ID: 1006826133

View in Genome Browser
Species Human (GRCh38)
Location 6:36937680-36937702
Sequence TGGAGACTGGCAGGCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006826133_1006826143 14 Left 1006826133 6:36937680-36937702 CCCTCTGTGCCTGCCAGTCTCCA No data
Right 1006826143 6:36937717-36937739 AGAGCAGAGCAAAGCATCAAGGG No data
1006826133_1006826142 13 Left 1006826133 6:36937680-36937702 CCCTCTGTGCCTGCCAGTCTCCA No data
Right 1006826142 6:36937716-36937738 CAGAGCAGAGCAAAGCATCAAGG No data
1006826133_1006826145 28 Left 1006826133 6:36937680-36937702 CCCTCTGTGCCTGCCAGTCTCCA No data
Right 1006826145 6:36937731-36937753 CATCAAGGGCTGTGCGTGATGGG No data
1006826133_1006826144 27 Left 1006826133 6:36937680-36937702 CCCTCTGTGCCTGCCAGTCTCCA No data
Right 1006826144 6:36937730-36937752 GCATCAAGGGCTGTGCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006826133 Original CRISPR TGGAGACTGGCAGGCACAGA GGG (reversed) Intergenic
No off target data available for this crispr