ID: 1006831407

View in Genome Browser
Species Human (GRCh38)
Location 6:36970422-36970444
Sequence CCTGCTAGTTGGCGACCTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006831407_1006831414 22 Left 1006831407 6:36970422-36970444 CCATGAGGTCGCCAACTAGCAGG 0: 1
1: 1
2: 0
3: 5
4: 47
Right 1006831414 6:36970467-36970489 CTGCAATCTGAAACCCAGAGAGG 0: 1
1: 0
2: 2
3: 27
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006831407 Original CRISPR CCTGCTAGTTGGCGACCTCA TGG (reversed) Exonic
900566515 1:3334880-3334902 GATCCTAGTTGGCGACCTCAGGG - Intronic
901781846 1:11599414-11599436 CCTGCTTTTTGGCCACCACAGGG + Intergenic
901908573 1:12436134-12436156 CCTGCTGGATGGTGACCCCAAGG - Intronic
902977214 1:20097698-20097720 CATGCTAGGTGGTGTCCTCAGGG + Intergenic
903888430 1:26554672-26554694 CCTGGCGGTTGACGACCTCAGGG - Exonic
904067616 1:27766240-27766262 CCTGGTAGTTGGAGAAGTCATGG - Intergenic
917975035 1:180232936-180232958 CCTTCTAGTTGGCGACTGGAGGG - Intronic
922756087 1:228097694-228097716 CCTGCTTGTTGGCGAACACCAGG - Exonic
1079224779 11:18595790-18595812 CCTGCCAGTTGGCAGCCTCATGG - Intergenic
1088078861 11:105885083-105885105 CCTGCTATTTGGCTACAGCAGGG - Intronic
1091055240 11:132411945-132411967 CCAGCTGGTTGGAGAACTCATGG + Intergenic
1093420308 12:18967170-18967192 CTTGCTGCTTGGAGACCTCAGGG + Intergenic
1100666134 12:96755580-96755602 CCTGTTATTTGAAGACCTCATGG - Intronic
1102547679 12:113668285-113668307 CCTGCTAGATGGCAAATTCAGGG + Intergenic
1103009953 12:117450403-117450425 CCTGATTGATGGCGACCCCAAGG + Intronic
1114250981 14:20960029-20960051 CCTGCTAATTGTAGACCTCTAGG + Intergenic
1114743253 14:25119593-25119615 CCTGCCAGGTGGCAACCTCAAGG + Intergenic
1116945493 14:50831367-50831389 CCAGCTCGGTGGCGACCTCGGGG - Intergenic
1121263393 14:92582796-92582818 CATGCTAGTGGCTGACCTCAGGG - Intronic
1127734899 15:61831150-61831172 CCAGCTAGATGGCCACCTCGCGG + Intergenic
1132620827 16:867663-867685 CCTCCTAGCTGGCGCCCTCAGGG - Intronic
1140728528 16:77835471-77835493 CCTGCTAGTTGGGGCCTTGAAGG - Intronic
1144373722 17:14618299-14618321 CCTTCTAGTTGAAGAACTCAAGG + Intergenic
1152198007 17:78928771-78928793 CCTGCTGCTTGGGGCCCTCAGGG + Intergenic
1159199069 18:65160021-65160043 GCAGCTAGTTGGCAACCTTAAGG + Intergenic
1162211212 19:9093670-9093692 CCTGCTGGTCGGCGCCCTCTGGG + Exonic
1163302117 19:16454419-16454441 CCAGCTAGTTTGCTTCCTCATGG + Intronic
940536465 2:154951514-154951536 CCTGCTAGTTGGATGCCCCAGGG + Intergenic
940729766 2:157375479-157375501 CCTGCTAGGCGGTGCCCTCATGG + Intergenic
945347737 2:208738814-208738836 CCTGCTATCTGGGGACCTCCAGG - Intronic
948995329 2:241575429-241575451 CCTGCTAGTCAGCAGCCTCAGGG - Intergenic
1169642194 20:7765405-7765427 CCTGCTTGTGGGAGTCCTCAAGG - Intergenic
1170723175 20:18902022-18902044 CCTGGAAGTTGGTGTCCTCATGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
954596609 3:51830492-51830514 CCTGCTGGTTGCTGCCCTCAGGG + Exonic
955673105 3:61423144-61423166 CATGCTACTTGCCTACCTCAAGG + Intergenic
961918618 3:130403213-130403235 CCTGCTATTTTGAGAGCTCAAGG - Intronic
973801657 4:54484378-54484400 CCTGCTTGCAGGAGACCTCATGG - Intergenic
986267802 5:6205300-6205322 CCTTCTAGTTGGCGGAATCAAGG - Intergenic
999296213 5:150461179-150461201 CCTGCTATCTGGCATCCTCAGGG - Intergenic
1000804021 5:165766064-165766086 CCTGCTAGTTGGGGGACTGAGGG - Intergenic
1004407864 6:15351407-15351429 CCTTCTAGCTGGGGTCCTCATGG + Intronic
1006831407 6:36970422-36970444 CCTGCTAGTTGGCGACCTCATGG - Exonic
1015961142 6:138650383-138650405 CCTGCTAGTCGGCGACCTCATGG - Intronic
1016427406 6:143949206-143949228 CCTGCTGGTAGGCCACCTCCAGG + Intronic
1022797356 7:33742696-33742718 CCTGCGAATGGGCGTCCTCAGGG + Intergenic
1032300837 7:130685219-130685241 ACTGCTAGTTGGCCAACCCAAGG + Exonic
1040436008 8:47392236-47392258 CCTACTAGTGGGCTACCTTAGGG - Intronic
1045273461 8:100681076-100681098 CCACCTGGTTGGCCACCTCAGGG - Intergenic
1057401624 9:94728326-94728348 CCTGCTGTTTGGAGTCCTCAGGG + Intronic
1061035105 9:128109042-128109064 CCGGCCAACTGGCGACCTCACGG + Exonic
1062645022 9:137543493-137543515 CCTGCTGGAGGCCGACCTCACGG - Exonic
1190708507 X:53049216-53049238 CCAGCTAGTTGGACACCCCAAGG + Exonic
1196911747 X:120490683-120490705 CCTGCTAACTGGCGACCTGATGG - Intergenic