ID: 1006824795

View in Genome Browser
Species Human (GRCh38)
Location 6:36926838-36926860
Sequence GCACCATGCCGTGATGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006824795_1006824799 26 Left 1006824795 6:36926838-36926860 CCTGCGGCATCACGGCATGGTGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 74
1006824795_1006824801 30 Left 1006824795 6:36926838-36926860 CCTGCGGCATCACGGCATGGTGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1006824801 6:36926891-36926913 CAGATGTGCCTCCGTTGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 84
1006824795_1006824800 27 Left 1006824795 6:36926838-36926860 CCTGCGGCATCACGGCATGGTGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1006824800 6:36926888-36926910 ACTCAGATGTGCCTCCGTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1006824795_1006824796 -5 Left 1006824795 6:36926838-36926860 CCTGCGGCATCACGGCATGGTGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1006824796 6:36926856-36926878 GGTGCCGAAGAAGACAGCTGTGG 0: 1
1: 0
2: 0
3: 11
4: 180
1006824795_1006824798 25 Left 1006824795 6:36926838-36926860 CCTGCGGCATCACGGCATGGTGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1006824798 6:36926886-36926908 TGACTCAGATGTGCCTCCGTTGG 0: 1
1: 0
2: 0
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006824795 Original CRISPR GCACCATGCCGTGATGCCGC AGG (reversed) Intronic
902399167 1:16148486-16148508 GGACCATGCCGTGGTGCCACCGG - Exonic
909482514 1:76141082-76141104 GCACCATGCTGGGATGTCCCTGG + Intronic
916592624 1:166206987-166207009 GCTCCATGCCGGGATGGTGCTGG - Intergenic
920499264 1:206476197-206476219 GCACAATGCCGTTCTCCCGCAGG - Exonic
923423336 1:233843082-233843104 CCACCATGCCCTGATGCAGCTGG - Intergenic
1067722106 10:48735884-48735906 GCACCATGCCGTGGTCCTTCAGG - Exonic
1073123024 10:101133444-101133466 GCACCAGGCCCTGCTGCCCCAGG - Intronic
1077048472 11:556188-556210 GCACCGTGACGTGGTGCCGCGGG + Exonic
1077181986 11:1220843-1220865 CCACCGTGCCGTGCTGCAGCGGG + Intergenic
1078540092 11:12206337-12206359 GCAGCGTGCCGTAATGCCGGTGG + Intronic
1081212713 11:40355670-40355692 GCACCATGCTGTGCTGCTGAGGG + Intronic
1092804969 12:12212925-12212947 GCACTTTGCCCAGATGCCGCAGG + Intronic
1098693080 12:73514648-73514670 GCACCATGCAGTGGTGACTCTGG + Intergenic
1102609523 12:114099268-114099290 GCACCCTGCCTAGATGCTGCCGG - Intergenic
1102775825 12:115518086-115518108 CCACCATGTCGTGATACGGCAGG + Intergenic
1103850412 12:123929361-123929383 GCACCCTGCCTTCAAGCCGCTGG + Exonic
1104809350 12:131611191-131611213 GCACCATGCCCTCATTCCACAGG - Intergenic
1127262318 15:57335329-57335351 GCACCAAGCCGTGAGGCCAGAGG - Intergenic
1129062530 15:72871778-72871800 GGACCATGTGGTGATGCTGCAGG + Intergenic
1130135884 15:81181625-81181647 GCCCCCTGCCGTGGTGCCTCTGG - Intronic
1130860232 15:87879391-87879413 GGACCATGCCATGTTGCCCCAGG - Intronic
1134449979 16:14357541-14357563 GCACCATGCCCTGTGGCCTCGGG + Intergenic
1135548467 16:23380857-23380879 GCACCATACAGTGAGGCCTCGGG - Exonic
1138280369 16:55768335-55768357 GCACCATGCCACGGTGCCCCTGG - Intergenic
1138288114 16:55825305-55825327 GCACCATGCCACGGTGCCCCTGG + Intronic
1138883854 16:61050689-61050711 GCACCCTGCTGTACTGCCGCCGG - Intergenic
1148223334 17:45880701-45880723 GCACCCGGCCGTGATGTTGCTGG - Intergenic
1149253984 17:54803747-54803769 GCACTATGCTGTGTTGCCTCTGG + Intergenic
1163265237 19:16216916-16216938 GCACCCCGCTGTGCTGCCGCTGG - Intronic
1166990434 19:46689674-46689696 TCACGATCCCGGGATGCCGCAGG + Exonic
1167201149 19:48066429-48066451 GCACCATGCCATGCAGCTGCCGG - Intronic
1168339783 19:55616288-55616310 GCACCACGCGGTGCTGCCGCAGG - Exonic
931802965 2:65776804-65776826 ACACCATGCCGTGGTTCTGCTGG - Intergenic
932332349 2:70904910-70904932 GCACAATGGCGTGCAGCCGCCGG + Intronic
943475862 2:188354216-188354238 GCACCATGCAGTGGTGACTCTGG - Intronic
948236336 2:236393807-236393829 GCACCAAGCTGTGCTGCCCCAGG - Intronic
949037375 2:241822078-241822100 GCACCATGACGTCATGGCGAAGG + Intergenic
1173640545 20:44598723-44598745 CCACCAAGCAGTGATGCAGCTGG + Exonic
1173743531 20:45419314-45419336 GCGCTATGCTGTGCTGCCGCGGG + Exonic
1179643919 21:42763950-42763972 GCAAGAGGCCGTGATGCCTCAGG - Intronic
951059507 3:18188715-18188737 GCACCATTCTGAGATGCCCCAGG + Intronic
961408898 3:126704297-126704319 TCCCCATGGCGAGATGCCGCAGG - Exonic
970498047 4:16647564-16647586 GTTCCATGCTGTGATGCCTCTGG + Intronic
973532970 4:51851452-51851474 CCACCATGCCATGTTGTCGCTGG - Intronic
980994616 4:139768720-139768742 GCACCATGGGGTGCTGCAGCAGG - Intronic
983649586 4:170025747-170025769 GCGCCGTGTCCTGATGCCGCAGG - Intronic
983869580 4:172809565-172809587 GCACCATCCTGGGATGCCTCAGG + Intronic
1006824795 6:36926838-36926860 GCACCATGCCGTGATGCCGCAGG - Intronic
1020580110 7:9987226-9987248 GCACCATGTTGTGATGCAACAGG + Intergenic
1029196596 7:98809847-98809869 TCACCATGTCATGATGCAGCAGG + Intergenic
1037363899 8:18102591-18102613 GCACCATGCCGTGAGGGATCTGG - Intergenic
1050177581 9:2884167-2884189 GCCCCATCCTGTGATGCAGCAGG - Intergenic
1053394647 9:37762092-37762114 GCACCATGCCGTACTGCCTGTGG - Exonic
1060536567 9:124393982-124394004 ACACCCTGCCCTGCTGCCGCAGG + Intronic
1062423756 9:136496781-136496803 GCACCATGCCGCTCTGCAGCCGG + Exonic
1189148768 X:38683526-38683548 GCACCATGGTATGATGCCACTGG - Intronic