ID: 1006829795

View in Genome Browser
Species Human (GRCh38)
Location 6:36961864-36961886
Sequence GCATCCTCCTGACCTCCTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006829788_1006829795 -10 Left 1006829788 6:36961851-36961873 CCCCCTCCCCGCAGCATCCTCCT 0: 1
1: 0
2: 6
3: 102
4: 1003
Right 1006829795 6:36961864-36961886 GCATCCTCCTGACCTCCTGTAGG 0: 1
1: 0
2: 0
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006829795 Original CRISPR GCATCCTCCTGACCTCCTGT AGG Exonic