ID: 1006824799

View in Genome Browser
Species Human (GRCh38)
Location 6:36926887-36926909
Sequence GACTCAGATGTGCCTCCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006824797_1006824799 4 Left 1006824797 6:36926860-36926882 CCGAAGAAGACAGCTGTGGATGT 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 74
1006824795_1006824799 26 Left 1006824795 6:36926838-36926860 CCTGCGGCATCACGGCATGGTGC 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006824799 Original CRISPR GACTCAGATGTGCCTCCGTT GGG Intronic
901186687 1:7378100-7378122 GACTCAGATGTGTCTGAGTGAGG - Intronic
908535759 1:65075521-65075543 GCCTCTGATGTGCCTCCCTTTGG + Intergenic
911742365 1:101400956-101400978 GACTGAGATGTGACTGCTTTGGG - Intergenic
913582654 1:120242046-120242068 GATTCAGAAGTACCTCCTTTAGG + Intergenic
913625519 1:120656314-120656336 GATTCAGAAGTACCTCCTTTAGG - Intergenic
914289926 1:146263683-146263705 CCCTCAGCTGTGCCTCAGTTTGG - Intergenic
914550969 1:148714466-148714488 CCCTCAGCTGTGCCTCAGTTTGG - Intergenic
914564583 1:148853539-148853561 GATTCAGAAGTACCTCCTTTAGG + Intronic
914608243 1:149276703-149276725 GATTCAGAAGTACCTCCTTTAGG - Intergenic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
921062965 1:211601416-211601438 AACTCAAATGTCCCTCGGTTGGG - Intergenic
1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG + Intergenic
1069610286 10:69768232-69768254 GACTCAGTTCTGCCTTCGTTGGG - Intergenic
1069825263 10:71251015-71251037 GACTCAGATCTGGCTCAGTTGGG + Intronic
1074039217 10:109771612-109771634 GACTCAGAGCTGCCTCTGTGTGG - Intergenic
1074390110 10:113049995-113050017 GGCTCAGATGTGGCACAGTTGGG - Intronic
1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077560578 11:3257809-3257831 GACTCAGGTGGGACTCAGTTAGG - Intergenic
1084426656 11:69087723-69087745 GACTCAGATGAGCCTCAGGATGG - Intronic
1085805033 11:79627923-79627945 GACTCAGATGTGACTTTGTAAGG - Intergenic
1086756690 11:90572826-90572848 AATTCAGATGTGACTCCATTTGG + Intergenic
1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG + Intergenic
1093879473 12:24387515-24387537 GACTCAGATGTGCATTCCCTGGG + Intergenic
1095883608 12:47165230-47165252 AACTCAGATATGCCTCTGGTGGG - Intronic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1104112023 12:125713093-125713115 GACTCAGCTGTGGATCCTTTGGG + Intergenic
1107031520 13:35858624-35858646 CACTCGGATCTGCCTCCTTTAGG + Intronic
1113440504 13:110324568-110324590 GAGTCAAACGTGCATCCGTTCGG - Intronic
1114705387 14:24721217-24721239 TACTCATATGTGCCTCACTTTGG - Intergenic
1116756275 14:48952600-48952622 GACACAGAAGTGACTCCTTTAGG - Intergenic
1117391080 14:55263458-55263480 GGCTCAGATGTTCCTACTTTTGG + Intergenic
1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG + Intergenic
1120850903 14:89168796-89168818 GACTGTGATGTGTCTCCGTATGG - Intronic
1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG + Intergenic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1130063274 15:80584671-80584693 CACTCAGATGTGCCCACGCTGGG - Intronic
1134409894 16:13995164-13995186 GACTCAGATGTCCCCCAGTAAGG + Intergenic
1135544759 16:23358175-23358197 GACTCAAATGGGGCTCCTTTTGG - Intronic
1139576584 16:67846326-67846348 GACTCAAATGTCCCTCAGGTGGG - Intronic
1145235962 17:21208640-21208662 CACTCAGATTTGCCTCTGCTGGG - Intronic
1152587162 17:81194252-81194274 GACTCAGCTGTGCTTCGGGTTGG - Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925980134 2:9169903-9169925 GACTCAGATCTGCTGCCCTTGGG - Intergenic
928654855 2:33439948-33439970 TTCTCAGATGTGTCTCCATTGGG - Intronic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
935648911 2:105365490-105365512 AACTCAGATGAACTTCCGTTAGG + Intronic
936781931 2:116043782-116043804 GACTCAGATGTACAACAGTTAGG + Intergenic
937252251 2:120532301-120532323 GACCGAGATGTGTCTCCCTTTGG - Intergenic
937394939 2:121526378-121526400 GGCTCAGATGTGCCCCAGTAGGG - Intronic
941425316 2:165337516-165337538 GACTAAGATGTGCCTAAGTATGG - Intronic
944796027 2:203186301-203186323 TACTCAGATGTGGCTCCTCTTGG + Intronic
1175925532 20:62469524-62469546 GTCTCAGACGTGGCTCCGTCGGG - Intronic
1178212298 21:30549880-30549902 AATTCAGATGTGACTCTGTTTGG + Intronic
1179353279 21:40633690-40633712 TGCTCAGATGGGCCTCCGTCAGG + Intronic
1181459817 22:23079288-23079310 GGCTCAGATGTCCCTTCCTTAGG - Intronic
1183031731 22:35111485-35111507 GACTGAGATGTTCATCCTTTTGG + Intergenic
953849594 3:46455609-46455631 GACTCAGCTGTGCCTCCCAAGGG + Intronic
953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG + Exonic
954636817 3:52075402-52075424 GACTCAGATGGGCCCACTTTGGG + Exonic
960983659 3:123256604-123256626 GAATTAGATGTGTCTCCATTGGG + Intronic
968597212 4:1491717-1491739 GACTCAGCTGTGCCACCATCAGG + Intergenic
975164869 4:71167160-71167182 GACTCACATGTGCCTGTGTTGGG + Intergenic
986769161 5:10956175-10956197 GACTCAGCTGTGTCTCTGCTGGG - Intergenic
1002813028 6:652287-652309 TACTAAGATGTGTTTCCGTTGGG - Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007854050 6:44835651-44835673 TACTCAGTTGAGCCACCGTTGGG + Intronic
1012260843 6:97085596-97085618 GACTCAGATGTGACCACGTTAGG - Intronic
1014213059 6:118727004-118727026 GACTCAAATGTGCCATGGTTTGG + Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1024146662 7:46523671-46523693 GGTTCAAATGTGCCCCCGTTGGG - Intergenic
1032451951 7:132039361-132039383 GATTCAAATGTTCCTCCTTTAGG + Intergenic
1033660491 7:143398880-143398902 GACTCAGCTCTCCCTGCGTTGGG - Exonic
1033987978 7:147250015-147250037 GATTCTGATGTGCCTCCAATGGG - Intronic
1035420480 7:158725479-158725501 AACTAAGATGTGCCTGCGTGTGG + Intergenic
1036940764 8:13049602-13049624 GGATCAAATGTGCCTCTGTTGGG - Intergenic
1037312473 8:17571407-17571429 GACTCAGATAGGCTTCCTTTTGG + Intergenic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1047620527 8:126602135-126602157 GTCTCATATGTGCCTCACTTAGG + Intergenic
1185801799 X:3017801-3017823 GACTCAGATGTGCCACAGTAAGG - Intronic
1189179965 X:38994490-38994512 GATTCAGAAGTGGCTCAGTTGGG + Intergenic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic