ID: 1006829795

View in Genome Browser
Species Human (GRCh38)
Location 6:36961864-36961886
Sequence GCATCCTCCTGACCTCCTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006829788_1006829795 -10 Left 1006829788 6:36961851-36961873 CCCCCTCCCCGCAGCATCCTCCT 0: 1
1: 0
2: 6
3: 102
4: 1003
Right 1006829795 6:36961864-36961886 GCATCCTCCTGACCTCCTGTAGG 0: 1
1: 0
2: 0
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006829795 Original CRISPR GCATCCTCCTGACCTCCTGT AGG Exonic
900963710 1:5942870-5942892 GCATCCTCCTGAGCCTCTGGGGG - Intronic
900984720 1:6066631-6066653 ACATCCTCCTGCCCTCCCCTGGG + Intronic
901006342 1:6173465-6173487 CCCTCCTCCTGACCTCCTGGTGG - Intronic
902296976 1:15474307-15474329 TCAAACTCCTGACCTCGTGTTGG - Intronic
902510225 1:16962787-16962809 TCAAACTCCTGACCTCCAGTCGG + Intronic
903345659 1:22682566-22682588 GCAGCCTCCTGATTTCCTGTGGG + Intergenic
903376967 1:22872755-22872777 TGATCCTCCTGCCCTGCTGTGGG + Intronic
906800971 1:48736487-48736509 GCCTCCCACTGCCCTCCTGTCGG - Intronic
907308131 1:53524943-53524965 GCCTCCGCGTGACCTGCTGTGGG + Intronic
909591327 1:77352384-77352406 GCATGTTCCTGACCTTCTCTGGG - Intronic
911207023 1:95102063-95102085 GAATTCTTCTGACCTGCTGTTGG - Intergenic
917030334 1:170683329-170683351 TCAGCCTCCTGAGCCCCTGTAGG - Intronic
919552947 1:199014951-199014973 GTCTCCTCCTGACTGCCTGTGGG + Intergenic
920198646 1:204245681-204245703 GGATCCTCCAGATCTCCTTTTGG + Exonic
920445882 1:206016145-206016167 CCATTCTCCTGTTCTCCTGTGGG - Intronic
921938202 1:220814030-220814052 CCATCCTCCTGAGCACCTTTAGG - Exonic
922743887 1:228032199-228032221 GCTTCCTCCTGGCCTCCAGCTGG - Intronic
922756078 1:228097640-228097662 GCATCCTCATGAGCTCCTCACGG - Exonic
1066957393 10:42185932-42185954 GGAACCTCCTGACCTCCTCTAGG - Intergenic
1067554793 10:47261275-47261297 GCCACCTCCTGACTTCCTGTAGG + Intergenic
1067690226 10:48497076-48497098 GCATGCTGCTGACCTCCTAGGGG + Intronic
1067942756 10:50669991-50670013 GCCTCCTCTTGTGCTCCTGTCGG - Intergenic
1068581798 10:58749271-58749293 TCATCTTCCTGAGTTCCTGTTGG + Intronic
1069216857 10:65831702-65831724 TCAAACTCCTGACCTCCTGACGG + Intergenic
1069775515 10:70925017-70925039 GACTCCTCCTGGACTCCTGTGGG + Intergenic
1073203195 10:101752994-101753016 GCATTCTCCTCTCCTCTTGTGGG - Intergenic
1073452826 10:103619680-103619702 GCTTTCTCCTGACCTCTTGGGGG + Intronic
1074013476 10:109508241-109508263 TCTTCATCCTCACCTCCTGTTGG - Intergenic
1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG + Intergenic
1076279118 10:129230286-129230308 GCACCTTCCTGACCTCCAGATGG + Intergenic
1076562377 10:131375556-131375578 GCATCGTCCTGACCTGGGGTGGG + Intergenic
1077087134 11:759121-759143 GCAGCCCCTTGACCTCATGTTGG - Intronic
1077857477 11:6143573-6143595 CCATTCTCCTGACATGCTGTAGG - Intergenic
1078143035 11:8705386-8705408 GCCTCATCCTGACCTCTTGGTGG + Intronic
1080441636 11:32299906-32299928 TCCTCCTCCTGACCTTCTGAAGG + Intergenic
1086371292 11:86158019-86158041 GCAACCTCCTCCCCTCCTGTGGG + Intergenic
1088938365 11:114426998-114427020 CCATCATCCTCACCCCCTGTAGG - Intronic
1094659065 12:32448769-32448791 GCAGCCTCATCACTTCCTGTAGG + Intronic
1096593157 12:52675729-52675751 ACATTCTCCAGACATCCTGTAGG + Exonic
1096611874 12:52807378-52807400 GCATTCTCCAGACATTCTGTAGG + Exonic
1096867463 12:54573283-54573305 GCAACCTCCCCACCTCCTCTTGG - Intronic
1097055639 12:56247610-56247632 TCCTCCTCCTGCCCTTCTGTAGG - Exonic
1098172705 12:67762836-67762858 GCCTGCTGCTCACCTCCTGTTGG - Intergenic
1102200998 12:111057591-111057613 CCATCTTCCTGTCTTCCTGTGGG + Intronic
1102646959 12:114409805-114409827 GCATCCTCCCTTCCTCCTTTCGG + Intergenic
1103299557 12:119917756-119917778 GCTTCTGCCTGGCCTCCTGTGGG - Intergenic
1103321730 12:120096173-120096195 GTAGACTCCTGACCTCCAGTGGG + Exonic
1104881047 12:132070395-132070417 GCCTCCACCTGAGATCCTGTGGG + Intronic
1110741554 13:79003328-79003350 GCCTCCACCTGCCCTCCTGCAGG - Intergenic
1112617394 13:101019349-101019371 GCTTCCTCCTTTCCTCCTCTGGG + Intergenic
1113588306 13:111480737-111480759 GCATCCTTCTCCCATCCTGTGGG + Intergenic
1118318109 14:64737799-64737821 GCAACCTCCCGTCCTCCTGCAGG - Intronic
1118609986 14:67532817-67532839 GCATTCTCCTGGCCACCTGTGGG - Intronic
1120865250 14:89290900-89290922 ACATCCTCCTCACCTCCTCCAGG - Intronic
1121126245 14:91408570-91408592 GTTTCCTCCCGGCCTCCTGTGGG + Intronic
1121774602 14:96582538-96582560 GCATCCCCTTCACCTCCTGCAGG + Intergenic
1123000809 14:105293139-105293161 GCATGCGCCTGGCCTCCTGGCGG - Intronic
1124608710 15:31193052-31193074 GCCTCCTCCTGACCACGTGCTGG - Intergenic
1125447093 15:39769633-39769655 GCATCTTCTTAACATCCTGTGGG - Intronic
1126479914 15:49106808-49106830 GCATCCTCTTGGCATCCTTTGGG - Intronic
1128555087 15:68626253-68626275 GCATCCCCCTCCCCTCCTGAAGG + Intronic
1128920377 15:71605018-71605040 GCAACCACCTTACCTCCTTTGGG - Intronic
1130267514 15:82421231-82421253 GCATAATCCTGACATCCTCTTGG - Intergenic
1130504511 15:84525603-84525625 GCATAATCCTGACATCCTCTTGG + Intergenic
1131551616 15:93362264-93362286 TCAACCTCCTGACCTTTTGTTGG + Intergenic
1132204371 15:99976326-99976348 CCAGCCCCCTGACCTCGTGTAGG - Intronic
1132204388 15:99976400-99976422 CCAGCCCCCTGACCTCGTGTAGG - Intronic
1132223333 15:100121839-100121861 GCATTCTCCTGTACTCCAGTGGG + Intronic
1133400181 16:5479970-5479992 CCAAGCTCTTGACCTCCTGTGGG - Intergenic
1136251965 16:29011354-29011376 GCATCCTTCAGAGCTCCTGGTGG + Intergenic
1138534802 16:57654124-57654146 GCCTGCCCCTGACCTCCTGCCGG - Exonic
1141710422 16:85695710-85695732 GCAACCACGTGACCTCCTGCAGG + Intronic
1141749431 16:85948299-85948321 GCATCTTCCTGAGCAGCTGTCGG + Intergenic
1144020858 17:11239798-11239820 CCATCCTCCTCACCTCCCATAGG + Intergenic
1144743247 17:17596058-17596080 GTACCCTCCTCACCTCCTCTGGG + Intergenic
1145760541 17:27422965-27422987 CCATCCTGCTGCCCTCCTGTGGG - Intergenic
1145798506 17:27669333-27669355 CCATCCTGCTGCCCTCCCGTGGG + Intergenic
1147530511 17:41271879-41271901 GCAACCTTCTGTCCTCCTCTTGG + Intergenic
1147536366 17:41325280-41325302 GAGTCCTCCTGCCCTCCTGCTGG + Intergenic
1147683887 17:42275909-42275931 GCAGCCCCCTGAGCTCCTATGGG + Intronic
1148238445 17:45984232-45984254 GCACCCACCAAACCTCCTGTGGG - Intronic
1148459187 17:47828488-47828510 AATTCCTCCTTACCTCCTGTGGG + Exonic
1148713358 17:49698059-49698081 GGAGGCTCCTGCCCTCCTGTGGG + Intergenic
1151512724 17:74571109-74571131 GCAGCCTCCTGACCGGCTCTGGG + Intergenic
1152714282 17:81891187-81891209 GCACCCTCCGGACCTCCGGGCGG + Intronic
1156493191 18:37508524-37508546 GCACCCCCCTCACCTCCTGCTGG + Intronic
1156881710 18:42088204-42088226 GCTTCCTCCTCACCTCCTCTTGG + Intergenic
1158268046 18:55681855-55681877 GAATCCTACTGACCACCTGTAGG + Intergenic
1159109353 18:64038910-64038932 ACATCCTCCTGTGGTCCTGTTGG - Intergenic
1160995452 19:1880161-1880183 GCATCCTCCTGCCCTGCAGCTGG - Intronic
1162132721 19:8536857-8536879 ACACCTCCCTGACCTCCTGTAGG - Intronic
1162510194 19:11113306-11113328 TCATCTTCCTGACCTCGTGCCGG - Exonic
1162645480 19:12046770-12046792 TCATCCTCCTGTCCACATGTGGG - Intronic
1162847798 19:13406869-13406891 GGTTCCTGCTGACCTTCTGTAGG + Intronic
1163155281 19:15436876-15436898 GCAGCTTCCTGACCTCCCGTCGG - Exonic
1164618922 19:29682336-29682358 GCAGCCACCAGACCTCCTGGGGG + Intergenic
1165115340 19:33524886-33524908 TAATCCTCCTGAGCTCCTGCTGG - Intergenic
1165417685 19:35704784-35704806 GCAGCCTCCTGGCCACCTTTAGG + Intronic
1165799076 19:38536718-38536740 GCTTCCTCCTCCCATCCTGTTGG + Intronic
1167817561 19:51897140-51897162 GCATACTCATGACCTACAGTTGG + Intronic
925852600 2:8097456-8097478 GAACCCTCCTGCCCTGCTGTGGG + Intergenic
929931201 2:46256934-46256956 GCATCCTCTTGATCTGCAGTTGG + Intergenic
930026819 2:47034187-47034209 GCAGCTTCCTGAAATCCTGTGGG + Intronic
932434429 2:71694881-71694903 GCTTCCACCTGGCCTCCTCTGGG - Intergenic
932694897 2:73947524-73947546 GCATCATCCTGACCACCTGAGGG + Intronic
937072455 2:119074385-119074407 GCCTCTTCCTGACTTCGTGTTGG + Intergenic
938049443 2:128154456-128154478 GCATCCTCTTGACCTGGTGGTGG + Intronic
938890618 2:135701559-135701581 TCCTCCTCCTGACATCCTGTTGG - Intronic
944186136 2:196950813-196950835 GCTTCCTCCTCTCCTCCTCTTGG - Intergenic
944420561 2:199525566-199525588 GCATCCCCAAGACCACCTGTAGG - Intergenic
947726233 2:232402632-232402654 GCACCCGCCTGACTTCCTGCTGG - Intergenic
948177633 2:235956662-235956684 GCCTCCTCCTGACCACAGGTGGG - Intronic
1172972439 20:38883289-38883311 GCATCTTCCTGACCTCGAGATGG - Intronic
1174083669 20:47989504-47989526 GGACCATCCTGTCCTCCTGTGGG - Intergenic
1178856274 21:36253041-36253063 CCACCCTCCTGAGCGCCTGTCGG + Intronic
1181182666 22:21078646-21078668 TCAGCCTCCAGACTTCCTGTCGG + Intergenic
1181234967 22:21443208-21443230 GCACCCTCCTGAACTGCTGTGGG + Intronic
1183200104 22:36380120-36380142 GCAGCCTCCGGGCCTCCTGGGGG - Intronic
1184479780 22:44739439-44739461 GCAGCCTCCTCACCTCCTTGGGG - Intronic
1184651210 22:45920225-45920247 GCTTCCTCCTGCCCCTCTGTGGG - Intergenic
1184688978 22:46108915-46108937 GCATCCTGCTGCCCTCCTCTGGG + Intronic
1185255307 22:49828092-49828114 CCATCCTCCTGACCCCCTCAGGG - Intergenic
1185343419 22:50301359-50301381 GCTTCCTGAGGACCTCCTGTGGG + Intronic
949402597 3:3681562-3681584 GTATCCTACTGACTTGCTGTAGG - Intergenic
952358075 3:32603152-32603174 GAATTCTCGTGACCTCCTGTGGG - Intergenic
954447061 3:50552504-50552526 GCCTCATCCTGACCACCTTTTGG - Intergenic
958907732 3:99960533-99960555 TCTCCCTCCTCACCTCCTGTAGG + Intronic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962413232 3:135159873-135159895 GCAGTCTCCTGAACTCCTCTAGG + Intronic
965610204 3:170535629-170535651 CCATCCTCCTGATCACCTGCTGG - Intronic
968510896 4:995491-995513 GCAGCCTCCTGGCCTCCCTTGGG - Intronic
968981497 4:3852423-3852445 CCAACCTCCTGTCCTGCTGTGGG - Intergenic
969463926 4:7343685-7343707 GCTTCCTCTTGACCTCCTAAGGG - Intronic
969629645 4:8328863-8328885 GCCTCCTCCTGGCCTCCTCCAGG - Intergenic
974194221 4:58550775-58550797 CCACCCTCATGACCTCCTGAAGG - Intergenic
975560676 4:75705564-75705586 CCCTCCTCCAGGCCTCCTGTAGG - Intronic
975744972 4:77466617-77466639 GCCTCCCCCTGCCCTGCTGTGGG + Intergenic
979733706 4:124055605-124055627 GCATCCCTCTGGCCTCCTGCTGG - Intergenic
982105609 4:152009370-152009392 GCCTCCTCCAGGCTTCCTGTGGG + Intergenic
984127772 4:175833348-175833370 TCCTCCTCCTTACCACCTGTAGG + Intronic
985235938 4:187874358-187874380 TGATGATCCTGACCTCCTGTAGG - Intergenic
986136061 5:4979178-4979200 CCATCCTCTTAACCTCCAGTAGG + Intergenic
986507762 5:8470549-8470571 CCATCCTCCAGACCCCCTGATGG - Intergenic
986666368 5:10108283-10108305 GCCTCCCCGTGACCTCCGGTGGG + Intergenic
988522303 5:31957357-31957379 GCAACCTCCTGACCGAGTGTGGG - Intronic
990962337 5:61407881-61407903 GCATCCTCCTGCACTGCTGGTGG + Intronic
992405665 5:76455226-76455248 TCAAACTCCTGACCTCCTGAGGG - Intronic
992554887 5:77893424-77893446 TCAGCCTCCTGACCCTCTGTAGG + Intergenic
996207424 5:120758687-120758709 GCTTCCCCTTGGCCTCCTGTTGG + Intergenic
998040318 5:138947276-138947298 GCGTCCTCCTGACCACCTGCCGG - Exonic
998722290 5:144966640-144966662 GCATTCTCCAGACCTCTTGAGGG + Intergenic
1001786899 5:174421543-174421565 CCACACTCCTCACCTCCTGTGGG - Intergenic
1002782708 6:379602-379624 GGTTCCTCCTGACCTCCCCTTGG + Intergenic
1003721329 6:8705855-8705877 GCATTGTTCTGACCTCCTGCTGG + Intergenic
1005796614 6:29369246-29369268 GCATCCTCATTTCCTCCTGGAGG + Intronic
1006139677 6:31920768-31920790 GCCTGTCCCTGACCTCCTGTAGG - Intronic
1006829795 6:36961864-36961886 GCATCCTCCTGACCTCCTGTAGG + Exonic
1007308190 6:40923524-40923546 GCATCCGCCCCGCCTCCTGTAGG + Intergenic
1008495149 6:52125439-52125461 CCATTCTCCTGACGTCATGTGGG + Intergenic
1011972137 6:93238849-93238871 GCATCCTCTTGGCCTTGTGTTGG - Intergenic
1012415818 6:99012227-99012249 GGATAATCCTGACCTTCTGTAGG + Intergenic
1015547532 6:134376765-134376787 TCTTCCTTCTGACCTCCTGCAGG - Intergenic
1015745542 6:136505639-136505661 GGATCCTCTTGTCCTCCGGTAGG - Intronic
1019941827 7:4298056-4298078 GCATCTTCCTGACCCCCGGGTGG - Intergenic
1020947790 7:14636296-14636318 GCATCATTCTGATATCCTGTGGG - Intronic
1021862810 7:24923701-24923723 GCATCTTCCTGGTCTCCTTTGGG - Intronic
1022801047 7:33777647-33777669 GCCATCTCCTGATCTCCTGTGGG + Intergenic
1024089538 7:45923834-45923856 GCAGCCTCCTGACCTCTATTCGG - Intergenic
1024241460 7:47439516-47439538 GCATGCGCGTGACCTCCTGTAGG + Exonic
1024345380 7:48308184-48308206 TCATGATCCTGACCTCATGTAGG - Intronic
1024861928 7:53854038-53854060 GCCACCTCCAGACCTCCTGTTGG - Intergenic
1024883487 7:54115559-54115581 GCATCCTCCTGCTGGCCTGTGGG + Intergenic
1026312540 7:69199631-69199653 GCCTCCTGTGGACCTCCTGTTGG - Intergenic
1026362363 7:69614469-69614491 GCAGCCTCCTGAGGACCTGTTGG + Intronic
1028694229 7:93690399-93690421 CCCTCCTTCTGACCTCCTGCTGG - Intronic
1031973606 7:128080442-128080464 CCATCCTCCTCACCTCCAGCAGG - Intronic
1034448901 7:151127062-151127084 GCCTCCCCCTCACCTCCTGTTGG + Intronic
1036582146 8:10085154-10085176 GGCTCTTCCTGCCCTCCTGTGGG + Intronic
1037694421 8:21210942-21210964 GCATCCTCCTGTTCTGCTGCCGG + Intergenic
1039655933 8:39406661-39406683 ACATCCTCCTGACCTCAGGAAGG - Intergenic
1039838673 8:41278119-41278141 GCTTCCACCTGAGCTCCAGTGGG - Intronic
1040905941 8:52469919-52469941 GAACCCTCCTGACCTGCTCTAGG - Intergenic
1043790199 8:84456347-84456369 GTATCCTCTTGGCTTCCTGTTGG - Intronic
1044543323 8:93431729-93431751 TCTTCCTCAGGACCTCCTGTAGG + Intergenic
1044893657 8:96864398-96864420 GCAGCCTCCTTCTCTCCTGTTGG - Intronic
1051534195 9:18138740-18138762 GCATCCTCACGAACTCCTGCTGG + Intergenic
1056043060 9:82687618-82687640 GTATGCTCCTGAGCTCCTTTGGG - Intergenic
1056590714 9:87963974-87963996 TCCTCATGCTGACCTCCTGTGGG - Intergenic
1058103414 9:100941825-100941847 TCATCCTCCTTTCCCCCTGTGGG + Intergenic
1058795020 9:108489526-108489548 TCATCCACCTCACCTCCAGTAGG + Intergenic
1059100664 9:111469051-111469073 GCATCCTGCTGGCCTCATTTGGG - Intronic
1059246645 9:112855110-112855132 GCATCCACCAAACCTCCTGATGG - Intronic
1061446790 9:130643287-130643309 GCAGCCACCTGCCCGCCTGTGGG + Intergenic
1061825751 9:133257241-133257263 GCATCTTACTGAGCTCATGTGGG - Intronic
1062309906 9:135930048-135930070 TCATCCTCCTGCCTTCCCGTGGG + Intergenic
1062570540 9:137183062-137183084 GCATCCTGCTGAGCTCCTCGTGG - Intronic
1185666218 X:1767382-1767404 CCCTCCTCCTTACCTCCTGGGGG - Intergenic
1186179049 X:6954936-6954958 GCATCAGCTTGACCTCCTGAGGG - Intergenic
1189372211 X:40437777-40437799 GCAGCATCCTCACCTCCAGTGGG + Intergenic
1191875978 X:65796873-65796895 ACAAACTCCTGACCTCCTGGTGG + Intergenic
1195974491 X:110511489-110511511 CCTTCCCTCTGACCTCCTGTGGG - Intergenic
1196138732 X:112237496-112237518 GCAGCCTTCTGCCCTCCTGCTGG - Intergenic
1196797305 X:119512655-119512677 GGAACCTACTGACCTCTTGTGGG + Intergenic
1199997282 X:153033208-153033230 GCGTCATCCTGACATCCTGCAGG + Intergenic