ID: 1006824797

View in Genome Browser
Species Human (GRCh38)
Location 6:36926860-36926882
Sequence ACATCCACAGCTGTCTTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006824797_1006824810 27 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824810 6:36926910-36926932 GTGGGAGAACCCAGGGATGGGGG 0: 1
1: 0
2: 5
3: 43
4: 416
1006824797_1006824802 9 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824802 6:36926892-36926914 AGATGTGCCTCCGTTGGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 94
1006824797_1006824807 24 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824807 6:36926907-36926929 GGGGTGGGAGAACCCAGGGATGG 0: 1
1: 0
2: 5
3: 67
4: 653
1006824797_1006824808 25 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824808 6:36926908-36926930 GGGTGGGAGAACCCAGGGATGGG 0: 1
1: 0
2: 3
3: 31
4: 338
1006824797_1006824799 4 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 74
1006824797_1006824809 26 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824809 6:36926909-36926931 GGTGGGAGAACCCAGGGATGGGG 0: 1
1: 0
2: 2
3: 49
4: 435
1006824797_1006824806 20 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824806 6:36926903-36926925 CGTTGGGGTGGGAGAACCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 183
1006824797_1006824801 8 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824801 6:36926891-36926913 CAGATGTGCCTCCGTTGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 84
1006824797_1006824798 3 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824798 6:36926886-36926908 TGACTCAGATGTGCCTCCGTTGG 0: 1
1: 0
2: 0
3: 11
4: 88
1006824797_1006824800 5 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824800 6:36926888-36926910 ACTCAGATGTGCCTCCGTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 66
1006824797_1006824805 19 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824805 6:36926902-36926924 CCGTTGGGGTGGGAGAACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006824797 Original CRISPR ACATCCACAGCTGTCTTCTT CGG (reversed) Intronic
901167339 1:7229922-7229944 ACATCCAGATGTTTCTTCTTGGG + Intronic
903511116 1:23875505-23875527 ACAGCAACAGCTGTCTTCTGGGG + Exonic
903680314 1:25092056-25092078 ACATCCCCACCTGTCTCCTGGGG - Intergenic
904813066 1:33176427-33176449 TGATCCACTGCTGTCTTCTCTGG + Intronic
905878189 1:41446970-41446992 ACACGCACATCTGTGTTCTTAGG - Intergenic
906518167 1:46451787-46451809 ACCTCCTCAGCTGTATGCTTGGG + Intergenic
907140323 1:52180468-52180490 ACATCTTCAACTGGCTTCTTAGG - Intronic
911114239 1:94228298-94228320 AAATACTTAGCTGTCTTCTTAGG + Intronic
911183979 1:94885511-94885533 ACATCCTCAGCTGTTTTCAATGG + Intronic
912468210 1:109888481-109888503 ATATCCACAGCTGACTTCCCAGG - Intergenic
912637012 1:111305508-111305530 ACATGCACAGCTGCCTGCCTTGG + Intronic
913219751 1:116649895-116649917 ACATCCACACCTGTCTTCACAGG + Intronic
916170054 1:161995218-161995240 ACAGCCAAAGCTTTCTTCTCTGG + Intronic
917852383 1:179076474-179076496 AGATCCATATCTGTCTTGTTTGG - Exonic
919838613 1:201593426-201593448 ACATCTACCTCTGTTTTCTTTGG + Intergenic
920951027 1:210571766-210571788 AGATCTACAGCTGACATCTTTGG + Intronic
922811013 1:228415562-228415584 ACATCCCCAGCTGTCTTTGCTGG + Exonic
924934389 1:248755807-248755829 AAAAGCACAGCTGTCTTCTGGGG + Intergenic
1063006231 10:1973165-1973187 ACAGCTACAGCTCTCTTCTAGGG - Intergenic
1071387323 10:85134496-85134518 CCATCCTCAACTGTCTTCTTAGG + Intergenic
1071525498 10:86355736-86355758 ACAGACCCAGCTGTCTTCCTGGG + Intronic
1071777782 10:88808403-88808425 TGACCCACACCTGTCTTCTTAGG - Exonic
1074214436 10:111370450-111370472 ACATCCCCACTGGTCTTCTTTGG - Intergenic
1074955198 10:118381986-118382008 ACATCCCCAGTCGTTTTCTTTGG - Intergenic
1075569186 10:123526893-123526915 CCACCCAGAGCTGTCTTCATGGG - Intergenic
1076591757 10:131588400-131588422 GAAGCCACAGCTGTCCTCTTTGG + Intergenic
1076942278 10:133617841-133617863 ATATCCACAGCTGTCCTCATTGG + Intergenic
1078941488 11:16011542-16011564 ACATCCACAGCTGCCTCTTTTGG + Intronic
1079186636 11:18244265-18244287 ACTTCCACAGCTGGCTTCCCAGG + Intronic
1079483131 11:20904643-20904665 ACACCCAAAGCTTTCATCTTTGG + Intronic
1079814487 11:25039016-25039038 ACATTCACAGCTGTTTTCTGTGG + Intronic
1080220927 11:29902756-29902778 ACATCCACAGTGATTTTCTTGGG - Intergenic
1080600600 11:33818185-33818207 ACACTCACAGCTCCCTTCTTTGG - Intergenic
1081036079 11:38148438-38148460 ACATTCACAGCTGTAATCTGCGG + Intergenic
1084117930 11:67052684-67052706 ACCTCCACACCTGTCCTCTTCGG - Intergenic
1089389616 11:118091557-118091579 AGACCCTCGGCTGTCTTCTTTGG + Intronic
1093781003 12:23137311-23137333 ACATCCCCAACTCTCTTCCTTGG - Intergenic
1095183769 12:39178007-39178029 TGCTACACAGCTGTCTTCTTGGG - Intergenic
1098039260 12:66337556-66337578 ACATCCAGAACTGACTTCATGGG + Intronic
1099331755 12:81297631-81297653 ACATCTAAATATGTCTTCTTTGG + Intronic
1100051885 12:90459497-90459519 AGTTCCACAGCTCTCTTCTACGG - Intergenic
1101549098 12:105745353-105745375 AAAGCTACAGATGTCTTCTTGGG + Intergenic
1102635296 12:114318429-114318451 AAATCCAAGGCTGTCATCTTGGG + Intergenic
1105977511 13:25485519-25485541 ACATGAACATCTGTCTTCCTGGG + Intronic
1107553081 13:41494851-41494873 ACACCAACAGCTCTCATCTTTGG - Intergenic
1107920264 13:45199173-45199195 ATATTTACAGCTGTATTCTTTGG - Intronic
1108510681 13:51152985-51153007 ACAACCAGGGCTGGCTTCTTGGG + Intergenic
1110063600 13:71071919-71071941 ACCTGCACAGCTGTCTGCTATGG + Intergenic
1110403966 13:75128100-75128122 GAATCCACATCTGTCTTCATAGG + Intergenic
1110499177 13:76206133-76206155 ACATATACAGCTGTCTGATTAGG - Intergenic
1115396261 14:32911876-32911898 ACTTCCACAGTTGTATTCTGTGG - Intergenic
1116264412 14:42668280-42668302 ACATGCACAGCTGTCTGCCCTGG - Intergenic
1116295427 14:43100789-43100811 AGCTGCAGAGCTGTCTTCTTTGG + Intergenic
1120070365 14:80095992-80096014 ATTTCCACTGCTGTTTTCTTAGG - Intergenic
1121339413 14:93096256-93096278 GCAGCCACAGCTCTCTCCTTGGG + Intronic
1122420739 14:101575584-101575606 CCAGCCACAGCTCTCTTCCTTGG + Intergenic
1122932353 14:104940043-104940065 ACATCCTCTGCTGTCACCTTCGG + Exonic
1123029979 14:105446998-105447020 ACATCCCCAGCTCTCCTCCTTGG - Intronic
1123989643 15:25673906-25673928 ACACTCACAGCTGTCTCCCTCGG - Intergenic
1124723682 15:32135658-32135680 ACATCCTCAGCTGTTCTTTTGGG - Intronic
1131563201 15:93462220-93462242 TCTTCCACAGCTTTCTTCCTGGG + Intergenic
1132013302 15:98294377-98294399 AAATGCAAAGCTCTCTTCTTTGG - Intergenic
1134634768 16:15783954-15783976 AAACCCACAGGTGTCTTCCTTGG - Intronic
1135893765 16:26379983-26380005 GCCCCCACAGCTGTGTTCTTGGG - Intergenic
1141714716 16:85720153-85720175 ACATCCACTGCTGTCTCTATCGG - Intronic
1142412794 16:89924743-89924765 GCAGGCACAGCTGTCTCCTTGGG - Intronic
1142637897 17:1269305-1269327 GCATCCACAGCTGAGTTATTTGG - Intergenic
1144023629 17:11258806-11258828 TCAGCCACAGCTGAGTTCTTAGG + Intronic
1144140294 17:12341343-12341365 ACATCTGCAGCTGTTTCCTTGGG + Intergenic
1144370796 17:14589670-14589692 ACATCCTCACCTCTCCTCTTTGG - Intergenic
1144961754 17:19048292-19048314 ACAAGCACAGCTGTATTGTTTGG + Intergenic
1144973407 17:19126230-19126252 ACAAGCACAGCTGTATTGTTTGG - Intergenic
1145052288 17:19672145-19672167 TCATCCACAGCTGCTTTCATGGG + Intronic
1145121212 17:20261557-20261579 TCAGCAAAAGCTGTCTTCTTGGG - Intronic
1145846959 17:28047966-28047988 ACAGCCACAGCTGGATTCTTTGG + Intronic
1146064748 17:29625347-29625369 AAATCCATGGCTGTCTTCTATGG - Intergenic
1146737630 17:35252439-35252461 ATATCCTCAGCTGTCCTTTTTGG - Intronic
1150019059 17:61592310-61592332 ACATGCTCAGGTCTCTTCTTAGG - Intergenic
1151074509 17:71255686-71255708 ACACCCACAGCTATCTCCATTGG - Intergenic
1153421481 18:4911178-4911200 ACATGCACAACTGCCTTCTGTGG - Intergenic
1159921158 18:74228422-74228444 ACATCCACAGTTGGCTCCATGGG - Intergenic
1161752582 19:6109227-6109249 ACGTCCGCAGCTCTCCTCTTAGG - Intronic
1161870175 19:6863835-6863857 ACATCCAAACCTGACTTCTGAGG - Intergenic
1163907685 19:20161338-20161360 ACATCCCCAGTTCTCCTCTTTGG + Intergenic
1164923351 19:32106231-32106253 ATTCCCACAACTGTCTTCTTTGG + Intergenic
1165120072 19:33553175-33553197 CCATCCACATCTCTCTTCTAGGG - Intergenic
1165200614 19:34141324-34141346 TTATCCACAGCTCTCTGCTTAGG + Intergenic
1165638988 19:37368198-37368220 ACATCTAGAGCTGTCATCTCAGG - Intronic
1166897898 19:46035723-46035745 ACTTCCACAGCTGCAGTCTTGGG + Intergenic
1168097365 19:54123361-54123383 ACCTCCTCAGGTCTCTTCTTAGG - Intronic
925185719 2:1844938-1844960 ACATCCACAGTTCATTTCTTAGG + Intronic
926713243 2:15900822-15900844 ACTTCTACAGCTGTCTTCAAGGG - Intergenic
927483611 2:23473459-23473481 ACATGCACAGCTGAGTTCTCTGG - Intronic
930462663 2:51703094-51703116 AGCTCCTCAGTTGTCTTCTTTGG + Intergenic
933720679 2:85395501-85395523 ACAACCACAGCCCTCTTCCTAGG - Intronic
933888324 2:86741026-86741048 ACATCCACAGCAGTGTTTCTCGG + Exonic
933921854 2:87055679-87055701 ACATCCACAGCAGTGTTTCTCGG - Intergenic
936104440 2:109613490-109613512 ACATCCACAGCGGTGTTTGTGGG - Intronic
939052715 2:137327843-137327865 ACATCCACAGATGTGGCCTTTGG + Intronic
939172158 2:138708980-138709002 ACAGCAAAAGCTGTGTTCTTTGG + Intronic
939778467 2:146414556-146414578 GCATCCAGAGCTGTCTTGCTGGG + Intergenic
940024536 2:149192210-149192232 ACATCTTCATCTGTCTTCCTGGG - Intronic
940581827 2:155589870-155589892 ACATTCACAACTGCCTTATTTGG - Intergenic
942292405 2:174486343-174486365 ACTTCCACAGCTGCCTTCCCAGG - Intronic
942564447 2:177252370-177252392 ATGTCCACATCTGTCTGCTTGGG + Intronic
944529408 2:200652547-200652569 ACAGCCCCAGCTGACCTCTTTGG - Intronic
945785109 2:214224617-214224639 GCAAACACAGCTGTGTTCTTAGG - Intronic
945790059 2:214293663-214293685 AGCTCCACAGCTGCCTTCCTAGG - Intronic
946125343 2:217557809-217557831 ACATCCACAGCCACCTCCTTTGG + Intronic
947702253 2:232244270-232244292 AAATCCCCAGCTGTGTTCTGGGG + Intronic
1171161348 20:22926770-22926792 ACAACCACAGCTCACCTCTTTGG + Intergenic
1174896373 20:54453800-54453822 ACCTGCACAGCTGTCTTCTGTGG + Intergenic
1175591977 20:60200552-60200574 ACCTGCACAGCTGTGTGCTTGGG + Intergenic
1176844044 21:13862955-13862977 ACCTCCACAGTTGTCCTCATGGG + Intergenic
1177151538 21:17460017-17460039 ACATCAACAGTTCTCTTTTTGGG - Intergenic
1178526028 21:33330104-33330126 ACGTGCACAGCTGTCTGCTAAGG - Intronic
1179919158 21:44498176-44498198 TCATCTGCAGCTGTCTGCTTAGG + Exonic
1180645735 22:17337332-17337354 AGCTCCACACCTGTCTTCCTTGG + Intergenic
1180821040 22:18827936-18827958 ACATCCATACCTGTCTTCACAGG + Intergenic
1181191937 22:21148109-21148131 ACATCCATACCTGTCTTCACAGG - Intergenic
1181207260 22:21262401-21262423 ACATCCATACCTGTCTTCACAGG + Intergenic
1182514542 22:30846678-30846700 AGATACACAGATATCTTCTTCGG - Intronic
1185165609 22:49260556-49260578 ACATCTCCAGCTTTCTTCTATGG + Intergenic
1203219660 22_KI270731v1_random:33015-33037 ACATCCATACCTGTCTTCACAGG - Intergenic
1203271167 22_KI270734v1_random:53812-53834 ACATCCATACCTGTCTTCACAGG + Intergenic
951842604 3:27050046-27050068 ACTTCCACAGCTATACTCTTTGG - Intergenic
952317491 3:32243790-32243812 TCATGCACAGCTGTGTTGTTTGG - Intronic
955005147 3:54961693-54961715 TCATGGACAGCAGTCTTCTTGGG + Intronic
956639854 3:71405279-71405301 ACATTCACACCTGCCTTCTGAGG - Intronic
956838400 3:73114731-73114753 ACACACACAGCAGTCTGCTTGGG + Intergenic
960773706 3:121225252-121225274 ACATCCCCAGCTGTAATCTCTGG + Intronic
962152486 3:132907606-132907628 ACATGCCCAGGTGTCTTCGTGGG - Intergenic
964005919 3:151828803-151828825 ACTTCCACATCTGTAGTCTTTGG - Intergenic
967369278 3:188725413-188725435 CCTTCCACAGATGTCTTCATAGG - Intronic
967442852 3:189528907-189528929 TCGTCCACTTCTGTCTTCTTTGG + Intergenic
969002756 4:3995513-3995535 ACATACCCACCTGTCATCTTTGG + Intergenic
969200607 4:5601829-5601851 TCATGCACAGCTGCCATCTTGGG - Intronic
976807427 4:89063560-89063582 ACTGCCACAGCTGGCTTGTTGGG + Intronic
977918287 4:102617456-102617478 AAATCCAAAGCTTTCATCTTAGG - Intergenic
978401149 4:108332449-108332471 ACATACGCAGATGCCTTCTTAGG + Intergenic
979863431 4:125723274-125723296 TCAGCCAAAGCTGTCTTCTCAGG + Intergenic
982623617 4:157736034-157736056 ACGACCACAGCCTTCTTCTTGGG - Intergenic
984182828 4:176506497-176506519 ACAAACAAAACTGTCTTCTTGGG - Intergenic
984557555 4:181233635-181233657 ACGTCCACATCTGTTTTTTTAGG + Intergenic
985121831 4:186651318-186651340 ACATACACAGCTTTGTTCTGGGG - Intronic
986257728 5:6114561-6114583 AGGACCACAGCTTTCTTCTTGGG + Intergenic
987556917 5:19464170-19464192 ACATCTTCAGTGGTCTTCTTGGG + Intergenic
989398084 5:40979999-40980021 ACATCCTCAAGTATCTTCTTCGG - Intronic
990341532 5:54827949-54827971 ACCTCCACTGCTGCTTTCTTGGG - Intergenic
991708590 5:69384286-69384308 ATACCGACAGCTGTGTTCTTAGG + Intronic
993703559 5:91145010-91145032 ACCTCCACAGCTGAGTACTTTGG + Intronic
994013325 5:94934895-94934917 CAATCCACAGCTTTCTTCATTGG - Intronic
994511385 5:100708813-100708835 ACATTCACAACTGTCCTCTGTGG + Intergenic
996347480 5:122502547-122502569 TCTTGCACACCTGTCTTCTTGGG - Intergenic
996362660 5:122667711-122667733 ACTTCCAAAACTGTATTCTTTGG - Intergenic
997601085 5:135139017-135139039 GGAACCACAGATGTCTTCTTGGG - Intronic
998939389 5:147264293-147264315 TCCTGCACAGCTGTCTTCCTGGG - Intronic
1000569676 5:162896096-162896118 CCATCCACAGCTTTTTTCTCTGG - Intergenic
1001145508 5:169180633-169180655 ACATCAACAGCTCTCTACTCAGG + Intronic
1001883292 5:175264574-175264596 ACATGCACAGCTGTCTGCCATGG - Intergenic
1004379723 6:15122320-15122342 ACATCCACAGTTATCTCCTCAGG + Intergenic
1004447720 6:15715961-15715983 ACATCCTCAGCTGGTCTCTTAGG + Intergenic
1005497298 6:26398920-26398942 ACATCAACAGATGTCTGCTGTGG - Intergenic
1006658712 6:35620592-35620614 CCATACCCAGCTGTGTTCTTTGG - Intronic
1006824797 6:36926860-36926882 ACATCCACAGCTGTCTTCTTCGG - Intronic
1007262898 6:40576141-40576163 GCAGCCATACCTGTCTTCTTTGG - Intronic
1011442317 6:87399826-87399848 ACATCCCAGGCTCTCTTCTTAGG + Intergenic
1015940761 6:138449316-138449338 GCATCCACAGAGGTGTTCTTAGG + Intronic
1020979708 7:15052638-15052660 GCCTCCACAGCTGCTTTCTTGGG + Intergenic
1021807419 7:24371141-24371163 ACAGCCACAGCTATTTGCTTAGG + Intergenic
1022260562 7:28700377-28700399 ACACCCTCAGCTGACTTCCTTGG + Intronic
1022754769 7:33275499-33275521 CCATCCAAAGCTGTTCTCTTTGG + Intronic
1023856449 7:44187105-44187127 ACAACCACAGCTGACGTCTTGGG + Intronic
1026208527 7:68280461-68280483 CCATCCACAGCTGCCATCTAGGG + Intergenic
1026734900 7:72943168-72943190 GGCTCCACTGCTGTCTTCTTCGG + Exonic
1027968088 7:85039767-85039789 ACAGCCACACCTGTCTTTGTAGG + Intronic
1028426312 7:90693511-90693533 ACATGCACGGCTGTGTTGTTGGG + Intronic
1030419701 7:109293075-109293097 TCAACCACAGCTGTATTCTAAGG - Intergenic
1032189564 7:129756369-129756391 ACACCCTCAGCTGTTTTCTATGG - Exonic
1033364394 7:140660440-140660462 ACAACCAGTGATGTCTTCTTTGG - Intronic
1034956802 7:155339953-155339975 ATATTCACAGATGCCTTCTTGGG - Intergenic
1035495986 7:159326572-159326594 GCATCTACAGCTGACTTCTCTGG + Intergenic
1036686704 8:10916490-10916512 ACATCCACATCTGTCTTTGTGGG - Intronic
1037287530 8:17317406-17317428 ACTGCCCCAGCTGTCCTCTTAGG - Intronic
1037955853 8:23057863-23057885 ATAGCCACAGCAGTTTTCTTAGG + Intronic
1038776788 8:30538590-30538612 TCATCTACATTTGTCTTCTTGGG + Intronic
1039655563 8:39401005-39401027 ACAGCCACTGCTGTATTTTTAGG + Intergenic
1040883657 8:52235806-52235828 ACATGCACAACTGTCAACTTTGG + Intronic
1041787735 8:61654238-61654260 ACATACCCTGCTGTCTTATTAGG - Intronic
1044170268 8:89042908-89042930 ACATTCACAAATGTCTTCTGAGG - Intergenic
1044781098 8:95744303-95744325 CCTGCCACAGCTGTCTTCTGGGG + Intergenic
1045695887 8:104808417-104808439 ACATCCACACTTGTCTTCTTAGG - Intronic
1047238967 8:123068334-123068356 ACATTCACAGCAGTGTTATTCGG + Intronic
1048497269 8:134945802-134945824 ACATCCACTGGTGTCTGGTTTGG + Intergenic
1049395650 8:142398996-142399018 ACAGCCACAGCTGGCTTCTGAGG + Intronic
1050961202 9:11734183-11734205 ACATTCAAAGCTGTCTTTATTGG + Intergenic
1051361068 9:16282126-16282148 ACATCCACTTCTGGCTTCTGTGG + Intergenic
1052449088 9:28603622-28603644 TCTTCCAGAGCTGTCTCCTTTGG + Intronic
1052636749 9:31116231-31116253 ACATATACATCTGTGTTCTTAGG - Intergenic
1053221722 9:36318202-36318224 ACAGCCTCAGGTTTCTTCTTCGG + Intergenic
1053287242 9:36857818-36857840 ACATTCTCAGCTGCCTTGTTGGG - Intronic
1053421288 9:37980823-37980845 ACATCCCCAGCTGAGCTCTTGGG + Intronic
1055614120 9:78053645-78053667 ACAGCCTCAGCTGACTTCCTGGG + Intergenic
1057175004 9:92989785-92989807 TCATCTATAGCTGTCTGCTTAGG + Intronic
1058142527 9:101372395-101372417 ACATCCATAGCTTTGTACTTAGG + Intronic
1062644839 9:137542575-137542597 ACCTCCACGTCTGTCTTCTCGGG - Intronic
1187737150 X:22316685-22316707 TTATTCACAGCTTTCTTCTTTGG - Intergenic
1188444442 X:30241913-30241935 ACTTCCTCAGCTGGCTTCTCAGG + Intergenic
1188470445 X:30532127-30532149 ACATGCACAGCTTTGTTCTATGG + Intergenic
1188881139 X:35493286-35493308 ACATGCACAGTGCTCTTCTTAGG - Intergenic
1190516797 X:51232179-51232201 ACATGCTTAGTTGTCTTCTTTGG + Intergenic
1190655275 X:52606650-52606672 CCTTCCTCTGCTGTCTTCTTGGG + Intergenic
1191667860 X:63721722-63721744 ACATCGTCAGCTGTTTTCCTGGG - Intronic
1194316604 X:92384636-92384658 AGATTCAAAGCTGTCTTCTTGGG + Intronic
1194948594 X:100097855-100097877 ACATCCACTGGGGTCTACTTGGG + Intergenic
1196766372 X:119248930-119248952 TCATTCACTGCTGTCGTCTTTGG + Intergenic
1196845762 X:119895740-119895762 ACACCCAAAGCTGACTTCTTTGG - Intergenic
1199266696 X:145836456-145836478 TCATCCACAGATGGCCTCTTAGG + Intergenic
1200134221 X:153867100-153867122 ACATCCACAGGGTTCTTCTCTGG + Exonic
1200624780 Y:5497956-5497978 AGATTCAAAGCTGTCTTCTTGGG + Intronic
1201400522 Y:13599555-13599577 GCATCCACACCTGTCCTCATGGG - Intergenic
1201613185 Y:15865911-15865933 TTATCCATAGCTATCTTCTTAGG - Intergenic