ID: 1006832308

View in Genome Browser
Species Human (GRCh38)
Location 6:36976366-36976388
Sequence TAACAGAGGGAGCCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006832303_1006832308 2 Left 1006832303 6:36976341-36976363 CCAAGGAAGCTCAATAACAACCT 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006832308 Original CRISPR TAACAGAGGGAGCCAGTGGA AGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901316939 1:8315959-8315981 GAAGAGAAGGAGCCACTGGAGGG - Intergenic
903031910 1:20469780-20469802 TAGCAGATGGAGTAAGTGGATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903753119 1:25642177-25642199 TAGCAGAGGCAGCCACAGGAGGG - Intronic
903833376 1:26188180-26188202 TACAAGAGGGCCCCAGTGGATGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904415972 1:30361438-30361460 TGACAGAAGGAGCCAGTGATGGG - Intergenic
904501324 1:30914462-30914484 AAACAGAGGGAGCCTGGGCAGGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905181551 1:36170404-36170426 TCACAGAGGGTGCCAGTGCTGGG - Intronic
905234844 1:36538957-36538979 CAAGATAGGGAGCCACTGGAGGG - Intergenic
905241849 1:36586687-36586709 TAAGAGAGGGAGCCTTGGGATGG - Intergenic
905343848 1:37298104-37298126 TGAGAGAGGAAGCCATTGGAGGG + Intergenic
905352455 1:37356973-37356995 TGAGGGAGGGATCCAGTGGAAGG + Intergenic
905493383 1:38362881-38362903 CATGAGAGGGACCCAGTGGAAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906705492 1:47891998-47892020 TAAAACAGAAAGCCAGTGGAGGG + Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906882765 1:49610550-49610572 TAAGAGATGGAGACACTGGAAGG + Intronic
906937595 1:50227541-50227563 TAAAACAGGCAGCCACTGGAGGG + Intergenic
907029779 1:51159318-51159340 TAACGGAGGTAGAGAGTGGAAGG - Intergenic
907158369 1:52354403-52354425 TCACAGAGGGACCCAGGAGAAGG - Intronic
907475964 1:54705703-54705725 TGACAGGTGGAGTCAGTGGAAGG + Intronic
907675713 1:56516111-56516133 TATCAGATGTAGCCACTGGATGG - Intronic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909241566 1:73220966-73220988 TAGGGGAGGGACCCAGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910802770 1:91162250-91162272 TGACAGAAGGAGGCAGAGGAGGG + Intergenic
911831220 1:102553477-102553499 TATGGGAGGGACCCAGTGGAAGG - Intergenic
912096073 1:106145821-106145843 TTACAGAGGTAGCCAGTCTAAGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912952702 1:114131339-114131361 TAAAAGAGGAAGTCAGAGGAGGG - Intronic
913220864 1:116659296-116659318 TAACTGAGGGTTCCAGTTGAGGG + Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916352240 1:163864000-163864022 TTTCAGAGGGAGCCAGCAGAAGG + Intergenic
916961009 1:169889904-169889926 TAACAGAGGTTTCCAGTGGAAGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917652911 1:177096568-177096590 TATGAGAGGGATCCAGTGGGAGG + Intronic
919303993 1:195806633-195806655 TAAAAGAGGGAGGCAGAGGGAGG + Intergenic
919655864 1:200196509-200196531 TAAGAGGGGAAGCCATTGGATGG + Intergenic
919801680 1:201358191-201358213 TAACAGAGTGTGGCATTGGATGG + Intergenic
919884068 1:201920026-201920048 AAAGAGAGAGAGCCAGTGGCGGG - Intronic
919947181 1:202328223-202328245 TAAAGGAGGAAGACAGTGGAAGG + Intergenic
920618338 1:207518420-207518442 TAACTGAGAGAACAAGTGGAGGG - Intronic
920634774 1:207690559-207690581 TAACTGAGAGAACAAGTGGAGGG - Intronic
921069747 1:211649201-211649223 TACCATGGGGACCCAGTGGAGGG - Intergenic
921261817 1:213391146-213391168 TAACAGAGGGAAACAGAGAAAGG + Intergenic
921678703 1:218006436-218006458 CAAGGGAGGGACCCAGTGGAAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922864570 1:228848546-228848568 TAACAGACAGAGGCTGTGGATGG - Intergenic
923087785 1:230714324-230714346 GAACAGAGTGAGCCGGTGCAGGG + Intergenic
923217794 1:231865620-231865642 TAACAGAGGTTGCCAGAGGCTGG - Intronic
923904605 1:238369906-238369928 CATGAGAGGGACCCAGTGGAAGG - Intergenic
1062939034 10:1408016-1408038 TAACAGTGTGAGCCCTTGGAAGG - Intronic
1063075365 10:2711248-2711270 TGTGAGAGGGACCCAGTGGAAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063153136 10:3354936-3354958 AGGCAGAGGGAGCCAGAGGAAGG - Intergenic
1063576310 10:7265174-7265196 GAAGAGAGGGAGGCAGGGGAGGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064481247 10:15742960-15742982 CAACTGAGGGAGCCACTTGAAGG - Intergenic
1067203584 10:44195334-44195356 GAACAAAGAGAGCGAGTGGAGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070916948 10:80161111-80161133 CAAAAGAGGAAGCCAGTGGAGGG - Intronic
1071112354 10:82174728-82174750 TAACAGAGTGAGCCAGGGGTTGG - Intronic
1071270742 10:84004967-84004989 AAAAAGAGAGAGACAGTGGAAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073692523 10:105826040-105826062 AAACAGAGGGAGCCAATAAAAGG - Intergenic
1073880162 10:107972249-107972271 TATGGGAGGGAGCCAGTGGGAGG + Intergenic
1074283285 10:112073519-112073541 TAACTGAATGAGCCAGTGGGAGG - Intergenic
1074416853 10:113274144-113274166 TAACAGAGGCAGGCAGCAGAGGG - Intergenic
1074456435 10:113599721-113599743 TAAAAGAGGGGGCCAGGGGAGGG + Intronic
1075427605 10:122353957-122353979 TGAGAGAGGGAGCAAGAGGAAGG - Intergenic
1075821886 10:125321533-125321555 TGAAATAGGAAGCCAGTGGATGG - Intergenic
1076208995 10:128625661-128625683 CTACAAAGGGAGCCAGTGGCAGG + Intergenic
1076377831 10:130003369-130003391 TGACAGCCGGAGCCAGTGGCTGG - Intergenic
1076395496 10:130135560-130135582 TAATAGAAGGGGCCGGTGGAGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078184991 11:9044640-9044662 TGAGAAAGGAAGCCAGTGGAGGG - Intronic
1078415930 11:11164863-11164885 TAAGAGAGCGAGCCAGTGCCAGG + Intergenic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1079010777 11:16826402-16826424 TCCCAGAGGGACCCACTGGAGGG - Exonic
1079397989 11:20082513-20082535 TAACAGAGAAAGCCAGTGACAGG - Intronic
1080096476 11:28414361-28414383 TAACAGAGGGAGGCACTGGCAGG - Intergenic
1083462324 11:62822381-62822403 TGACATAGGGAGCCATTGCAGGG - Intronic
1084568505 11:69945088-69945110 TAAAGGTGGGAGCCAGGGGAGGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086794098 11:91078845-91078867 TAACAAAGAGTGTCAGTGGATGG - Intergenic
1087240290 11:95767497-95767519 AAGCAGAGGGAATCAGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088771657 11:113042048-113042070 TACCAGAGGAAGTCAGAGGAGGG - Intronic
1089079523 11:115764202-115764224 TAACAGGGGGTGCCATTAGAGGG - Intergenic
1090697968 11:129267865-129267887 TGAGAGAGGAAGCAAGTGGAGGG + Intronic
1090854175 11:130597801-130597823 GAACAGAGGGAGGCAAGGGATGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090920006 11:131198912-131198934 TAGCAGAGGCAGCCTGTGGCTGG - Intergenic
1090954707 11:131503932-131503954 TAACAAAGGTAGTCAGTGTAGGG - Intronic
1091139010 11:133219562-133219584 TGACAGTGGGACCCAGGGGATGG - Intronic
1091270769 11:134310372-134310394 TGACACTGGAAGCCAGTGGAAGG + Intronic
1091404438 12:200489-200511 GAACAGGGGGAGCCACAGGAAGG - Intronic
1091587992 12:1827072-1827094 TGACGCAGGGAGCCCGTGGAGGG + Intronic
1091823217 12:3491540-3491562 TAAAAGAGAGAGCGAGAGGATGG - Exonic
1091854077 12:3724838-3724860 TAGCAGTGGGAACCAGTGAAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092824171 12:12382272-12382294 TAAGAGAGGGAGACAGAGGTGGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092930738 12:13313033-13313055 TAACAGAGGGAGCCATGGGAGGG - Intergenic
1093293386 12:17357473-17357495 GAACAGCAGGAGCCAGAGGAAGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094717232 12:33024678-33024700 TGAGAGAGGGAGCAAGAGGAAGG - Intergenic
1095531207 12:43189146-43189168 TATGGGAGGGACCCAGTGGAAGG + Intergenic
1096232007 12:49902035-49902057 TCACAGAGTGACCCAGTGGAAGG + Intronic
1096466502 12:51849588-51849610 AAACAGAGGGCTCCACTGGAGGG + Intergenic
1096749654 12:53750898-53750920 CGGCAGATGGAGCCAGTGGAGGG - Intergenic
1096773189 12:53949480-53949502 GAACAGATGGAGCCACTGAAGGG - Intergenic
1096792808 12:54055391-54055413 TAACAGTGGGAGGGAGAGGAGGG - Exonic
1097259888 12:57713090-57713112 TAACAGAGAGAACCAGGGAAAGG - Intronic
1098190110 12:67938945-67938967 AAATAGAAGGAGCCAGAGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098596817 12:72282533-72282555 TAACAGAGAGAGCCAGTTTCCGG - Intronic
1099404877 12:82247604-82247626 AAAAAGAGGGAGCCAATGAAAGG - Intronic
1101255552 12:102973598-102973620 GAAAAGAGGGAGGCAGTGGGAGG - Intergenic
1101597186 12:106177892-106177914 CAACAGAGGGAGCAAGTTTAGGG + Intergenic
1102162240 12:110778889-110778911 GATCACAGGAAGCCAGTGGAAGG + Intergenic
1103016783 12:117500851-117500873 GAAAAGGGGGAGGCAGTGGAAGG - Intronic
1103447780 12:121005483-121005505 TGCCTGATGGAGCCAGTGGAGGG + Intronic
1103567779 12:121825482-121825504 ACACAGAGGGTGCAAGTGGAAGG + Intronic
1103676944 12:122663385-122663407 TGACAGAGGGAGACAAAGGAAGG - Intergenic
1105621597 13:22072723-22072745 TGTCAGTGTGAGCCAGTGGAAGG - Intergenic
1105753627 13:23444770-23444792 TATGAGAGGGACCCAGTGGCAGG + Intergenic
1105864080 13:24443388-24443410 TATCAGAAGAAGCCAGAGGAGGG - Intronic
1106758407 13:32844787-32844809 GAAAAGAGGGAGCCACTGAAGGG - Intergenic
1107576676 13:41731685-41731707 CAAAAGAGGGACCCAGTGGGAGG + Intronic
1108165727 13:47691119-47691141 TGACAGAATGAGGCAGTGGATGG - Intergenic
1108563404 13:51669937-51669959 TGATAGAGGAAGTCAGTGGAGGG + Intronic
1109056044 13:57550545-57550567 AAACAGAAGGACCCAGGGGAGGG + Intergenic
1111369222 13:87294462-87294484 TAAAAATGGGAGCAAGTGGAGGG - Intergenic
1112265616 13:97920663-97920685 TAAGAGAGGGAGCATGTGCAGGG - Intergenic
1112945230 13:104919881-104919903 TACCACAGGGATCCATTGGAAGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114179786 14:20356496-20356518 TATAAGAGGGAGTCAGAGGAAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114534891 14:23416596-23416618 AAACAGAGGGAGGCAGAGGTGGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117321651 14:54629846-54629868 GAACAGTGGGTGCCAGGGGAAGG - Intronic
1117361432 14:54978993-54979015 TAAAAGAAGGAGCCAATGAAAGG - Intronic
1117462777 14:55962690-55962712 TAAGAGATGGAGCCTTTGGAAGG + Intergenic
1118838753 14:69495390-69495412 TAAGAGAGACAGCCACTGGAAGG - Intronic
1119271298 14:73307566-73307588 GAACAGAGGGAGCAAGAGGAAGG + Intronic
1119806412 14:77485164-77485186 TCACAGAGGATGCCAGTGTAAGG + Intronic
1120534951 14:85683320-85683342 AAAAAGAGGGAGCCAGGGCAGGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122738883 14:103859480-103859502 GAAGTGAGGGAGCCAGGGGAGGG + Intergenic
1125727295 15:41874602-41874624 TGACAAAGGGAGGCAGTGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126671707 15:51121260-51121282 TCACAGAGGGAGGCAGTGCAGGG + Intergenic
1127018538 15:54717953-54717975 AAAGAGAGGGAGCCAGGAGAGGG + Intergenic
1127160655 15:56181234-56181256 TGACAGAGCAAGCCAGTGCAGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129125648 15:73438657-73438679 TAGCAGAGGGAGACAGGGTAGGG + Intergenic
1129608264 15:77035267-77035289 CTGCAGAGGGCGCCAGTGGAGGG + Intronic
1130638991 15:85653210-85653232 TTACAGAGTGACCCAGTGAAGGG + Intronic
1133273688 16:4624464-4624486 TTTCAGAGGGGGCAAGTGGAAGG + Intronic
1133693274 16:8236573-8236595 CATGAGAGGGACCCAGTGGACGG - Intergenic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1135659221 16:24280048-24280070 TAACAGAGGCAACCGGTGAAAGG + Intronic
1135790087 16:25385949-25385971 TAACAGAGTGACCCATTGCAAGG - Intergenic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137425224 16:48373735-48373757 TAACATGGGTAGCCAGCGGAGGG - Intronic
1138420770 16:56897758-56897780 GGACAGAGGGAGGCAGAGGAAGG - Intronic
1139111466 16:63896545-63896567 TAAGACAGGAAGCCACTGGAAGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140899435 16:79354297-79354319 AAACAGATGGATTCAGTGGAAGG + Intergenic
1141866196 16:86751771-86751793 CAACAGAGGGTGCCGGGGGAGGG - Intergenic
1142614260 17:1125690-1125712 TAACAGTGGGAGCAAGAGGCAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143120355 17:4602834-4602856 GAAAAGAGGGAGCCAGGAGACGG + Intronic
1143305879 17:5946293-5946315 TATGAGAGGGACCCAGTGGGAGG + Intronic
1143889839 17:10094402-10094424 GGACAGAGGTAGGCAGTGGAAGG - Intronic
1143987737 17:10929693-10929715 AAACAGTGGGAGCCACTGCAGGG + Intergenic
1144517551 17:15929101-15929123 TAGCAGAGTGAGAGAGTGGAGGG + Intergenic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1145279201 17:21455870-21455892 TAACCGAGGGAGCTGGTGGGAGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146478223 17:33180425-33180447 GAACAGAGGGACCCAGCTGAGGG - Intronic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147381515 17:40059078-40059100 CAAAAGAGGGAGCCAGGGAAGGG - Intronic
1148340186 17:46868739-46868761 TCACAGAGGGACCCAGTGAGTGG + Intronic
1149038410 17:52159024-52159046 TAACAGAGGCAGCCAGGGCGGGG - Intronic
1149179051 17:53912303-53912325 AAGCAGAGTGAGCCAGTGGGTGG + Intergenic
1149553290 17:57555634-57555656 TAACTGGGGGAGTCAGTGTAGGG - Intronic
1150245661 17:63672998-63673020 CAACAGAGGAACCCAGTGGAAGG - Intronic
1151066708 17:71159206-71159228 TAAGGGAGGGACCCAGTGGGAGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153629231 18:7053406-7053428 TAATAGTGGGAGCAACTGGAGGG + Intronic
1154280231 18:12996023-12996045 TAAGATGGGGAACCAGTGGAGGG + Intronic
1154358013 18:13637144-13637166 TCACATAGGGAGGCAGTGGATGG - Intronic
1154382923 18:13868936-13868958 TAACAGAGAGAGCGAGCGCAGGG + Intergenic
1155902702 18:31411017-31411039 ACACAGAGGGAGTCAGTGGTGGG - Intronic
1156454316 18:37284472-37284494 AACCAGAGGGAGCCAAGGGAGGG - Intronic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157523335 18:48360562-48360584 GGACAGAAGGAGCCAGGGGAGGG + Intronic
1157810817 18:50694483-50694505 TAACATAGGGCTCCGGTGGATGG - Intronic
1157977174 18:52340475-52340497 AAACGGAGGGAGCCAGAGGAGGG - Exonic
1158157143 18:54438818-54438840 TGACATGGGGAGCCACTGGATGG - Intergenic
1158523552 18:58192369-58192391 TAACAAGGGGAGACAGTGGCAGG + Intronic
1158536888 18:58316259-58316281 AAAGAGAGGGAGCTGGTGGATGG - Intronic
1158702414 18:59760357-59760379 AAACTCAGGGAACCAGTGGATGG + Intergenic
1158833111 18:61302346-61302368 TGTCAGAGGGACCCAGTGGGAGG + Intergenic
1158955273 18:62532090-62532112 TTCCAGTGGGAGCCAGTGAAGGG + Intronic
1159556043 18:69945882-69945904 AAACAGAGAGAGCTAGTGCAGGG + Intronic
1160879508 19:1313090-1313112 AAACTGAGGCAGCCAGCGGATGG - Intergenic
1162413392 19:10519380-10519402 AAACACAGGGAGCCACGGGAGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162796431 19:13089830-13089852 GAAGAGAGGGGGCCAGGGGAGGG - Intronic
1163113749 19:15177416-15177438 AAACAGACGGGGCAAGTGGATGG + Intronic
1163492045 19:17622895-17622917 TCACAGAGAGAGACAGTGGCTGG + Intronic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1165130817 19:33630724-33630746 TAACTGACGGAGCCAGTGCATGG + Intronic
1165344616 19:35236838-35236860 CAAGGGAGGGACCCAGTGGAAGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166331056 19:42078211-42078233 TAAGAAAAGGAGTCAGTGGAAGG + Intronic
1166437927 19:42785420-42785442 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166456881 19:42949212-42949234 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166472965 19:43096159-43096181 TCACAGAGGGAGAAAGAGGAGGG - Intronic
1166713185 19:44950174-44950196 TACCAGAAGTAACCAGTGGAAGG - Exonic
1167357061 19:49010662-49010684 GAACAGAGGGAGCCCGAGGGAGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167937708 19:52921323-52921345 GAACACAGGAAGCCAGTGGAGGG + Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168420773 19:56201687-56201709 AAACAGTGGGAACCAGAGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926058700 2:9791989-9792011 TAACAGGGGGAGACAGAGCACGG + Intergenic
927712145 2:25332638-25332660 AATCAGAGGGAGCCAGGGCACGG - Intronic
927779508 2:25928189-25928211 AAACAAAGGAATCCAGTGGAGGG + Exonic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928664136 2:33533627-33533649 TTACAGAGCTAGCCAGTGGCAGG + Intronic
928812958 2:35251702-35251724 TAACAGAGAGAGAGAGAGGAAGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930104112 2:47626786-47626808 TAATACAGGGAGCCACTGAAAGG + Intergenic
930906241 2:56571957-56571979 TGAGAAAGGGAGCCATTGGAGGG + Intergenic
931471235 2:62539606-62539628 TAACAGTGGAAGCAAGAGGAAGG + Intergenic
932261177 2:70329020-70329042 TTACAGAGGGAGCAAGCTGACGG - Intergenic
932347389 2:71004580-71004602 TGACAGAGGAAGCCAGTCTATGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934518039 2:95001168-95001190 TAACAGAGACAGCTAGTGGCAGG - Intergenic
934716430 2:96547276-96547298 TGCCAGAGGGCGCCAGTGCAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935800486 2:106690637-106690659 AATGAGAGGGAGCCAGTGGGAGG - Intergenic
936058825 2:109281315-109281337 TAACGGAGGGGGCCCGGGGAAGG - Intronic
938181520 2:129189105-129189127 GAACAGAGGGAGACAGAGCAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939659308 2:144868587-144868609 GAAGAGAGGGAGTGAGTGGAGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940971720 2:159903688-159903710 TAACAGAAGTGGCCGGTGGAGGG + Intronic
941226723 2:162858664-162858686 TCACAGAGGGAGACAGGTGAGGG + Intergenic
941763980 2:169275954-169275976 GAACAGAGTGAGGCAGAGGACGG + Intronic
943183560 2:184575924-184575946 TATGAGAGGGACCCAGTGGGAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945384295 2:209178945-209178967 TAAAAGAGGGAGCCAGCAGTAGG + Intergenic
945457451 2:210065999-210066021 TGAAAGAGGGAACCAGAGGATGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946478784 2:220033925-220033947 TAAAAGAGGGAAACAGAGGAAGG + Intergenic
947105253 2:226662181-226662203 GAACAGAGGGACCCAGTGAGAGG - Intergenic
947315971 2:228858823-228858845 AAACAGAGGGTGCCTCTGGAGGG - Intronic
948565270 2:238882316-238882338 TAACACAGGTAGGCACTGGATGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169092416 20:2869647-2869669 TATCAGTGGTAGCCAGTGCAGGG + Intronic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1171176994 20:23059545-23059567 TAACTGATAGATCCAGTGGATGG + Intergenic
1172351849 20:34249214-34249236 TCACACAGGGAGCTAGTGGCAGG + Intronic
1172755381 20:37280139-37280161 TTACATAGGGGGCCAGTGGAGGG + Intergenic
1173181648 20:40810580-40810602 GGACAGAGGAAGCCAGTGAAAGG + Intergenic
1173283764 20:41652393-41652415 GAACAGAGAGAGCCGATGGAAGG + Intergenic
1173283863 20:41653410-41653432 GAACAGAGAGAGCCAATGGAAGG - Intergenic
1173945095 20:46944138-46944160 GGACAGAGGGAGCCAGGTGAGGG + Intronic
1174177058 20:48651810-48651832 GGACAGAGGGAGCCATCGGAAGG + Intronic
1175008332 20:55709722-55709744 TATCAGAGGGACCCAGGGGGAGG + Intergenic
1175912681 20:62412304-62412326 TGAGAGAAGGAGCCAGGGGATGG - Intronic
1178166555 21:29984942-29984964 TATGGGAGGGACCCAGTGGAAGG + Intergenic
1179248849 21:39656388-39656410 TAACAGGTGGAACCAGGGGATGG - Intronic
1179599320 21:42465579-42465601 TAATAGAGGGAGGCAGGGAAGGG - Intergenic
1180822395 22:18839520-18839542 TAACTGAGGGTTCCAGTTGAGGG + Intergenic
1181190576 22:21136526-21136548 TAACTGAGGGTTCCAGTTGAGGG - Intergenic
1181208629 22:21273981-21274003 TAACTGAGGGTTCCAGTTGAGGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183277411 22:36907914-36907936 TAACAGAGGGTGTCAGTACAGGG + Intergenic
1183331392 22:37223916-37223938 TAAGAGTGGGAGGCAGAGGATGG + Intergenic
1183542079 22:38435291-38435313 TACCAGAGGGAGCCAGCACAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184299330 22:43546462-43546484 TATCAGTGGGAGCCAGAAGATGG + Intronic
1184330356 22:43823388-43823410 TAAGATAGGGAGCCATGGGAGGG - Intergenic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184609569 22:45594203-45594225 TAACACAGGGAGGCAAGGGAAGG - Intronic
1184625252 22:45722359-45722381 TAACAGTGGGAACCATTAGAAGG + Intronic
1184861131 22:47173827-47173849 TACCAAAGAGAGCCAGGGGAGGG + Exonic
1203218305 22_KI270731v1_random:21431-21453 TAACTGAGGGTTCCAGTTGAGGG - Intergenic
950771494 3:15314961-15314983 GAACAGAGGAAACCAGAGGAGGG + Intronic
950892319 3:16414969-16414991 TGACAGAGGAAGTCCGTGGAGGG + Intronic
951509394 3:23484883-23484905 TCATGGAGGGACCCAGTGGAAGG - Intronic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
952200266 3:31119047-31119069 TGTCAGAGGGACCCAGTGGGAGG - Intergenic
953140845 3:40228035-40228057 TAACAGAGGGAGACAATTGGGGG - Intronic
953923655 3:46969182-46969204 TAAAAGAGGGAACCAGAGGGAGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954630071 3:52043329-52043351 GAAAAGAGGGAGCCAATTGAAGG + Intergenic
955212626 3:56955959-56955981 TACCAGAGGGAGACAGTTCAGGG - Intronic
956262288 3:67357190-67357212 TGAAAGAGGGAGCAAGAGGAGGG + Intergenic
957040326 3:75331293-75331315 TCACAGAGCGTGCTAGTGGAGGG + Intergenic
957338246 3:78859790-78859812 AAACAGGGGGAGCCGGTGCAGGG + Intronic
959163319 3:102744778-102744800 TCACTGAAGGAGCCAGTGTAGGG + Intergenic
959238943 3:103763379-103763401 TGACAGAGGGAGGCATTTGATGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960141886 3:114159054-114159076 AAACAGAGGGACCCAGAGCAAGG + Intronic
960498805 3:118410078-118410100 TGAGGGAGGGACCCAGTGGAAGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961560153 3:127723204-127723226 TCAAAGAGGGAGAAAGTGGAGGG - Intronic
961772952 3:129263576-129263598 CATCAGTGGGAGCCAGTGGTAGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965988393 3:174785174-174785196 TAATAGAGGGAAACAGTAGAAGG - Intronic
966750048 3:183313324-183313346 TAGCAGAAGGAGACACTGGAGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967425005 3:189316764-189316786 TAAAAGAGAGAGCCAGAGGTGGG + Intronic
967528523 3:190522116-190522138 TTACAGAGTGAGACAGTGGTGGG + Intronic
967615571 3:191561188-191561210 TAAGGGAGGGACCCAGTGGGAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968546227 4:1200385-1200407 TGACAGAGGGAGCAAGTGGAGGG + Intronic
968725899 4:2247679-2247701 TGACAGAGGGAGGCAGGGCACGG + Exonic
969183091 4:5456758-5456780 TCAGAGAGAGAGCCATTGGAAGG - Intronic
969711375 4:8846220-8846242 TGACAGTGGGAGCCTCTGGATGG - Intronic
970217508 4:13775652-13775674 TAAGGGAGGGACCCAGTGGGAGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970962288 4:21886497-21886519 TTACAGAGGGAGTAAGCGGATGG + Intronic
971593879 4:28502509-28502531 TATGAGAGGGACCCAGTGGGAGG - Intergenic
972562151 4:40238321-40238343 GCACAGAGCGAGCCTGTGGAGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973079186 4:45968569-45968591 TAAGAGAGGGAGCAAGAGAAAGG - Intergenic
974171118 4:58269002-58269024 TATGGGAGGGACCCAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976668772 4:87628685-87628707 TAAGAGGTGGAGCCTGTGGAAGG + Intergenic
977702383 4:100035382-100035404 TATGAGAGGGACCCAGTGGGAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979826215 4:125236156-125236178 TCAGAGAAGGGGCCAGTGGAGGG - Intergenic
980125850 4:128773037-128773059 TAACAGTGTGAGGCAGTGTATGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983517718 4:168675092-168675114 TCACAGGGGGAGGCAGTGGTGGG - Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983863451 4:172735714-172735736 TGTGAGAGGGACCCAGTGGAAGG + Intronic
984157020 4:176206147-176206169 CAAGAGAGGGAGCCACTGAATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984830162 4:183965710-183965732 TGACAGAGGAAACCAGTGGCGGG + Intronic
985184434 4:187300835-187300857 TAGGAGAGGGAGCCATAGGATGG + Intergenic
985507954 5:295308-295330 TCCCAGAGGGAGAGAGTGGAGGG + Intronic
985740081 5:1610360-1610382 TCCCAGAGGGAGAGAGTGGAGGG - Intergenic
986730806 5:10633490-10633512 CAACAGAGGGAACCAGTGTGAGG - Intronic
986819202 5:11446771-11446793 TTACAGAAGGAGCAAGTGGCAGG + Intronic
987024265 5:13908361-13908383 AAGGAGAGGGAGGCAGTGGAAGG - Intronic
987162907 5:15163311-15163333 TGAAGGAGGGAACCAGTGGAAGG - Intergenic
987814875 5:22887118-22887140 TAACAGATGGAGCCAGCTCAAGG + Intergenic
988800861 5:34695422-34695444 TAACAGAGGACGCCAGAGAAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990146014 5:52761086-52761108 CAAGAGAGGGACCCAGTGGGAGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992475364 5:77096743-77096765 TGACAGAGGCAGCGATTGGAGGG - Intergenic
992929911 5:81632705-81632727 TAAGAGAAGGAGACAGTAGAGGG - Intronic
993161627 5:84298830-84298852 TAAGAGAGGAACCCTGTGGATGG - Intronic
993861819 5:93145483-93145505 TAACTGAGGGAGTGATTGGATGG - Intergenic
993901440 5:93586098-93586120 GAAGAGAGGGAACCAGTGAACGG - Intronic
994733643 5:103524676-103524698 TAACACAGGGAACCAGTAGCTGG + Intergenic
995921947 5:117325149-117325171 TATGAGAGGGACCCAGTGGGAGG - Intergenic
997256160 5:132429734-132429756 TGACAGAGGGAAACAGAGGAAGG - Intronic
999937325 5:156501373-156501395 TGACAAAGGGAGTCAGGGGAAGG + Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000226668 5:159267669-159267691 TATGAGAGGGACCCAGGGGAAGG + Intronic
1000267454 5:159651438-159651460 TAAGGGAGGGAGACAGGGGATGG - Intergenic
1001483054 5:172101802-172101824 TCACAGAGGGATCCGGAGGAAGG + Intronic
1001646099 5:173283443-173283465 TAAGAGAGGGAGAGAGGGGAAGG + Intergenic
1004154965 6:13159268-13159290 TAAGAGAAGAAGGCAGTGGAGGG + Intronic
1004683724 6:17921605-17921627 TCACTGAGGGAGTCAGTGAAGGG - Intronic
1006078067 6:31547072-31547094 TAACAACGGGAGGCAGGGGAGGG - Intronic
1006266955 6:32933570-32933592 TAACAGAAGAAGTCAGTGGAAGG - Intergenic
1006479634 6:34281347-34281369 TATCAGAGAGAGGAAGTGGAAGG - Exonic
1006507918 6:34502357-34502379 AAACAGAGGGAAACAGGGGAAGG + Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007849803 6:44792207-44792229 TGGCAGAGTGGGCCAGTGGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008914104 6:56768074-56768096 TAAAATAGGAAGCCACTGGAGGG + Intronic
1009729194 6:67578142-67578164 TATGGGAGGGAGCCAGTGGGAGG + Intergenic
1010879765 6:81153203-81153225 TGTGAGAGGGACCCAGTGGAAGG - Intergenic
1012908153 6:105091220-105091242 TCTCTGAGGCAGCCAGTGGATGG - Intergenic
1013675993 6:112463793-112463815 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1013935160 6:115585748-115585770 CAACAGAGGGAACAAGAGGAAGG - Intergenic
1014603678 6:123446739-123446761 TAACATAGGAAGCCAGTGAGAGG + Intronic
1016285161 6:142464175-142464197 TGAGAGAGGGACCCAGTGGGAGG - Intergenic
1016566359 6:145459183-145459205 AAAGAGAGGGGGTCAGTGGATGG + Intergenic
1017346610 6:153390692-153390714 TATCAGAGGGACCCAGTGAGAGG + Intergenic
1017396213 6:154002583-154002605 GACCACTGGGAGCCAGTGGAAGG + Intergenic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019719664 7:2560362-2560384 AAACAGAGGAAGCCTTTGGAAGG + Intronic
1020672219 7:11130592-11130614 TAACAGAGGAAACTAGGGGAAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021932695 7:25597498-25597520 TAAGGGAGGGAACCATTGGAAGG + Intergenic
1022060184 7:26785735-26785757 TATCAGATGGAGCCAGGGTAGGG - Intronic
1023158242 7:37273273-37273295 TAACAGAGGGACCTTGGGGAAGG + Intronic
1024135843 7:46407072-46407094 AAACAGAGGGAGCCTGGGCAGGG + Intergenic
1024274232 7:47664931-47664953 CAACAGAGGGAGCTCGTGGTGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026018668 7:66692310-66692332 TAAGAGAGGGAGGCAGGGAAAGG - Intronic
1026881734 7:73910388-73910410 TAAGAGAGGGAGGCAGGGAAAGG + Intergenic
1028679278 7:93506836-93506858 TATGAGAAGGAGCCAGTGAAAGG + Intronic
1029613819 7:101643924-101643946 CACCAGAAGGGGCCAGTGGAGGG + Intergenic
1030076708 7:105743161-105743183 TTACTGAGGGAGTCAGAGGAGGG + Intronic
1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG + Intergenic
1032144607 7:129367748-129367770 TAGCACAGGGAGCCAGCAGAGGG + Intronic
1032959817 7:137018678-137018700 TAACAGAGGGAGGAAAAGGAAGG - Exonic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034029271 7:147742144-147742166 TGTGAGAGGGACCCAGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035557018 8:574890-574912 TAAAAGAGGGACAGAGTGGAAGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1037185171 8:16054527-16054549 TAACATAGGGAGGCTGAGGAGGG - Intergenic
1037914821 8:22766632-22766654 GAGCTGTGGGAGCCAGTGGAGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039306913 8:36272940-36272962 TAACAGAAGCTGCCTGTGGATGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040637580 8:49293043-49293065 TGACAGAGGGACCCGGTGGGGGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042708106 8:71683827-71683849 AAAAAGAGGGACCCAGTGCAAGG + Intergenic
1043757585 8:84022431-84022453 TATGGGAGGGATCCAGTGGAAGG + Intergenic
1044351093 8:91167417-91167439 TGTCGGAGGGAGCCAGTGGAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047092164 8:121586452-121586474 TGTCAGAGACAGCCAGTGGATGG + Intergenic
1047167217 8:122452495-122452517 GAACAGAGCGAGAGAGTGGAAGG + Intergenic
1047447118 8:124929358-124929380 TGAGAGAGGGACCCAGTGGGAGG + Intergenic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1047919360 8:129618094-129618116 TGTCAGAGGGACCCAGGGGAAGG + Intergenic
1047925263 8:129676616-129676638 TAACATAGGAAGTCATTGGAAGG + Intergenic
1049217634 8:141415364-141415386 TAACAGCGGGAGCGAGCGGGAGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051485257 9:17601660-17601682 TAGCAGAGGAAGCCAGTGAGTGG + Intronic
1052721523 9:32176407-32176429 TGTGAGAGGGAGCCAGTGGGAGG - Intergenic
1052873579 9:33533242-33533264 TAACATGGGGAGGCAGAGGAGGG + Intronic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1053280208 9:36815706-36815728 TCACAGAGTGAGCCAGAGGCAGG - Intergenic
1055150007 9:72985446-72985468 AGACAGTGGGAGCCAGGGGAGGG + Intronic
1057444361 9:95103564-95103586 CAAGTGAGGGAGCAAGTGGACGG + Intronic
1057854452 9:98591826-98591848 TCACAGAGTGAGGCAGTGGCAGG - Intronic
1059716939 9:116921855-116921877 CAAGAGAGGGACCCAGTGGAAGG - Intronic
1060724316 9:125997104-125997126 TGCCAGAGGGACCCAGAGGAGGG - Intergenic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061326429 9:129867477-129867499 GAGCAGGGGGAGCCAGAGGAAGG + Intronic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1061615360 9:131775477-131775499 TAACAGAAGGAGGAAGTGGCAGG - Intergenic
1062430562 9:136525244-136525266 GAACAAGGGGAGCCAGGGGAGGG + Intronic
1185699931 X:2223173-2223195 CAAGGGAGGGAGCCAGTGGGAGG + Intronic
1186753223 X:12643092-12643114 AAAGAGAAGGAGCCATTGGAGGG + Intronic
1187214523 X:17263710-17263732 CAAGAGAGGGACCCAGTGGGAGG + Intergenic
1187265708 X:17731071-17731093 TACCAGAGAAAGCAAGTGGATGG - Intronic
1187714704 X:22091423-22091445 GAAAAGAGGGACCAAGTGGATGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188372224 X:29382736-29382758 ACACAGAGGCATCCAGTGGAAGG - Intronic
1188568603 X:31554995-31555017 TAGGAGAGGGAGCCATTTGATGG + Intronic
1189347259 X:40251564-40251586 TGACAGAGCGAGGCAGAGGACGG + Intergenic
1189508677 X:41638809-41638831 TAGGAGAGGAAGCCAGTGGAGGG + Intronic
1189577285 X:42367820-42367842 TTACAGAGGGAGCCACAGGCAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189926188 X:45958067-45958089 TAAGAGAGGGAGAGAGTTGAAGG + Intergenic
1190950475 X:55138609-55138631 TAAGGGAGGGACCCAGTGGGAGG + Intronic
1193269690 X:79515005-79515027 TAACAGAGGGGCCTAGGGGATGG - Intergenic
1194819210 X:98485481-98485503 TGACTGAGGGAGACAGTGGCAGG + Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1196978657 X:121187474-121187496 TAAGAGAGGAAGTCATTGGAGGG + Intergenic
1197016703 X:121633716-121633738 TACCGGAGGGACCCAGTGGGAGG - Intergenic
1197631256 X:128862095-128862117 GTACAGAGGGAGCCAGGGGCTGG + Intergenic
1199249697 X:145646400-145646422 TAACAGAGGAAGAGATTGGAGGG - Intergenic
1199672907 X:150161672-150161694 TCACAGAGGAGGCAAGTGGATGG - Intergenic