ID: 1006828559

View in Genome Browser
Species Human (GRCh38)
Location 6:36954889-36954911
Sequence CCGGGCCCAGGTATCCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006828551_1006828559 25 Left 1006828551 6:36954841-36954863 CCTCACAGATGAGGAGAAACGTT 0: 1
1: 0
2: 1
3: 10
4: 205
Right 1006828559 6:36954889-36954911 CCGGGCCCAGGTATCCCCGACGG 0: 1
1: 0
2: 0
3: 7
4: 81
1006828550_1006828559 26 Left 1006828550 6:36954840-36954862 CCCTCACAGATGAGGAGAAACGT 0: 1
1: 0
2: 0
3: 6
4: 140
Right 1006828559 6:36954889-36954911 CCGGGCCCAGGTATCCCCGACGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006828559 Original CRISPR CCGGGCCCAGGTATCCCCGA CGG Exonic
902810531 1:18885535-18885557 CCGGGCCCAGATCTTCCTGAAGG - Exonic
904500302 1:30909054-30909076 CCGGGCCCTGGTATCCCACGCGG - Intergenic
905460310 1:38118540-38118562 CCAGGCCCTGGTGTCCCTGAAGG + Intergenic
906058965 1:42936162-42936184 CCTGGCCCAGGGATCCCTGCTGG - Intronic
906140933 1:43532916-43532938 GCGGGCCCAGGTATGCGAGAGGG - Intronic
907411663 1:54287656-54287678 CTGGGGCCAGGTTTCCCAGAGGG + Intronic
912381037 1:109248513-109248535 CCAGGCCCAGGCATCCCCCCAGG + Intergenic
914746982 1:150508333-150508355 CTGGGTCCAGGCATCCCAGACGG + Intronic
915936556 1:160093169-160093191 CCGGGCCCAGGTGCCCCCGCAGG + Exonic
916840795 1:168598423-168598445 TCGGTCCCAGGTATCCCAGTAGG + Intergenic
1062768369 10:82010-82032 CAGGGCCCAGGGATGCCCTAGGG + Intergenic
1070645005 10:78195594-78195616 ACGGGCCCAGGTTTCCCCAGTGG - Intergenic
1074816238 10:117142729-117142751 CAGGACCCAGGTAGCCCCTAAGG + Intergenic
1074865338 10:117541745-117541767 CCGGTCCCAGATATTCCAGAAGG + Intergenic
1076545734 10:131244800-131244822 GTGGGCCCAGGTGTCCCCCAGGG + Intronic
1076987588 11:250157-250179 CCTGACACAGGTAGCCCCGATGG - Intronic
1081749766 11:45501677-45501699 CCGGCCCCAGCTCTGCCCGATGG + Intergenic
1094524489 12:31222725-31222747 CCAGGACCAGGAATCCCCAAAGG + Intergenic
1094816428 12:34190687-34190709 CTGGGCCCAGGTTTCCCTGGTGG + Intergenic
1100581325 12:95942934-95942956 CCGGGCAGAGGTTTCCCCCATGG + Exonic
1114269418 14:21091971-21091993 CCGGGCCCAGGTTTCCTCCTCGG + Exonic
1118836291 14:69480317-69480339 CCCAGCCCAAGTATCCCTGAGGG - Intergenic
1120019082 14:79507902-79507924 CTGGGCCCAGGCATCCCAGTAGG - Intronic
1122027775 14:98889970-98889992 CCTGGCCCGGGTAGCCCCGGAGG + Intergenic
1128695274 15:69757316-69757338 CTGGGCCCAGGCATCCCCTGGGG + Intergenic
1129539330 15:76338107-76338129 CCGGGCCCGGGAATGCCCGCAGG + Intronic
1129964228 15:79719652-79719674 CCTGGGCCAGGTATCCCCACTGG - Intergenic
1132464902 16:72782-72804 CCAGCCCCAGGTGTCCCCGCAGG - Intronic
1132517943 16:374554-374576 CAGGCACCAGGTATCCCCGGGGG - Intronic
1132644062 16:990760-990782 CTGGGCCCGGGAATCCCGGACGG - Intergenic
1132648032 16:1007991-1008013 CCGGGCCCAGGCTTCCCGGTTGG + Intergenic
1132692135 16:1186311-1186333 CTGGGCCCAGGGAGCCCTGAAGG + Intronic
1132759574 16:1502211-1502233 CCGGGCCCAGGGCTTCCCGGTGG - Intronic
1142034390 16:87854662-87854684 CCTGGCCCAGCTGTCCCCGCAGG - Intronic
1142177574 16:88652034-88652056 CCCGGCCCAGGTGTCTCGGAGGG - Exonic
1142640177 17:1280899-1280921 CCGGGGCCAGGCTCCCCCGAGGG + Intronic
1150267536 17:63841116-63841138 CTGGGCCCATGAATCCCCAACGG + Intronic
1152961252 18:81835-81857 CAGGGCCCAGGGATGCCCTAGGG + Intergenic
1163266462 19:16225314-16225336 CTGGGCCCAGGTATCCAAGTCGG + Intronic
926335142 2:11857281-11857303 CCTGGCCCTGGTATTCCCCATGG - Intergenic
927639817 2:24839522-24839544 CAGAGCCCAGGTCTCCCCAAAGG - Intronic
937065430 2:119013342-119013364 GCAGGCCCAGGTAGCCCCAAAGG - Intergenic
942277415 2:174333417-174333439 CAGTGCCCAGGTCTGCCCGAGGG + Intergenic
946152724 2:217787324-217787346 CCGGGCCCAAGCCTCCCCGACGG - Intergenic
949034557 2:241810555-241810577 CAGGGCCCAGGGATCCCCCACGG + Intronic
1171820102 20:29828237-29828259 CTGGGCCCAGGTTTCCCTGGTGG + Intergenic
1174078775 20:47956537-47956559 CCTGGCCCAGGTTCCCTCGATGG - Intergenic
1174115808 20:48225686-48225708 CCTGGGCCAGGTATCCACGCAGG - Intergenic
1176370329 21:6058473-6058495 CCGGGCCCAGGTGACACCGTGGG + Intergenic
1179753190 21:43480068-43480090 CCGGGCCCAGGTGACACCGTGGG - Intergenic
1179982898 21:44905734-44905756 CAGGGCCCAGGTGTCCCTGGGGG - Intronic
1180324099 22:11352925-11352947 CTGGGCCCAGGTTTCCCTGGTGG + Intergenic
954177012 3:48852686-48852708 CCAGGGCCAGGTGTCCCTGAGGG - Intergenic
954617666 3:51977894-51977916 CCGGTCCCAGGTAGCCCTGCTGG + Exonic
957086828 3:75687595-75687617 CTGGGCCCAGGTTTCCCTGGTGG - Intergenic
961000644 3:123371847-123371869 CAGGGCCCAGCTATCCCTGAGGG - Intronic
961420117 3:126796612-126796634 CCTGGCCCAGATATGCCCCAGGG + Intronic
961537126 3:127577025-127577047 CCGGGCCGTGGTATCCATGACGG - Exonic
967325888 3:188239200-188239222 CAGGGCCCAGGCATCCCTGCAGG - Intronic
967843849 3:194029259-194029281 CTGGGACCAGGTATCTCCCATGG + Intergenic
968235851 3:197029707-197029729 CCGGCCCCAGCCAGCCCCGACGG - Exonic
968472038 4:786772-786794 ACTGGCCCAGGAACCCCCGAAGG + Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
986712758 5:10499708-10499730 CTGGGCCCAGGTATCCTGGACGG + Intergenic
997454668 5:134007698-134007720 CCAGACCCAGGTCTCCCCAAGGG - Intergenic
998203278 5:140142299-140142321 CCTGCCCCAGGTCTCCCCGTTGG + Intergenic
1006447591 6:34088531-34088553 CAGGGCACAGGTCTGCCCGAAGG + Intronic
1006828559 6:36954889-36954911 CCGGGCCCAGGTATCCCCGACGG + Exonic
1011564317 6:88658451-88658473 CAGGGGCCAGGTAGCCCCGCTGG + Intronic
1017825386 6:158077860-158077882 CAGGACCCAGGAATCCCAGAAGG - Intronic
1017914062 6:158818677-158818699 GCGGGCCCAGGGATACCCGGCGG + Intronic
1018743020 6:166744615-166744637 CCAGGCCCAGACACCCCCGAGGG + Intronic
1018803368 6:167240135-167240157 CCGGGAGCAGGTATCTCCGCAGG - Intergenic
1019576610 7:1740651-1740673 CCGGGTCCAGGAGTCCCCAAGGG - Intronic
1026806919 7:73434550-73434572 CCGGGCCCAGGTCTCCGGGAGGG - Exonic
1029436253 7:100565543-100565565 CCGGGCCCGGGTAAGCTCGATGG - Exonic
1032720082 7:134543974-134543996 CCTGGCCCAGGTAATCCAGAGGG + Intergenic
1034979764 7:155468161-155468183 CCGGGACCCGGTAGCCCTGAGGG + Intergenic
1035173501 7:157033909-157033931 CTGGGCCCAGGTCCCACCGAGGG - Intergenic
1045063598 8:98427417-98427439 CCCGGCCCAGGTCTCCCTGCCGG - Intronic
1047614933 8:126556333-126556355 AAGGGCCCAGGAATCCCAGATGG + Exonic
1049687798 8:143945906-143945928 GCGGGCCCAGGCAGCCCTGAGGG + Intronic
1053750292 9:41246727-41246749 CTGGGCCCAGGTTTCCCTGGTGG - Intergenic
1054335519 9:63804543-63804565 CTGGGCCCAGGTTTCCCTGGTGG + Intergenic
1060892888 9:127199593-127199615 CTGGGCCAAGGGATCCTCGAGGG - Intronic
1062736906 9:138142301-138142323 CAGGGCCCAGGGATGCCCTAGGG - Intergenic
1203375454 Un_KI270442v1:371993-372015 CTGGGCCCAGGTTTCCCTGGTGG + Intergenic
1198205415 X:134460437-134460459 CCGGGCCCAGGGAACCCCGCAGG + Intronic
1199878602 X:151954915-151954937 CCTAGCCCAGGTAGCCCTGAGGG - Exonic