11804282-11804304 GTGAGGACACAGCAAGAGGATGG - Intronic
1162690515 19:12426052-12426074 GAAGGGGAAAAGGAAGAGGAAGG + Intronic
1162838145 19:13335222-13335244 GAAGGGAAACAGGAAGAGGTGGG - Intronic
1163380047 19:16960032-16960054 GAGGGAAATTAGCAAAGGGAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1164863593 19:31583437-31583459 GAGGAGAGAGAGCAAGAGGAGGG + Intergenic
1165213550 19:34254094-34254116 GAGGGGAAAGAGTAAGAGGGAGG - Intergenic
1165355902 19:35303889-35303911 CAGGGGAAATGGAAACAGGAAGG - Intronic
1165574170 19:36799988-36800010 GAGGAGGATTAGTAAGAGGAAGG + Intergenic
1166257180 19:41614962-41614984 GAGGGGAAAAGGGAAGGGGAAGG + Intronic
1166546480 19:43637097-43637119 GAGGAGAGAAAGCAAGAGGGAGG - Intronic
1166640405 19:44490087-44490109 GAAGGGAAAGAGCGAAAGGAAGG + Intronic
1166658169 19:44627339-44627361 GAGGGGGAATGGCAGGAGGGAGG + Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1166981381 19:46634268-46634290 GAGGGGACAGGGCAAGAGGCGGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167496678 19:49823331-49823353 GTGTGTAAATAGCAAGAGGCTGG + Intronic
1167499025 19:49835434-49835456 GAGGGGAACTAGTAAGGAGATGG - Intronic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168053459 19:53847288-53847310 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1168090523 19:54080045-54080067 GAAGGGAAAGAGAGAGAGGAAGG + Intronic
1168233070 19:55045413-55045435 AAGGGGAAAGGGCTAGAGGAGGG - Intronic
1168578632 19:57534969-57534991 GAGGTGAACTAGCAGGAGCATGG + Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
925287695 2:2726691-2726713 TGGGGAAAAAAGCAAGAGGAGGG - Intergenic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
926716787 2:15930798-15930820 GAGGGAAAAGACCAAGAGCATGG - Intergenic
926727679 2:16011168-16011190 GTGAGGACATAGCAAGAAGACGG + Intergenic
926984763 2:18610764-18610786 GTGGAGATATAGCAAGAAGAGGG + Intergenic
927003094 2:18819649-18819671 GAGAGGAAATTGAAAGAGAAAGG - Intergenic
927427384 2:22996112-22996134 GAGAGGCAGAAGCAAGAGGAAGG + Intergenic
927785675 2:25972838-25972860 GAGGGGAAAGAGAAAGAGGTGGG - Intronic
928266132 2:29813407-29813429 GAGGGGAATTAGGGAGTGGATGG + Intronic
928353167 2:30581761-30581783 GAAGGGAAATAGCCAAAGGTTGG + Intronic
928422062 2:31145283-31145305 AAGGTGAAATAGCCAGAGGATGG - Intronic
929147706 2:38721250-38721272 GAATGCAAATAGAAAGAGGAAGG + Intronic
929177595 2:38996993-38997015 GATGGGAAATAGCATGGAGAAGG - Exonic
929694661 2:44104000-44104022 GAGGGGAAAATGAAAGGGGAGGG - Intergenic
929819933 2:45264829-45264851 AAGGGGACAGAGCAAGTGGAAGG - Intergenic
930021517 2:47004659-47004681 GAGGGGAATGAGCAGGAGAAGGG + Intronic
930084053 2:47480196-47480218 GAAGGGAAGGAGGAAGAGGAGGG - Intronic
930084093 2:47480300-47480322 GAGGGGAAAGGGGAAGGGGAAGG - Intronic
930493704 2:52110210-52110232 GTGAGGACATAGCAAGAGGGTGG + Intergenic
930674346 2:54184257-54184279 GAGTGGTATTAGCAAGAGAATGG + Intronic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
932496646 2:72148850-72148872 GAGGGGGAAAAGCAGGAGGCAGG + Intergenic
932569186 2:72928994-72929016 GAGGGGAAAAAGCCATAGGCAGG - Intronic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
932627570 2:73310365-73310387 GAGGGGAAATAAGAAGATGTTGG - Intergenic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932933274 2:76068035-76068057 GGGTGGAAATAGCATAAGGATGG + Intergenic
933229471 2:79789711-79789733 GAGTGGAAATGGGAAGTGGAAGG + Intronic
933862929 2:86487990-86488012 TAAGGGCAATAGGAAGAGGATGG - Intronic
934925958 2:98381877-98381899 GTGGGGAAAGAGGAAGAGGGAGG + Intronic
935370625 2:102342878-102342900 GAGAGGACATAGAAAGAGGAAGG + Intronic
935654780 2:105412734-105412756 GAGGAGAAAGAGCCAGAGGCGGG + Intronic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936248489 2:110848974-110848996 CATGGGAAATAGCAAAAGCAAGG - Intronic
936768025 2:115877162-115877184 GAGTGAAAAGAGCAAGGGGAGGG - Intergenic
936803616 2:116297333-116297355 GAGGGAATTTAGCAAGAGGAAGG + Intergenic
936855119 2:116948358-116948380 GAGGGGAAGGAGGGAGAGGAGGG + Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937708735 2:124952643-124952665 GAGGGAGAAAAGCAAAAGGAAGG - Intergenic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
938625531 2:133104904-133104926 GAAGGTTAATAGCAAAAGGATGG - Intronic
938990451 2:136622969-136622991 GAGGGGTACTGGCAAGAGCAGGG + Intergenic
939092485 2:137795479-137795501 GAGAGGATACAGCAAGAAGATGG - Intergenic
939223858 2:139339874-139339896 GAGGGGACAGAGAGAGAGGAGGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939500142 2:142974252-142974274 GAGGGGAAAGAGGAAGGGTATGG + Intronic
939612473 2:144327773-144327795 TAGGGGAGATAGCAAGGAGAGGG + Intronic
939736402 2:145852892-145852914 GAGGGGGAAGAAGAAGAGGAGGG + Intergenic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940428971 2:153565245-153565267 GAGGGGAAAGAAGAAAAGGAAGG + Intergenic
940721924 2:157291767-157291789 GAGGGGATATAGGGAGAGGCGGG - Intronic
941324228 2:164093231-164093253 GAGGGGGAATAGCGTGAGTAAGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942006329 2:171703653-171703675 GAAGAGAAAGAGCAAGGGGAAGG + Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942217752 2:173738738-173738760 TAGGGGAAATGGCAGGAGGCAGG + Intergenic
942485245 2:176432397-176432419 GATGGTAAATTCCAAGAGGAAGG - Intergenic
942825980 2:180177271-180177293 GAGAGGAAAAAACAAGAGAAAGG - Intergenic
943376684 2:187086290-187086312 GAGTATAAATAGCATGAGGAAGG + Intergenic
943430351 2:187792387-187792409 TAGGGGAAGTTTCAAGAGGAGGG + Intergenic
943628164 2:190221733-190221755 GAGGAGAAGTAGCAAGACGACGG + Intronic
944201895 2:197116614-197116636 GAGGAGAAAGAGCCAGAGAAAGG - Intronic
944301509 2:198129738-198129760 GCGAGGAGATAGAAAGAGGAAGG - Intronic
944316332 2:198289370-198289392 GAGGGGAAAGAGAAAGAGACAGG - Intronic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
945419606 2:209618170-209618192 GAGTTGAAAAATCAAGAGGAAGG + Intronic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
945958221 2:216105951-216105973 GAAGGGGAAAAGCAAGAGGGAGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946447863 2:219755008-219755030 GAGGGTTTATAGCAAGAAGATGG - Intergenic
946670910 2:222103250-222103272 GAGGGGAAAAAGCATAAGAAAGG + Intergenic
946972007 2:225104134-225104156 GAGGCTGAATAGGAAGAGGAGGG - Intergenic
947038186 2:225884259-225884281 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
947216751 2:227756882-227756904 GAGGGGAAATAGGGAGGGTACGG + Intergenic
947226822 2:227848694-227848716 GATGGGAAATTGCAAGAAGAGGG + Intergenic
947401307 2:229733933-229733955 GAGGGGGCAAAGTAAGAGGAAGG - Intergenic
948216125 2:236234234-236234256 TAGGGGACATAGCCAGGGGAGGG - Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948483311 2:238263979-238264001 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
948541505 2:238694224-238694246 GAGGAGAAAGAGGAAGAGGGAGG + Intergenic
1168955229 20:1829865-1829887 GAGGGGCGACAGCAAGAGGAAGG + Intergenic
1169457354 20:5763602-5763624 TAGGGGAAAGAGGAAGAGTATGG - Intronic
1169544129 20:6633579-6633601 GGGGGCAAATAAAAAGAGGAAGG - Intergenic
1170414338 20:16124094-16124116 AAAGGGAATTGGCAAGAGGAAGG - Intergenic
1170922964 20:20696574-20696596 GAGGGGAAATAGGGATAAGATGG - Intronic
1170930175 20:20762549-20762571 GAGGGCACAGAGCAAGAGAAGGG - Intergenic
1171079530 20:22164551-22164573 AAGGGGAAAGAGCAAAAGAAAGG + Intergenic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171945342 20:31371833-31371855 AAGGGGGAAGAGTAAGAGGAGGG - Intronic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173409697 20:42799141-42799163 GAGGGAAAAGGGGAAGAGGATGG + Intronic
1173894172 20:46537649-46537671 GATAGGTAATAGGAAGAGGATGG - Intergenic
1173899390 20:46576032-46576054 GAGAGGAAAGAAAAAGAGGAAGG + Intronic
1174073275 20:47913761-47913783 GAGGTGAGATAGAAAGAGAAGGG + Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1174259635 20:49284528-49284550 CAGGGGAAATAGTAAGAAAAAGG - Intergenic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174498578 20:50967343-50967365 GATGGGAAAGAGCATGAGGGAGG - Intergenic
1174523045 20:51147503-51147525 GAGGAGCAAGAGGAAGAGGAGGG + Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174842539 20:53913807-53913829 GATGGAAAATAGGTAGAGGATGG - Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175452103 20:59077955-59077977 GAGGGGGAGGAGGAAGAGGAAGG + Intergenic
1175487362 20:59355658-59355680 GGGGGGAGATAGGGAGAGGAGGG - Intergenic
1175925914 20:62471259-62471281 GAGTGGATACAGCCAGAGGAGGG + Intronic
1175929702 20:62487874-62487896 GAAGAGAAAGAGCAAGAGGAAGG - Intergenic
1177758314 21:25373705-25373727 GAGGGGGAGTAGGAAGAGGATGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177968460 21:27759089-27759111 GAGGGGAGATGGAAAGGGGATGG - Intergenic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1179373310 21:40826967-40826989 GAGAGGAATTAGAGAGAGGAAGG + Intronic
1179633931 21:42695486-42695508 GAGGGGAGAGGGCCAGAGGACGG + Intronic
1181539920 22:23567541-23567563 GAGGAGGGAGAGCAAGAGGAAGG + Intergenic
1181907315 22:26209691-26209713 GAAGGAAAAAAGAAAGAGGAAGG + Intronic
1181963772 22:26642439-26642461 GAGGGGCGAGAACAAGAGGAAGG + Intergenic
1181998611 22:26902773-26902795 GGGGGGAAAGAGAGAGAGGAAGG - Intergenic
1182099529 22:27648180-27648202 GAGGGGGAAGAGCAAAAGGAAGG + Intergenic
1182277824 22:29201578-29201600 TAGGAGAAATTGCCAGAGGAGGG + Intergenic
1182308980 22:29391309-29391331 GTGAGGACATAGCAAGAGGGCGG - Intronic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183091095 22:35522726-35522748 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1183258337 22:36777572-36777594 GAGGGGAGCCGGCAAGAGGAAGG - Intergenic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184024143 22:41841479-41841501 GAGGCCAAATAGACAGAGGAGGG - Intronic
1184379023 22:44133505-44133527 TAAGGGAAATAGCAAGAGAAAGG - Intronic
1184549275 22:45195936-45195958 GTGGGGGAAAAGGAAGAGGAGGG - Exonic
1185198220 22:49485943-49485965 GTGAGGACATAGCAAGAGGGTGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949694450 3:6678352-6678374 GAAAGGAAATAGCAAAAGCAGGG + Intergenic
949792306 3:7806514-7806536 GATGGGAAATAGAAAGTGAAAGG - Intergenic
949819641 3:8102480-8102502 GAGGTGAAATAATAAGAGAAGGG + Intergenic
950314305 3:11986984-11987006 AAGGGGAAGAAGCAAGAGAAAGG - Intergenic
950387934 3:12674550-12674572 GAGGAGAATTAGTAAGAGGAAGG + Intergenic
951008014 3:17641585-17641607 GAGGAGGAATAGGAGGAGGAAGG - Intronic
951297198 3:20952486-20952508 GAGGGGAGATAGCCATAGCATGG + Intergenic
951470496 3:23051237-23051259 GAGGGAACATAGGAAGGGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951773902 3:26287412-26287434 GAGTAGAAATAGAAATAGGAGGG + Intergenic
952070751 3:29632844-29632866 GTGGGGAAATAAGCAGAGGAAGG - Intronic
952106155 3:30071509-30071531 GAGGGGGAAGAGTGAGAGGAGGG + Intergenic
952541582 3:34372994-34373016 GAGGGGATGTGCCAAGAGGAGGG + Intergenic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953340995 3:42134172-42134194 GAGGGGGAAGGGGAAGAGGAAGG - Intronic
953904785 3:46863184-46863206 GAGTGGACCTAGCAAGAGGCAGG - Intronic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954853919 3:53626474-53626496 GAGGGGAAATGGAGAGAGAAAGG + Intronic
955424629 3:58775598-58775620 GAAGGGAAGTAGAAAGAGAAGGG + Intronic
955703119 3:61701900-61701922 GAGAGGGAAGAGAAAGAGGAAGG + Intronic
955812465 3:62805676-62805698 GAGGGGAAAAGGGAAGAGAATGG - Intronic
955893483 3:63674952-63674974 GTGGGGAAATAGGAAGGGAAGGG - Intronic
955940987 3:64146958-64146980 GAGGAGGAAGAGGAAGAGGAAGG - Exonic
956751064 3:72344236-72344258 GAGGAAAAAAAGCAAGAAGAAGG + Intergenic
959069551 3:101689698-101689720 GAGTGGAAATTGGAAGAGCAAGG - Intergenic
959679899 3:109082826-109082848 GAGGGAATAAAGCAAGAGCAAGG + Intronic
959966605 3:112362893-112362915 GAGGGGAAAGATAGAGAGGAGGG - Intergenic
960008387 3:112805692-112805714 GAGAGGACACAGCAAGAAGATGG + Intronic
960299835 3:115988944-115988966 AAGGGAATATAGCAAGAGAAAGG - Intronic
960872163 3:122260925-122260947 GAGGAGGAATAACCAGAGGAGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961252135 3:125516268-125516290 GAGAGGAAATAGCAAGGGAGTGG - Intronic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961534363 3:127560627-127560649 GCAGGGAAATAGGAAGAGCAGGG - Intergenic
962352472 3:134665836-134665858 GAGGAAAGATAGCCAGAGGAAGG + Intronic
962500957 3:135991783-135991805 GAGGGGAAAAAGCACCAGGTGGG - Intronic
962573699 3:136736446-136736468 GAAGGGAGATAGCAGGGGGAAGG + Intronic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
962991830 3:140584503-140584525 GAGGGGAAAAAGAAAGGGCATGG + Intergenic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963490807 3:145998115-145998137 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
964453945 3:156839994-156840016 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
965333596 3:167407738-167407760 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965617394 3:170608925-170608947 GAGGTGAAAGAGTAAGAGGAAGG - Intronic
965674279 3:171178610-171178632 GAGGGGGAATATCAAGAGATGGG + Intronic
965743743 3:171903671-171903693 GAGGGGAGATAGGGAGAGGTTGG - Intronic
966206356 3:177410451-177410473 GAGGAGAAATAAGAAAAGGAAGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
967326501 3:188245530-188245552 GAGGTGAAAAGGCAAAAGGAAGG - Intronic
967719803 3:192803687-192803709 GAAGGGAAAAAGACAGAGGAGGG + Intronic
968620037 4:1599918-1599940 GAGAGGAAATAGGAGGGGGAGGG - Intergenic
968715229 4:2153160-2153182 GAGAGCAAAAAGCAAGAGGCAGG + Intronic
968963694 4:3758683-3758705 GAGGGGGAAGAGGAAGAGGAGGG + Intergenic
969477271 4:7428702-7428724 GAGAGGAAAGAACAAGGGGAGGG + Intronic
969495326 4:7523072-7523094 GGAGGGAAATGGGAAGAGGAAGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969839378 4:9869477-9869499 GAGGGGGCATTGTAAGAGGAAGG - Intronic
970305425 4:14726906-14726928 GAGGGGAGAGAGCAACGGGAGGG - Intergenic
970807141 4:20050239-20050261 GAGGAAAAATAGGAAGAGGAGGG - Intergenic
971072509 4:23110852-23110874 GTGAGGAAATAACAAAAGGAAGG - Intergenic
972216564 4:36904537-36904559 GAGGGGAGGTGGCAAGAGAATGG + Intergenic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
972790245 4:42364909-42364931 GGAGGGAAAGAGAAAGAGGAAGG - Intergenic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
974099234 4:57398650-57398672 GAGGGGAAATTCCATGAGGTAGG + Intergenic
974148220 4:57972465-57972487 GAGGGTAAATGGTAAAAGGAGGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975756980 4:77580755-77580777 GAGGGGAAGGAGGGAGAGGAGGG - Intronic
976361776 4:84187551-84187573 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
976572751 4:86632627-86632649 GAGGAGAAAGAGAAAGAAGAAGG - Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
977129687 4:93219911-93219933 GCAGGGAGATAGCAAGAGTAGGG + Intronic
977334619 4:95681092-95681114 CAGGAGAAATAGCAAGACGCAGG - Intergenic
977666990 4:99653662-99653684 GAGAGAAAATATCAGGAGGAGGG - Exonic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978122240 4:105093507-105093529 CAGGGGAAATAACAACAGAATGG - Intergenic
978264754 4:106810353-106810375 GAGGGGGAGGAGGAAGAGGAGGG - Intergenic
978503524 4:109433780-109433802 GAGAGGAGAGAGGAAGAGGAAGG - Intronic
979128358 4:117006417-117006439 GAAGGCTAAAAGCAAGAGGAAGG + Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979749652 4:124262994-124263016 GAAGGAAAAGAGAAAGAGGAGGG - Intergenic
981091640 4:140738468-140738490 AAGGGGAAAGAGCAAGAAGGAGG - Intronic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
981918095 4:150056878-150056900 GAGGGGGTAGAGGAAGAGGAAGG - Intergenic
982275327 4:153631810-153631832 GAGGGGAAAGTGGAAGAGTAGGG - Intronic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983640390 4:169939776-169939798 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
984039179 4:174707588-174707610 GAAGGGAAATAGGCAAAGGAGGG + Intronic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984828479 4:183949906-183949928 GAGGTGACATTGCTAGAGGAGGG - Intronic
985136240 4:186788676-186788698 GAGGGGATAGAGCAAAGGGATGG - Intergenic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986229241 5:5846635-5846657 GAGGGTAAAAGGTAAGAGGAGGG - Intergenic
986346847 5:6843748-6843770 GAGGCTAAAAAGGAAGAGGACGG + Intergenic
986353986 5:6906204-6906226 GAGGGCAAGAAGCAAGAAGACGG - Intergenic
986482646 5:8204309-8204331 GAGTGACAAGAGCAAGAGGAGGG - Intergenic
986772580 5:10987626-10987648 GACGGGGAATGGAAAGAGGAGGG - Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987151183 5:15041800-15041822 GAGAGGAAATAGGAAGATGTAGG - Intergenic
987657949 5:20832565-20832587 GAGTAGAAATAGCAATAGCAAGG - Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
988099760 5:26660997-26661019 GAGGGAAGAGAGCAAGAGCAGGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
988828988 5:34969318-34969340 GAAGGGACATGGCAAAAGGAAGG + Intergenic
988839179 5:35066562-35066584 AAGGGGAAATAAGAAGAGGAAGG - Intronic
989092968 5:37753859-37753881 GAAGGGGAATAGGATGAGGATGG - Intergenic
989118180 5:37977092-37977114 GTGAGGACACAGCAAGAGGATGG + Intergenic
989167617 5:38446462-38446484 GGGGCAAAATGGCAAGAGGACGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991114471 5:62938353-62938375 GAAGGGAAATAGAGAGGGGAAGG + Intergenic
991175673 5:63685155-63685177 GAGGGAGAAAAGGAAGAGGAAGG - Intergenic
991487087 5:67148639-67148661 GAGAGGAAATAGCATGAGGGAGG + Intronic
991553946 5:67874364-67874386 GATAGGAAATGGGAAGAGGAGGG - Intergenic
992511245 5:77437721-77437743 GAAGAGAGGTAGCAAGAGGAGGG - Intronic
992956117 5:81910116-81910138 GAGGGGCAAGAGGAAGAGGAGGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993958613 5:94268396-94268418 GTGGGGCAACTGCAAGAGGAGGG + Intronic
993978125 5:94507513-94507535 GAGGTGAATTAGCAAAATGATGG + Intronic
995357974 5:111261425-111261447 GAAGGGAAATACCTAGAGGAAGG - Intronic
995378952 5:111511577-111511599 AAGGGAAAATAGCAACAGGAAGG + Intronic
995492451 5:112707532-112707554 GAGGGCAAGTAGCAAGGGGGCGG + Intronic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
995537632 5:113153258-113153280 GAGGGGAGATATAATGAGGAAGG - Intronic
996334911 5:122372790-122372812 GAGGGGGAAGGGAAAGAGGAGGG - Intronic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996724241 5:126660008-126660030 GAGGGGAAAGAGGAAGTGTATGG - Intergenic
998028002 5:138837467-138837489 GAGGGGGAGGATCAAGAGGAGGG - Intronic
998507000 5:142680031-142680053 GAGTGGACATAGGAAGAAGATGG - Intronic
998537801 5:142950964-142950986 GAAGGGAAAGGGAAAGAGGAAGG - Intronic
998821637 5:146062807-146062829 GAGGTGAAATAGGAAGAACAAGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999212203 5:149899618-149899640 GAGAGGAGGTGGCAAGAGGATGG + Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1000132051 5:158309846-158309868 GAAAGGAAATAGAGAGAGGAAGG - Intergenic
1000247167 5:159458336-159458358 GAGGTGACACAGCAACAGGAGGG - Intergenic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000420058 5:161028541-161028563 GTGGGAAACTAGCAAGAAGAGGG + Intergenic
1001044735 5:168363081-168363103 GAGGGTAGAGAACAAGAGGAAGG + Intronic
1001468482 5:171990142-171990164 AAGGGGAAAGAGGAAGAGAAGGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1002779905 6:357970-357992 GAGGGGGAATCACGAGAGGAGGG + Intergenic
1002999749 6:2319826-2319848 GAGGGGAGCTGGAAAGAGGATGG + Intergenic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003476340 6:6487432-6487454 GAGGGGAGGAAGCGAGAGGAGGG - Intergenic
1003674686 6:8192375-8192397 GAGGGGCACCAGCAACAGGAGGG + Intergenic
1003759690 6:9162771-9162793 GAGGGGAAAGAGAGAGAAGAAGG + Intergenic
1003765965 6:9236817-9236839 AAGGGGAAATGGGAAGAGGTAGG - Intergenic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004721030 6:18267209-18267231 GAGGGGAAAGTGCAGGAGGTGGG + Intergenic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005758438 6:28946342-28946364 GAAGGAAAAGAGCAAGAGAATGG + Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007449138 6:41930105-41930127 GAGGGGAAGTGCCAAGAGGAGGG - Intronic
1007698904 6:43753471-43753493 GAGAGAAAATAACAAAAGGATGG - Intergenic
1007730405 6:43942134-43942156 GTGGGGCCATAACAAGAGGAGGG - Intergenic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1008125736 6:47666141-47666163 GAGGAGGAATAGGAGGAGGAGGG - Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1009241554 6:61192317-61192339 GAGGGGAAAGAGGGAGAGTATGG + Intergenic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009677045 6:66838952-66838974 GAGACGGAATAGCACGAGGAGGG + Intergenic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010388929 6:75313990-75314012 AAAGAGAAATAACAAGAGGAAGG - Exonic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010680541 6:78793816-78793838 GAGGGGGATTATCAAGAAGATGG - Intergenic
1010824135 6:80452118-80452140 GAGGGGAGAGAGCAAGAGAGAGG + Intergenic
1010966376 6:82213868-82213890 GAGGGGAAGGAGAAAGAGAAGGG + Intronic
1011037194 6:82990763-82990785 GAGGGGAAAGAGGGAGAGTACGG - Intronic
1012366552 6:98447665-98447687 GTGGGGGAATAGCAAGAGTGGGG - Intergenic
1012660489 6:101883739-101883761 GAGAGGGAATAGCAAGCGTAAGG + Intronic
1013623881 6:111918300-111918322 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1013726814 6:113108110-113108132 GAGGGCAAAAGGCAAGAGGAGGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014761990 6:125366640-125366662 TGGGGGAAAGAGCAAGAGGTAGG - Intergenic
1014862565 6:126487772-126487794 TAAGGGAAATAGGAAGATGATGG - Intergenic
1015113359 6:129619268-129619290 GAGGGGGAAAAGAAAGAGGAGGG + Intronic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1015209341 6:130678967-130678989 GAAGGGATGTAGGAAGAGGAAGG + Intergenic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016062480 6:139645077-139645099 GAGGGGGGATTGCAAGAGGCAGG + Intergenic
1016358601 6:143244334-143244356 GTGGAGGAATAGCAAGAGGTTGG + Intronic
1017105133 6:150880238-150880260 GAGGGGAAATGGGGAGAGGTTGG - Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1019964079 7:4484679-4484701 GAGGGGAGGGAGAAAGAGGATGG + Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020329367 7:7002285-7002307 GAGGAGGATTAGTAAGAGGAAGG - Intergenic
1020583420 7:10033797-10033819 GTGGGGAAATAACCACAGGATGG + Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1021175402 7:17444215-17444237 GGGAGGAAATGGCAAAAGGAAGG - Intergenic
1021841900 7:24727792-24727814 GAGGGGAAATCGGCAGATGAAGG - Intronic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022493916 7:30841199-30841221 GAGGGGAGATAGCGTGGGGAGGG - Intronic
1022531656 7:31070507-31070529 GAGGGGAGAGGCCAAGAGGAAGG + Intronic
1022596972 7:31722102-31722124 GAAGGGAAAAAGTAAGAGAAGGG - Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024494601 7:50030251-50030273 GAAGGGGAATAGCAAGGGGAGGG + Intronic
1024497504 7:50065201-50065223 TAGAGGAATTAGAAAGAGGAAGG + Intronic
1024619210 7:51143021-51143043 GAGGAGGAAAAGTAAGAGGAAGG + Intronic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1024675606 7:51635638-51635660 AAGGGGATTTAACAAGAGGAGGG - Intergenic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1025294795 7:57768891-57768913 GGGGAGACAGAGCAAGAGGAAGG - Intergenic
1026016942 7:66679048-66679070 GGAGGGAACTAGCAAGAGCACGG - Intronic
1026040695 7:66865777-66865799 GAGGGGCAAAAGGAAGGGGAAGG - Intergenic
1026211826 7:68312714-68312736 TGGGTGAAAGAGCAAGAGGAGGG - Intergenic
1026344748 7:69464411-69464433 GATGAGAAATAGAAAGAGTAAGG + Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026641983 7:72135104-72135126 TGGTGGAAATAGCAAGAGAAGGG - Intronic
1027589920 7:80105690-80105712 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1028030467 7:85905652-85905674 GGAGAGAAAGAGCAAGAGGAAGG - Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029310751 7:99661525-99661547 CAGGAGAAATATCAAGAGGGAGG - Intronic
1029615226 7:101652262-101652284 GAAGGGAAAAAGGAAGAGGCTGG + Intergenic
1030038344 7:105427552-105427574 AAGGGGGAATAGGAAGAGAATGG + Intergenic
1030845231 7:114400972-114400994 AAGAGGAAATAGCAGGAGTAAGG + Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1030962064 7:115936817-115936839 GAGTTGAAAAAGGAAGAGGAAGG + Exonic
1031101036 7:117479909-117479931 CGGGGGAAAGAGCAAAAGGAAGG + Intronic
1031621109 7:123934841-123934863 GAGGGGGAATAGGCAGAGGTTGG + Intronic
1031729852 7:125286306-125286328 TGAGGGAAATAGGAAGAGGATGG + Intergenic
1031866122 7:127039970-127039992 GAGGGGAAAGGGGAAGGGGAAGG + Intronic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032523852 7:132564393-132564415 GAGGGGGAGGAGCAAGAAGAGGG - Intronic
1033351356 7:140564988-140565010 GAGGTGTGATAGCTAGAGGAAGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033646252 7:143306844-143306866 GAGGGGTAATAGAAAGCAGAAGG - Exonic
1033867146 7:145704707-145704729 GAAGGCAAATAGAAAGAGGATGG - Intergenic
1034016659 7:147594932-147594954 GAGAGGAGATAGGAAGAGAAAGG + Intronic
1034546078 7:151790226-151790248 GAGCAGGAAGAGCAAGAGGAAGG - Intronic
1034672099 7:152866714-152866736 GAAGGGAAACAGGAAGGGGAAGG - Intergenic
1034687954 7:152990121-152990143 GAGGGGGAAAAAAAAGAGGAAGG - Intergenic
1034731050 7:153387833-153387855 GAGGAGAGAATGCAAGAGGATGG + Intergenic
1036056419 8:5259908-5259930 TAAGGGAGATAGCAAGAGTAGGG - Intergenic
1036453069 8:8885623-8885645 GAAGGAAAACAGCAAAAGGAAGG + Intronic
1037459333 8:19093669-19093691 GAAGGGAAATAGAAACCGGATGG - Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1037849114 8:22311830-22311852 GAGAGAAAAAAGCAAGGGGAAGG + Intronic
1038163165 8:25059833-25059855 GAGGGTAAAGGGCAAGAAGATGG - Intergenic
1038271678 8:26080847-26080869 GATGGTAAATGCCAAGAGGATGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1039287708 8:36060872-36060894 GAGGGAAAATGGGAAGAGGTGGG + Intergenic
1039317068 8:36385513-36385535 GAGGAAAAGTAGCCAGAGGAAGG - Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1039464565 8:37775282-37775304 AAGGGTAAATGGCCAGAGGAAGG - Intronic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041874767 8:62675496-62675518 GATGGAAAGTAGCAAGAGTAGGG + Intronic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042480565 8:69297616-69297638 GAAGGGAAAGGGGAAGAGGAAGG + Intergenic
1042889334 8:73589966-73589988 GAAGGGAAGAAGAAAGAGGAGGG + Intronic
1043037431 8:75215525-75215547 GAGAGGCCAAAGCAAGAGGATGG - Intergenic
1043339297 8:79218202-79218224 GAGGGGAAATAGCAGAAGATTGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1044301597 8:90590889-90590911 GAAGGGAAAAAGAAAAAGGAAGG + Intergenic
1044536773 8:93365924-93365946 CAGGGATATTAGCAAGAGGATGG + Intergenic
1045015056 8:97994205-97994227 GAGGGGGAAGGGAAAGAGGAAGG + Intronic
1045101764 8:98851657-98851679 GAGGAGGAATAGAAAAAGGAGGG + Intronic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1046100521 8:109609128-109609150 GAGAGGTAATTGCAGGAGGAGGG - Intronic
1046790066 8:118312065-118312087 AAGAGGAAATAGCAAGATGTGGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046913475 8:119655011-119655033 GAGGTGAAATAGTAAGAACAAGG - Intronic
1047871288 8:129085447-129085469 AAGGGGTAATAGAAACAGGAAGG + Intergenic
1048242653 8:132758437-132758459 GGGAGAAAATAACAAGAGGAAGG + Intronic
1048518911 8:135136098-135136120 GAGGAGGAAAAGGAAGAGGAGGG + Intergenic
1049491724 8:142907458-142907480 TAAGGGAAAAAGGAAGAGGAGGG - Intronic
1050044278 9:1527138-1527160 GAGGGGAAATAAGAAGAGGGAGG + Intergenic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050273396 9:3970917-3970939 GAGGGGAAATAAAAAAAGGATGG + Intronic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050348121 9:4713858-4713880 GACGGGTATTAGCAAGAGGAAGG - Intronic
1050801017 9:9614989-9615011 GGGGAGAAATTGCAGGAGGAAGG + Intronic
1050836672 9:10089492-10089514 GAGTGGGATTAGCAACAGGAAGG + Intronic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1052415160 9:28168365-28168387 GTGTGAAAATAGCAACAGGAAGG + Intronic
1052750331 9:32483588-32483610 GAGGGAACAAGGCAAGAGGAAGG - Intronic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1054161628 9:61675401-61675423 GGGGAGACAGAGCAAGAGGAAGG + Intergenic
1054851008 9:69846713-69846735 GGCTGGATATAGCAAGAGGATGG + Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055707386 9:79020490-79020512 GAGGGGAAAGAAAAAGTGGAGGG + Intergenic
1055933724 9:81585728-81585750 GTGGGGAAATAGCAAGAATGGGG + Intronic
1056289495 9:85128399-85128421 GATGGGAACTAGGAAGATGAAGG + Intergenic
1056378248 9:86035111-86035133 GAGGGGACCTTGCAAGTGGATGG - Intronic
1056545050 9:87606456-87606478 GAAGGGAAAGAGAGAGAGGAAGG - Intronic
1056890658 9:90488791-90488813 GGGAGGAAACAGTAAGAGGAGGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1058139469 9:101342444-101342466 GAGGGGGAAGAGGAAGGGGACGG + Intergenic
1058223521 9:102332043-102332065 GAGGGGGAAGAGCAATAGAAGGG - Intergenic
1058331517 9:103767230-103767252 AAGAGGAAATATCAAGAGTAAGG + Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1058913279 9:109540999-109541021 GAAGGGGAAGAGGAAGAGGAAGG - Intergenic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059837019 9:118166690-118166712 GAGGGGAATAATCAGGAGGAAGG - Intergenic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060554545 9:124501536-124501558 GAGGGGAAAGAGCAGGAGAGAGG + Intronic
1061276102 9:129570089-129570111 GAGGAGAGAGACCAAGAGGAAGG + Intergenic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061491087 9:130944600-130944622 GAGGGGAGAGAGCATGAGGTGGG + Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062097970 9:134712465-134712487 GAGGGGAAATAGGAAGGAGGGGG - Intronic
1062182046 9:135196164-135196186 AAGGGGAAATGGGAAGGGGAAGG - Intergenic
1062503805 9:136862666-136862688 GACGGGAACTGGCAAGGGGAAGG + Intronic
1062675353 9:137740037-137740059 GAGGGAAAAAAGCAAGTGCACGG - Intronic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186045528 X:5532662-5532684 GAGGGGAGAAAGAAAAAGGAAGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186075013 X:5868818-5868840 GAAGAGAAAGAGGAAGAGGAGGG + Intronic
1186240920 X:7565431-7565453 GAGTGGAAATAGGAAGAGTTGGG + Intergenic
1186318461 X:8397093-8397115 GATGGGAAATAGCCAGTGAAAGG - Intergenic
1186336283 X:8592648-8592670 GAGAGGAAATAGAAATAGAAAGG + Intronic
1186390659 X:9155520-9155542 GTGGGGAAAGAGCAAGGGGCTGG - Intronic
1186496255 X:10014944-10014966 GAGGGGGAGGAGCAAGCGGAGGG + Intergenic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1187469655 X:19557672-19557694 GAGGGGAAATATCAAGATGCAGG - Intronic
1187843802 X:23515469-23515491 GAGGGGAAAGCGGAAGGGGAAGG - Intergenic
1187895566 X:23976853-23976875 GGGAGAAAATAGCAAGAGTATGG - Intergenic
1188196060 X:27235765-27235787 GAAGGGAAAAAACAATAGGATGG - Intergenic
1188209319 X:27401472-27401494 GAAGGGAAACTGCAAGAGAAAGG + Intergenic
1188589550 X:31817060-31817082 GAGGGGAGATAGCTAGATTAAGG - Intronic
1188895715 X:35665905-35665927 AAGGGGAAAGAGCAAGCAGAAGG - Intergenic
1189323122 X:40098002-40098024 GAGGGGGAGGAGGAAGAGGAGGG - Intronic
1189327295 X:40120575-40120597 GAGGGGTAGGAGCCAGAGGAGGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1189863632 X:45300300-45300322 GAGGGGAAAGAGCGACAGTATGG - Intergenic
1190328357 X:49220493-49220515 GTGGAGAAAGAGGAAGAGGAGGG - Exonic
1191767202 X:64710814-64710836 GCTGGGAAATAGGAAGATGATGG + Intergenic
1192018040 X:67353012-67353034 AAGGGCAAATTGCAAGTGGAGGG - Intergenic
1192430337 X:71107457-71107479 GAGGGTAGATGGAAAGAGGAAGG + Exonic
1192436444 X:71146106-71146128 GAGAAGAAAAAGGAAGAGGAGGG - Intronic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1192824366 X:74679742-74679764 CTGGGGAAATAACCAGAGGATGG - Intergenic
1193039144 X:76986564-76986586 GAGAGAAAAGAGGAAGAGGAGGG - Intergenic
1193271623 X:79535857-79535879 TAGGGGCAATAGCAAGAGGAGGG + Intergenic
1194156112 X:90391255-90391277 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194492280 X:94566917-94566939 GAGGAGGTATAGCAAGAGGTTGG - Intergenic
1195014848 X:100768202-100768224 GAGGGGGAAAAAAAAGAGGAAGG - Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195517526 X:105794390-105794412 GAGGGGGAGGAGGAAGAGGAGGG + Intergenic
1195581019 X:106502772-106502794 GAGGGGAAAAAGGGAGAGTACGG - Intergenic
1195581508 X:106509190-106509212 GAGGGAAAACAGGAAGAGTATGG - Intergenic
1195624605 X:106995127-106995149 GAGGGGGGATAGCTAGAGGTGGG - Intronic
1195672410 X:107481119-107481141 GAGAGGAAATGTCAAAAGGACGG + Intergenic
1195680578 X:107543129-107543151 GAAGGGCAATGGCAAGAGCATGG - Intronic
1195875629 X:109537239-109537261 GCTGGGAAATAGCGAGAGGCGGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196237531 X:113299952-113299974 GAGGGGAGATAGGAGGGGGAGGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198147413 X:133871307-133871329 GATGGGGATGAGCAAGAGGAAGG - Intronic
1199381357 X:147176328-147176350 GAGGGGAAAGAGGAAGGGTATGG + Intergenic
1199403131 X:147424066-147424088 GAGTGGTATAAGCAAGAGGATGG + Intergenic
1199477669 X:148263385-148263407 GAAGGGACAGAGCAAGATGATGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1200080533 X:153574069-153574091 GTGGGGGAAGAGCAAGGGGAAGG - Intronic
1200155359 X:153972099-153972121 GAGGGGAAGTGGCAAGATGGCGG - Intergenic
1200236841 X:154471904-154471926 GATGAGAAATAGCCAGAGGCAGG + Intronic
1200502458 Y:3968228-3968250 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1200795749 Y:7339751-7339773 GAGTGCAATTAGCAAGAGCAAGG + Intergenic
1201334401 Y:12864642-12864664 AAAGGGAAAAAGCAAAAGGAGGG - Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202377592 Y:24251202-24251224 GAGGAGGATTAGTAAGAGGAAGG + Intergenic
1202493189 Y:25418920-25418942 GAGGAGGATTAGTAAGAGGAAGG - Intergenic