ID: 1006840000

View in Genome Browser
Species Human (GRCh38)
Location 6:37022522-37022544
Sequence GGTGGAGGCCTCGGAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 0, 3: 72, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006840000_1006840004 -10 Left 1006840000 6:37022522-37022544 CCTGTCCCTCCGAGGCCTCCACC 0: 1
1: 0
2: 0
3: 72
4: 445
Right 1006840004 6:37022535-37022557 GGCCTCCACCTGTGTCACCCAGG 0: 1
1: 0
2: 13
3: 40
4: 662
1006840000_1006840010 11 Left 1006840000 6:37022522-37022544 CCTGTCCCTCCGAGGCCTCCACC 0: 1
1: 0
2: 0
3: 72
4: 445
Right 1006840010 6:37022556-37022578 GGCCTCTATCTTTCCTACCTAGG 0: 1
1: 0
2: 3
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006840000 Original CRISPR GGTGGAGGCCTCGGAGGGAC AGG (reversed) Intronic
900012780 1:131263-131285 GTTGGAGGCCACTGAGTGACTGG - Intergenic
900042843 1:487250-487272 GTTGGAGGCCACTGAGTGACTGG - Intergenic
900092742 1:927511-927533 GGGACAGGCCTGGGAGGGACTGG - Intronic
900142577 1:1144872-1144894 GAGGGAGGCCTCGGAGGGGTGGG - Intergenic
900384122 1:2401547-2401569 GGTGCAGCCGTCAGAGGGACGGG + Intronic
900533730 1:3167216-3167238 GCTGAAGGCCTGGGAGGGACAGG - Intronic
901746399 1:11376671-11376693 GGTGGAGGCCTTGGAGGCTCTGG + Intergenic
901770966 1:11530187-11530209 GCTGGATGCCTGTGAGGGACTGG + Intronic
901772029 1:11535415-11535437 CCTGGAGGCCTCAGAGGAACAGG - Intronic
902535646 1:17118144-17118166 GGTGGGGGCCTGGGAGAGGCAGG + Intronic
903039426 1:20517302-20517324 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
903360339 1:22773043-22773065 GGTGGAGGCCACCTAGGGGCAGG - Intronic
903363094 1:22789372-22789394 GGGGGAGTCCTCAGAGGGAGTGG + Intronic
904001906 1:27343415-27343437 GTTGGAGGCCTCCGTGGGAGTGG + Intronic
904477985 1:30776853-30776875 GGTGGGGGCCTCGGATGGGAAGG + Intergenic
904709479 1:32417999-32418021 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
907725271 1:57014995-57015017 GGAGAAGGCCTCTGAGGTACAGG + Exonic
908544318 1:65148600-65148622 GGGTGAGGCCCTGGAGGGACTGG + Intronic
909210426 1:72816165-72816187 GGTGGAGTCCTTGGAAGAACAGG + Intergenic
909575830 1:77174829-77174851 AGTGGAGTCCTTGGAGGAACAGG - Intronic
911309450 1:96275481-96275503 TCTGGAGGCCTAGGAGGAACTGG + Intergenic
912461517 1:109835359-109835381 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
912541661 1:110420768-110420790 GGTGGGGGCTTGGGAGGGGCTGG + Intergenic
914753342 1:150549984-150550006 AGTGGAGGGCTCTGAGGGCCCGG + Intronic
915142331 1:153775338-153775360 GGTGGGGGCCTGGGTGGGAATGG + Exonic
915343991 1:155189941-155189963 GGTGGAGCCCGGGGCGGGACTGG + Intronic
915912757 1:159924693-159924715 GGTGGTGGCCGCGGGCGGACGGG - Intronic
916036070 1:160923606-160923628 GGTGGAGTCCTTTGAGGAACAGG + Intergenic
916954577 1:169819021-169819043 GGTAGAGCCCTTGGAGGAACAGG + Intronic
918326380 1:183415057-183415079 GGTGGAAGCCTGGGAGGCAGAGG - Intronic
918465110 1:184813104-184813126 GGTGGAGTCCTTGGAAGAACAGG - Intronic
920320948 1:205121955-205121977 GGTGGACGCCGCGAAGAGACTGG + Exonic
920394208 1:205631944-205631966 GGCGGCGGCCGCGGAGGGCCTGG - Exonic
921184104 1:212655541-212655563 GGTGGAGGAGACAGAGGGACAGG + Intergenic
921737262 1:218642723-218642745 GGTGGAGGCCTGGGAAGGGAGGG - Intergenic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
922099181 1:222468259-222468281 GTTGGAGGCCACTGAGTGACTGG - Intergenic
922261218 1:223947753-223947775 GTTGGAGGCCACTGAGTGACTGG - Intergenic
922735855 1:227977987-227978009 GTTGGAGGCCACTGAGTGACTGG + Intergenic
922759611 1:228119194-228119216 GGCGGAGTCCTCGGAGGAACAGG + Intergenic
923107956 1:230868673-230868695 GGAGGGGGCCACGGAGGGCCGGG - Intronic
923272778 1:232372727-232372749 GGTGGAGGCCGGGGCGGGACAGG + Intergenic
924342385 1:243049933-243049955 GTTGGAGGCCACTGAGTGACTGG - Intergenic
924483380 1:244456324-244456346 GGTGGAGCCCCTGGAGGAACAGG - Intronic
924808546 1:247381135-247381157 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1064594161 10:16926471-16926493 GGTGGAGGACAGGGAAGGACAGG + Intronic
1064667730 10:17674002-17674024 GGGAGAGTCCTTGGAGGGACTGG + Intronic
1066469867 10:35687953-35687975 GGTGGAGCCCTCCAAAGGACAGG + Intergenic
1066734091 10:38455622-38455644 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1067046917 10:42990199-42990221 GGAGGGGGCCTCTGAGGAACTGG + Intergenic
1067497984 10:46775929-46775951 GGTGGAGGCCACTGAGCCACAGG - Intergenic
1067557496 10:47282960-47282982 TGTGCAGGCCACGGTGGGACTGG + Intergenic
1067596663 10:47564485-47564507 GGTGGAGGCCACTGAGCCACAGG + Intergenic
1068348764 10:55817099-55817121 GGTGGAGTCCTTGGAGGAACAGG + Intergenic
1068496766 10:57792542-57792564 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
1069582101 10:69573181-69573203 TTTGGAGGCCTCCGAGGGACGGG - Intronic
1069757651 10:70782913-70782935 AGTGGAGTCCTCAGAGGGTCCGG - Intronic
1070562980 10:77581782-77581804 GGTGGTGGCCTTAGAAGGACAGG + Intronic
1070665118 10:78337247-78337269 GATGCTGGCCTCAGAGGGACGGG + Intergenic
1070770253 10:79078246-79078268 GAAGGAGGCCACAGAGGGACTGG + Intronic
1071357182 10:84810039-84810061 AGTGGAGCCCTTGGAGGAACAGG + Intergenic
1071392233 10:85187675-85187697 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1071708491 10:88025558-88025580 GTTGGAGGCCTTTGGGGGACAGG + Intergenic
1072530998 10:96319292-96319314 GGTGGAGTCTTCGGGGGGCCTGG - Exonic
1074703300 10:116110763-116110785 GGTGGTGGCCATGGTGGGACAGG + Intronic
1075708588 10:124518210-124518232 GGGGGAAGCCTGGGAGGGTCTGG - Intronic
1075746752 10:124733333-124733355 GGTGGAGGCCTCAGGCGCACTGG + Intronic
1076630176 10:131847589-131847611 GGCCGAGGCCAGGGAGGGACAGG + Intergenic
1076891728 10:133288075-133288097 GGCAGAGGCCTCGGAGGGGCTGG - Intronic
1076969116 11:123467-123489 GTTGGAGGCCACTGAGTGACTGG - Intergenic
1077014136 11:392559-392581 TGTGGGGGCCTCGGAGGGCGGGG - Intergenic
1077067064 11:646362-646384 AGTGGAGGCCCGGGAGGGGCGGG - Intronic
1077227120 11:1443270-1443292 GGCGGGGGCCTTGGAGGGCCTGG - Intronic
1077251777 11:1563968-1563990 GGTGGAGGCTACGGAGCCACAGG - Exonic
1077441685 11:2571896-2571918 AGTGGACGCCTGGGAGGGGCAGG + Intronic
1077486757 11:2842270-2842292 GGTGAAGGGCTCTGGGGGACAGG + Intronic
1077926858 11:6689782-6689804 GGTGGAGCCCTTGGAGGTACAGG - Intergenic
1078011950 11:7579145-7579167 GCTGGAGGGCTTGGAGGGATGGG + Intronic
1078091669 11:8268164-8268186 GCTGGCGGCCTCGTTGGGACCGG + Intronic
1078331716 11:10427836-10427858 GTTGGAGTCCTCTGAGGAACAGG - Intronic
1078751974 11:14174019-14174041 GGTGGAGCCCTTGGAGGAACAGG + Intronic
1079412658 11:20203574-20203596 GGTGGAGCCCTTGGAAGAACAGG - Intergenic
1080609583 11:33892344-33892366 GGAGAAGGCCTAGGAGGGAGAGG - Intergenic
1080810631 11:35701048-35701070 GGTGGAGTCCTTGGAAGAACAGG + Intronic
1080916928 11:36669183-36669205 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
1081808609 11:45903089-45903111 CGTGGAGTCCTCGGAGAGGCAGG - Exonic
1083278457 11:61610959-61610981 GGGGAGGGCCTCGGTGGGACTGG - Intergenic
1083385083 11:62302035-62302057 GGTGGAGCCCTTGAAGGAACAGG - Intergenic
1083459255 11:62799830-62799852 GGTTGAGGCCTCCTAGGGGCTGG - Intronic
1083751971 11:64765972-64765994 GGTGGAGGCGGCGGAGGGGGAGG + Intronic
1084464982 11:69317343-69317365 GATGGAGCCCTCTGAGGGACGGG + Intronic
1084640595 11:70423657-70423679 GGTGTGGGCCTGGGTGGGACAGG + Intronic
1085391176 11:76183078-76183100 GCTGGAGACCTGGGAGAGACAGG - Intergenic
1086058790 11:82679542-82679564 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1086143214 11:83521858-83521880 GGTGGGGACTTGGGAGGGACTGG - Intronic
1088007866 11:104963920-104963942 AGTGGAGCCCTTGGAGGAACAGG - Intronic
1088017220 11:105075362-105075384 GGTGGAGCCCTTGGAGGAACAGG - Intronic
1089617332 11:119702247-119702269 GGTGGAGGCCCTGGTGGGAAAGG - Intronic
1090291601 11:125550781-125550803 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1090758546 11:129815933-129815955 GGAGGAGGGCTCGAAGGGAGAGG + Intronic
1091917117 12:4277672-4277694 GGCTGAGGCCTGGGAGGGAAAGG + Intronic
1095597144 12:43972040-43972062 GGTGGAGCCCTTGGAGGAACAGG + Intronic
1096111509 12:49031773-49031795 GGTGGAGGTGTGGGATGGACAGG + Exonic
1096337640 12:50768497-50768519 GGTGGAGCCCTTGGAAGAACAGG - Intronic
1096559351 12:52424614-52424636 GGTGCAGGCCTGGGAGGTTCTGG - Exonic
1096693282 12:53333975-53333997 GCTGGTGGCTTGGGAGGGACTGG - Intronic
1096916450 12:55038656-55038678 GGCTGAGGCCTCAGAGGGAAGGG + Intergenic
1097029473 12:56080726-56080748 GGTGGGGGCCTTGGCGGGAAGGG + Intronic
1098005199 12:65989399-65989421 GGTGGAGTCCTTGGAGAGACAGG + Intergenic
1098294091 12:68986346-68986368 GGTGGAGTCCTTGGAGGAACAGG - Intergenic
1099104044 12:78478505-78478527 GTTGGAGTCCTCTTAGGGACAGG - Intergenic
1101188560 12:102307111-102307133 GGTGGAGCCCTAGGAAGAACAGG - Intergenic
1101716793 12:107319159-107319181 GGTGGAAGACTCCGAGGGGCTGG + Exonic
1101824623 12:108210406-108210428 GGTGGTGGCCTTGGAGTGATGGG - Intronic
1102120245 12:110434655-110434677 GGAGGAGGGGTGGGAGGGACAGG + Intergenic
1102394578 12:112575277-112575299 GCTGGAGGCGGCGGAGGGACGGG + Intronic
1103348164 12:120265114-120265136 GGGGGCGGCCCTGGAGGGACGGG + Intronic
1104759205 12:131287036-131287058 GGTGGAGGCCAGGGAGGGGCAGG - Intergenic
1104821406 12:131679460-131679482 GGTGGAGGCCAGGGAGGGGCAGG + Intergenic
1106220177 13:27740419-27740441 GGTGGTGGCCTCACAAGGACTGG - Intergenic
1106336755 13:28790595-28790617 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1107311595 13:39083869-39083891 GGTGGAGCCCTTGGAGGAAGAGG - Intergenic
1108592796 13:51925732-51925754 GGTGGAGGCCTGGGTGGGTAAGG - Intergenic
1108648160 13:52450612-52450634 GCTCGCGGCCTCGGAGGGCCGGG - Exonic
1109346002 13:61114899-61114921 GGTGGAGCCCCTGGAGGAACAGG - Intergenic
1110585783 13:77190556-77190578 GTTGGAGAGCTAGGAGGGACAGG - Intronic
1113984363 13:114301944-114301966 GGGGGAGGCCATGGAGAGACTGG + Exonic
1114063063 14:19037767-19037789 GGTGGAGTCCTCGGAGCGGCAGG + Intergenic
1114065810 14:19059270-19059292 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1114099195 14:19362228-19362250 GGTGGGGTCCTCGGAGCGGCAGG - Intergenic
1114473806 14:22980966-22980988 GCAGGAGGCCTCGTAGGGAAGGG - Intronic
1114617151 14:24074398-24074420 GTGGGAGGCCTAGGAGTGACAGG - Intronic
1114621830 14:24100780-24100802 GGTGAATGCTTTGGAGGGACAGG - Intronic
1116235372 14:42272816-42272838 GGTGGAGTCCTTGGAGAGACAGG + Intergenic
1116329658 14:43579195-43579217 GGTGGAGCCCTTGGAAGAACAGG - Intergenic
1117091320 14:52253645-52253667 AGAGGAGGCCTCAGAGGTACAGG - Intergenic
1117174744 14:53134563-53134585 GGTCGAGGCCTCGGTGGTTCTGG - Intronic
1117667069 14:58067436-58067458 GCTGGAGTCCTGGGAGAGACTGG + Intronic
1117817693 14:59614311-59614333 GGTGGAGCCCTTGGAGGAGCAGG - Intronic
1121249100 14:92486354-92486376 GTTGGAGGGCTCAGAGGGCCTGG + Intronic
1121667770 14:95686021-95686043 GGAGGAGGCTGCGGAGGGACTGG + Intergenic
1122117765 14:99536222-99536244 GGGCGAGGGCTCGGAGGGGCTGG - Intronic
1122127538 14:99587274-99587296 GGGGAAGGTCTTGGAGGGACAGG - Intronic
1122447620 14:101781314-101781336 GGTTGAGGCTTCGGAGGGTGGGG - Intronic
1122937587 14:104967191-104967213 TGGGGAGGCTGCGGAGGGACGGG - Intronic
1123068905 14:105631545-105631567 GATGGAGGCCTCGGCGGGGCTGG + Intergenic
1123073061 14:105651503-105651525 GATGGAGGCCTCGGTGGGGCTGG + Intergenic
1123092983 14:105750273-105750295 GATGGAGGCCTCGGTGGGGCTGG + Intergenic
1123098459 14:105777372-105777394 GATGGAGGTCTCGGTGGGGCTGG + Intergenic
1123107482 14:105849486-105849508 GATGGAGGCCTTGGCGGGGCTGG - Intergenic
1124040032 15:26093494-26093516 GGTGGAGTCCTTGGAGGAACAGG + Intergenic
1124690800 15:31820952-31820974 GCTGGGGGCCTCGGAGGGAATGG - Intronic
1124787713 15:32697660-32697682 GGTGGAGGGCCAGGAGGGAATGG + Intergenic
1125533766 15:40430658-40430680 GGTGGCGGCTTGGGAGGGAGAGG + Intronic
1125889375 15:43254186-43254208 GGGGAAGGCCTCAGAGGGAGTGG - Intronic
1126623869 15:50667262-50667284 GGTAGAGCCCTTGGAGGAACAGG - Intronic
1126786166 15:52179551-52179573 GGTGGGGCCCTCGGAGGGTCCGG - Intronic
1127287828 15:57546249-57546271 TGTGGAGGCCACAGAGGGCCGGG + Intronic
1128351350 15:66892421-66892443 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1128640643 15:69333768-69333790 GGTGGAGCCCTTGGAGGAGCAGG - Intronic
1129251174 15:74309783-74309805 GGTGGAGGACTTGGGGGGTCTGG - Intronic
1130837546 15:87665292-87665314 GGTGGAGCCCTTGGAAGAACAGG - Intergenic
1130999168 15:88924638-88924660 GGTGGAGGCTGTGGAGGAACAGG - Intergenic
1131007826 15:88992928-88992950 AGTGGAGGCCTCAGCGAGACAGG + Intergenic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1131456434 15:92585888-92585910 AGCAGAGGCCTCGGAGGGTCTGG + Intergenic
1131510778 15:93048436-93048458 GATGGAGGCTGCGGAGGGTCGGG + Intronic
1131540082 15:93268438-93268460 GGAGGATGGCTAGGAGGGACAGG + Intergenic
1131914560 15:97250906-97250928 GGTGGAGCCCTTGGAGGAAGAGG + Intergenic
1132891349 16:2206294-2206316 GGTGGAGGCCTGGGGGGCCCTGG + Intronic
1133072305 16:3254560-3254582 AGAGAAGGCCTCGGAGGGCCTGG - Exonic
1133234655 16:4382240-4382262 CGTGGTGGCCTCGGCGTGACTGG - Exonic
1133826336 16:9281554-9281576 AGTGGAGGCATGTGAGGGACAGG - Intergenic
1136276288 16:29181091-29181113 GGACGAGGCCACGGAGAGACTGG + Intergenic
1136609609 16:31358156-31358178 GGTGGAGGCCTCTGGGGCAGAGG + Intronic
1136777333 16:32878957-32878979 GGTGGAGGCCCCAGATGGGCTGG + Intergenic
1136893292 16:33982556-33982578 GGTGGAGGCCCCAGATGGGCTGG - Intergenic
1138503708 16:57465219-57465241 GGTGGAGGCCTGGCAGGGGGAGG + Intronic
1139611858 16:68064843-68064865 AGTGGAGGCCTATCAGGGACAGG - Intronic
1140626818 16:76804194-76804216 TGCGGAGGCCTCAGAAGGACAGG + Intergenic
1141838649 16:86559912-86559934 GGGGGAGGCCTCGGAGGAGGGGG + Intergenic
1142080669 16:88147150-88147172 GGACGAGGCCACGGAGAGACTGG + Intergenic
1142451559 16:90175655-90175677 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1203079746 16_KI270728v1_random:1141066-1141088 GGTGGAGGCCCCAGATGGTCTGG + Intergenic
1142864194 17:2780384-2780406 GGCGGTGGCCTGGGAGGGGCAGG - Intronic
1143007459 17:3846166-3846188 GGCGGAGGCCCCGGCGGGGCCGG - Exonic
1143237983 17:5419629-5419651 GATGGCGGCCGCCGAGGGACCGG - Exonic
1143387218 17:6538195-6538217 GTCTGAGGCCTCGGAGGGAGAGG - Intronic
1143627960 17:8121824-8121846 GCTGGAGGCCTCGGATCTACCGG + Exonic
1144613383 17:16745819-16745841 GGGGGAGGCCATGGAGAGACTGG - Intronic
1144626349 17:16846191-16846213 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1144726093 17:17503548-17503570 GAAGGAGGCCGCGGTGGGACAGG + Intergenic
1144827542 17:18114761-18114783 GGTAGAGGCCCAGGAGGGAGTGG - Intronic
1144880083 17:18426528-18426550 GGTGGCTGCCTGGGAGGGCCTGG + Intergenic
1145046904 17:19625850-19625872 GGTGGAGTCCTGAGAGGTACAGG + Intergenic
1145133047 17:20375895-20375917 GGGGGAGGCCATGGAGAGACTGG - Intergenic
1145152150 17:20517856-20517878 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1145274908 17:21423461-21423483 GGTGGAGGCCGGGGAGGAGCTGG - Intergenic
1146487517 17:33255581-33255603 GGAGGGGGGATCGGAGGGACGGG + Intronic
1146821233 17:35984907-35984929 GGTGGAGCACTAGGAGGGGCTGG - Intronic
1146906482 17:36621500-36621522 GGTGCAGGGCTGAGAGGGACTGG - Intergenic
1146970163 17:37066020-37066042 GGTGGGGGGTGCGGAGGGACAGG - Intergenic
1147580495 17:41624889-41624911 GGTGGCTGCCTGGGAGGGCCTGG - Intergenic
1147625386 17:41896693-41896715 GCTGGAGGCTTTGGAGGGAGAGG + Intronic
1148238260 17:45983499-45983521 TGGGGAGGCCTTGGAGGGAGGGG - Exonic
1151801683 17:76383069-76383091 GGTGGGGGGCTCGGAGGTGCAGG + Intronic
1151802263 17:76385303-76385325 GGGGGCGCCCTCGGAGGCACCGG + Intronic
1152248843 17:79200960-79200982 AGTGAAGGGCTGGGAGGGACAGG - Intronic
1152435453 17:80273588-80273610 GGTGGAGGCCCCAGGGGGTCTGG - Intronic
1152518006 17:80837351-80837373 GGGGGAGGCAAGGGAGGGACAGG + Intronic
1152577552 17:81149484-81149506 GTTGGAGGCCTGTGAGGGGCTGG - Intronic
1154193165 18:12246982-12247004 GGTGGAAGCCACGGAGCGCCTGG + Intergenic
1154451017 18:14474877-14474899 GGTGGAGTCCGCGGAGCGGCAGG - Intergenic
1156625633 18:38904331-38904353 GGAGGAGACCTCAGAGGGAAAGG + Intergenic
1157146354 18:45166834-45166856 GCTTGAGGCCTCGGGGGAACAGG - Intergenic
1158016306 18:52788721-52788743 GGCGGAGCCCTTGGAGGAACAGG + Intronic
1159962802 18:74568531-74568553 GTTGGAGACCTGGGAGGGAGGGG + Intronic
1160645922 19:193393-193415 GTTGGAGGCCACTGAGTGACTGG - Intergenic
1160860885 19:1236859-1236881 GGCGGCGGCCTCGGGGGGGCGGG + Intronic
1160975094 19:1789235-1789257 GATGGAGGCGGCGGTGGGACTGG - Intronic
1161032438 19:2064411-2064433 GCAGGAGGCCTCAGAAGGACGGG - Intergenic
1161514400 19:4688719-4688741 GGCGGAGGCCTCCGTGGGGCGGG + Intronic
1161620102 19:5293162-5293184 TGTGGAGGCCTCGCGGGGCCTGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161766569 19:6211889-6211911 GGTGGAGGCCGGGGCGGGCCAGG + Intergenic
1162785447 19:13031956-13031978 GGTGGAGGGATGGGACGGACAGG - Intronic
1162957609 19:14107807-14107829 GATGGAGGCCTCGGGGGCTCGGG + Intronic
1163442646 19:17329427-17329449 GCAGGAGGCCCCGGAGGGAGAGG + Intronic
1163463851 19:17455126-17455148 GGTGGAGAGCTGGGAGGGAGTGG - Intronic
1164470342 19:28524865-28524887 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
1164615420 19:29664550-29664572 GGAGGAGGCCAGGGAGGGCCAGG + Intergenic
1164822569 19:31261398-31261420 AGGGGTGGCCTTGGAGGGACAGG + Intergenic
1165114803 19:33522331-33522353 AGTGGAGGCCCCGCAGGGTCTGG - Intergenic
1165329691 19:35134667-35134689 GGTGGGGGCATGGGAGGGGCAGG - Exonic
1165419254 19:35714952-35714974 GCTGGAGGGCTCGAGGGGACAGG + Exonic
1166781481 19:45345685-45345707 GGCGGAGGCCCTGGCGGGACAGG + Exonic
1166855513 19:45781059-45781081 GGTGGAGGCCAAGAAGGGCCAGG - Intronic
1166874873 19:45891071-45891093 GGTGGAGGCCGAGGAGGGGGTGG + Exonic
1166900838 19:46061510-46061532 GGTGGAGCCTTTGGAGGAACAGG + Intronic
1168145700 19:54419139-54419161 GGTGGCGGCCTTGGCGGGCCTGG + Exonic
926503801 2:13685752-13685774 GGTGGAGCCTTTGGAGGAACAGG - Intergenic
926980153 2:18560158-18560180 GGTGTGGGCCTCGGGGGGCCGGG - Exonic
927213325 2:20651692-20651714 GGTGGAGGCCTCCCGGGGCCGGG + Intergenic
928518256 2:32063886-32063908 GGCGGAGGCCTGGGAGGCACCGG - Exonic
929981660 2:46687036-46687058 GGAGGAGTCCTCGGAGGAAGGGG + Intergenic
931516903 2:63055378-63055400 GGCGGAGGCCTCGGTGAGAAAGG + Intronic
931849967 2:66243314-66243336 GGTGGGAGCTTGGGAGGGACAGG - Intergenic
931850910 2:66249682-66249704 GGTGGGAGCTTGGGAGGGACAGG - Intergenic
932495760 2:72145002-72145024 CGTGGAGACCTCAGAGGGGCGGG + Intronic
932731013 2:74222013-74222035 GGAGGCTGCCTAGGAGGGACTGG - Intronic
932965906 2:76474265-76474287 GGTGGAGTCCTTGGAAGAACAGG - Intergenic
933614267 2:84468352-84468374 GGTGGAGCCCTTGGAAGAACAGG + Intergenic
934717279 2:96551335-96551357 GGTGGAGGCCTTGCAGTGCCAGG + Exonic
935590601 2:104843429-104843451 GGAGGAGGCCTCGGGGCGGCAGG + Intergenic
935885899 2:107618601-107618623 GGTGGAGCCCTTGGAGGAATAGG - Intergenic
935941320 2:108242385-108242407 GGTGGAGCCCTTGGAGGAGCAGG + Intergenic
936033915 2:109094415-109094437 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
936269222 2:111036178-111036200 GGTGGAGGCCTGGAGGGGAGGGG + Intronic
936600450 2:113890043-113890065 GGAGGAGGCCGCGGCGGGGCAGG + Exonic
937368857 2:121284540-121284562 GGCGGCGGGCTCGGAGGGGCAGG - Intronic
938480419 2:131657930-131657952 GGTGGAGTCCGCGGAGCGGCAGG + Intergenic
938700608 2:133875850-133875872 AGTGGAGCCCTTGGAGGAACAGG + Intergenic
939168967 2:138671620-138671642 GGTGCATGCCACGGAGGGGCTGG - Exonic
939693234 2:145292150-145292172 GGTGGGGGCGGCGGAGGGAGGGG - Intergenic
940182856 2:150954728-150954750 GGTGGAGGCCAAGGAGGAATTGG - Intergenic
940446571 2:153784823-153784845 GGTGGAGCTCCCAGAGGGACAGG + Intergenic
940551782 2:155167894-155167916 TGTGGAGGCATGAGAGGGACAGG - Intergenic
941012174 2:160313002-160313024 TGTGGAGGCTGCGGAGGCACAGG + Intronic
941639624 2:167972984-167973006 GGTGGAGTCCTTGGAAGAACAGG - Intronic
941877694 2:170451768-170451790 GGTGGAGCCCTTGGAGGAATAGG + Intronic
944457641 2:199911660-199911682 GGCGGCGGCCGGGGAGGGACTGG + Exonic
945704466 2:213212469-213212491 GGTGGAGCCCTTGGAAGAACAGG + Intergenic
946335527 2:219032827-219032849 CATGGAGGCCTGAGAGGGACAGG + Intronic
948095099 2:235327233-235327255 GGTGGAGGCCTGGGGAGGCCTGG - Intergenic
948809548 2:240467595-240467617 GGAGGAGGACTTGGAGGGTCTGG + Exonic
948946773 2:241224430-241224452 TGGGGAGGCCACCGAGGGACAGG - Exonic
948953904 2:241272647-241272669 CGTGGAGGCCGCGGAGGGGGAGG - Intronic
949082942 2:242119961-242119983 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1169141545 20:3229823-3229845 GGGGGAGGCCCTGGAGGGAGGGG + Intronic
1170375173 20:15692326-15692348 GGTGGATGCCTGGGAAAGACAGG - Intronic
1171255967 20:23689203-23689225 GGAGGAGGCCTGGGAGGGGCAGG - Intergenic
1171263315 20:23751100-23751122 GGAGGAGGCCTGGGAGGGGCAGG - Intronic
1171272372 20:23826894-23826916 GGAGGAGGCCTGGGAGGGGCAGG - Intergenic
1171347680 20:24478302-24478324 GGAGGAGCCCTAGGAGGGAGGGG + Intronic
1171442086 20:25173261-25173283 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1172011085 20:31845834-31845856 GGTGGTGGCTGGGGAGGGACAGG + Intergenic
1172130228 20:32650373-32650395 GGTGGTGGCCTTGGTAGGACAGG + Intergenic
1172504962 20:35455066-35455088 GGTGCAGGACTTGGAGGGGCGGG + Intergenic
1174172888 20:48628065-48628087 CTGGGAGGCCTCGGAGGGACAGG - Intronic
1175429280 20:58890998-58891020 GGAGGAGGCCTCGGGGGCGCCGG + Intronic
1175722162 20:61294025-61294047 GGTGAAGGCCCCGGCAGGACAGG + Intronic
1175926960 20:62475801-62475823 GGTGGGGGCCTGGGAAGGACGGG + Intronic
1175984636 20:62758515-62758537 GGAGAAGGCCATGGAGGGACAGG + Intronic
1176139908 20:63540414-63540436 GGTAGAAGCCTCGGAGGCTCTGG - Intergenic
1176445220 21:6815696-6815718 GGTGGAGTCCGCGGAGCGGCAGG + Intergenic
1176548576 21:8212183-8212205 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1176556470 21:8256391-8256413 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1176567507 21:8395218-8395240 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1176575409 21:8439433-8439455 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1176823387 21:13680729-13680751 GGTGGAGTCCGCGGAGCGGCAGG + Intergenic
1178544028 21:33478988-33479010 GGCGGAGGCCTCGGACGGGACGG - Intronic
1179313681 21:40221234-40221256 GGTGGTGGCATGGGTGGGACAGG - Intronic
1179315482 21:40240245-40240267 GGTGGAGGTCCCTGTGGGACAGG - Intronic
1179500333 21:41804715-41804737 GGGGGATGCCTGGGAGGGAAGGG - Intronic
1180054914 21:45352736-45352758 GGAGGAGGCCGAGGAGGGGCTGG - Intergenic
1180481556 22:15760396-15760418 GGTGGAGTCCTCGGAGCGGCAGG + Intergenic
1180484291 22:15781862-15781884 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1180972573 22:19823024-19823046 GCAGGAGGCCTGGGAGGGGCCGG + Intronic
1181609610 22:24003839-24003861 GGTGGTGACCTGGGAGGGGCAGG + Intergenic
1182007770 22:26975436-26975458 GGTGGAGGCCTGGGAAGAACTGG + Intergenic
1184091407 22:42294870-42294892 GGTGGAGGGCCCTGGGGGACAGG + Intronic
1184102981 22:42351319-42351341 GATGGTGGCTTCGGAGGGGCAGG - Intergenic
1184763380 22:46558217-46558239 GCTGGGGGCCAGGGAGGGACAGG - Intergenic
1184837723 22:47033845-47033867 GGTGAAGGCCGAGGAGGGAGTGG + Intronic
1184877062 22:47282710-47282732 GCTGGGGGTCTCGGAGGGAGGGG - Intergenic
1203253460 22_KI270733v1_random:128488-128510 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1203261514 22_KI270733v1_random:173566-173588 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
949998495 3:9638101-9638123 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
950028253 3:9835105-9835127 GCTGGGGGCCTCGGAGGCACAGG - Exonic
950088523 3:10278483-10278505 AGTGGAGGCACCGGAGGGAGAGG + Intronic
950182833 3:10927220-10927242 GGCAGAGGTCTCGGAGGGATTGG + Intronic
950440143 3:13005735-13005757 TCTGGAGGCTTCGTAGGGACGGG + Intronic
950510924 3:13426070-13426092 AGAGGATGCCTCGGAGGGCCTGG - Intergenic
950605706 3:14078167-14078189 GGTGGAGTCCTTGGAAGAACAGG + Intronic
953607378 3:44420649-44420671 GGAGGAAGCCTCGGGGGTACAGG - Intergenic
954136899 3:48586047-48586069 GGAAGAGGCCTCTGGGGGACTGG - Intronic
954662454 3:52233288-52233310 GGCCGAGGCCTCAGAGGGCCTGG - Intronic
955340928 3:58124419-58124441 GGTGGAGGCCCCTGAGGGGTTGG - Exonic
955454373 3:59103359-59103381 GATGGAGCCCTTGGAGGAACAGG - Intergenic
955911381 3:63863301-63863323 TGTGGAGGTCTGGGAGGGAGTGG - Intronic
955996922 3:64687669-64687691 GGTGGGGGCAGCGGAGGGAGGGG - Exonic
958968416 3:100585086-100585108 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
959296216 3:104537625-104537647 GGTGGAGGGTTGGGAGGGAGAGG + Intergenic
959342196 3:105145803-105145825 GGTGGAGGTCTGGAAGGGAAGGG - Intergenic
959872849 3:111348880-111348902 AGTGGAGTCCTTGGAGGAACAGG + Intronic
961337997 3:126196174-126196196 GGTAGAGTCCTTGGAAGGACAGG + Intronic
961724098 3:128914639-128914661 GGAAGAGGACTTGGAGGGACTGG + Intronic
964961713 3:162436180-162436202 GGTGGAGCCCTTGGAGAAACAGG + Intergenic
965496454 3:169404618-169404640 GGAGGAGGCTTCAGAGGAACTGG - Intronic
965585752 3:170316828-170316850 GGCGGAGCCCTTGGAGGAACAGG + Intergenic
966991546 3:185236367-185236389 GGTGCAGGCCTGGGAGGGTGGGG - Intronic
967136326 3:186515814-186515836 GGTGGAGGCCTTGGAAAGGCTGG - Intergenic
968371759 3:198226133-198226155 GTTGGAGGCCACTGAGTGACTGG + Intergenic
968489886 4:884316-884338 GGTGGAGGCATGGGTGAGACAGG + Intronic
968603345 4:1520652-1520674 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603364 4:1520693-1520715 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603403 4:1520775-1520797 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603462 4:1520898-1520920 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603481 4:1520939-1520961 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603519 4:1521021-1521043 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603538 4:1521062-1521084 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603557 4:1521103-1521125 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603576 4:1521144-1521166 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
968603595 4:1521185-1521207 CGGGGCGGCCTCGGAGGGGCTGG - Intergenic
969248935 4:5954566-5954588 CGTGGAGGCCTAGGTGGGAATGG - Intronic
971006258 4:22376985-22377007 GGTGGAGCCCTTGGAGCAACAGG - Intronic
971279338 4:25229517-25229539 GGTGGAGCCCTTGGAGGAACAGG - Intronic
974087997 4:57281585-57281607 GGTGGAGGGATGGGAGGGATGGG + Intergenic
974922732 4:68261863-68261885 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
975612144 4:76213735-76213757 GGATGGGGCCGCGGAGGGACGGG + Exonic
977499959 4:97825614-97825636 AGTGGAGCCCTTGGAGGAACAGG - Intronic
977527222 4:98159899-98159921 GGTAGAGCCCTTGGAGGAACAGG - Intergenic
977589931 4:98814757-98814779 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
978600081 4:110418739-110418761 GGTGGAGGCCGCTGTGGGGCAGG + Intronic
979260445 4:118638611-118638633 GTTGGAGGCCACTGAGTGACTGG + Intergenic
980321709 4:131288541-131288563 GATGGAGCCCTTGGAGGAACAGG + Intergenic
980990492 4:139735062-139735084 GGCGGGGGCCGCGGAGGGGCGGG - Intronic
981201086 4:141980165-141980187 GGTGGAGTCCTTGGAAGAACAGG - Intergenic
984650569 4:182265609-182265631 GGTGGAGCCGTTGGAGGAACAGG - Intronic
985339260 4:188931061-188931083 GATGGAGCCCTTGGAGGAACAGG - Intergenic
985475509 5:76744-76766 AGAGGAGGCCTAGGAGGGACAGG + Intergenic
985846816 5:2355966-2355988 GGTGGTGGGCTGGGAGGGAGAGG - Intergenic
988568891 5:32344472-32344494 GGTAGAGCCCTTGGAGGGAAAGG - Intergenic
989146130 5:38251855-38251877 GGTGGAGTGCTTGGTGGGACAGG - Intergenic
989336985 5:40329813-40329835 GGTGGAGCCCTTGGAAGAACAGG + Intergenic
990070737 5:51780208-51780230 GGTGGATCCCTTGGAGGAACAGG + Intergenic
990290600 5:54346808-54346830 GGTGGAGTCCTTGGAAGAACAGG - Intergenic
990308955 5:54519356-54519378 GGCTGAGGCCGCGGAAGGACTGG - Exonic
993868835 5:93225837-93225859 GGTGGAAGCTTCAGAGAGACTGG + Intergenic
995433333 5:112106921-112106943 AGTTGTGGCCTAGGAGGGACAGG + Intergenic
995581819 5:113609972-113609994 GGTAGAGCCCTTGGAGGAACAGG - Intergenic
996057791 5:118999815-118999837 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
996476463 5:123928211-123928233 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
997432310 5:133848969-133848991 CATGAAGGCCTCGGAGGGTCTGG - Intergenic
999266145 5:150268200-150268222 GTTGGAAGCCAAGGAGGGACAGG - Intronic
1001401987 5:171451241-171451263 CGTGGAGGCCTGGGCGGGAGCGG - Intronic
1002643250 5:180640517-180640539 GGTGGAGGCCACTGGGGCACAGG - Intronic
1002731000 5:181331679-181331701 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1002805216 6:567204-567226 GTGGGAGGGCTGGGAGGGACAGG - Intronic
1002898588 6:1393004-1393026 GGTGGAGGCTTCGGAGGAGCCGG + Intronic
1003129926 6:3386729-3386751 GGTGGAGGCGGCAGTGGGACTGG + Intronic
1005181428 6:23111876-23111898 GGTGGAGACCTTGAAGGAACAGG + Intergenic
1005822006 6:29606310-29606332 GGTAGAGGGCTTGGAGGGAGAGG - Intronic
1006275412 6:33001386-33001408 TGGGGAGGCCTCCCAGGGACGGG + Intergenic
1006293946 6:33161550-33161572 GGGAGAGGCGTCTGAGGGACCGG + Intergenic
1006320187 6:33315484-33315506 GGTGGGGTCCCTGGAGGGACTGG - Exonic
1006819475 6:36880314-36880336 GGTGGAGTCCTTGGAGGAACAGG - Intronic
1006840000 6:37022522-37022544 GGTGGAGGCCTCGGAGGGACAGG - Intronic
1006840032 6:37022648-37022670 GGTGGAGGCCGAGGTGGGACAGG - Intronic
1006840051 6:37022711-37022733 GGTAGAGGCCTAAGTGGGACAGG - Intronic
1007089548 6:39173596-39173618 GGTGGAGGGCTGAGAGGGACTGG + Intergenic
1007547467 6:42705127-42705149 GGTGGAGTCCTCCGAGGGCAAGG - Intronic
1008315149 6:50030530-50030552 GCGGGAGCCCTGGGAGGGACTGG - Intergenic
1008452912 6:51673691-51673713 GGTGTCAGCCTCGGAGGGGCAGG + Intronic
1009657465 6:66565866-66565888 GGTGGAGCCTTTGGAGGAACAGG + Intergenic
1009716848 6:67408623-67408645 GGTGGAGACTTTGGAGGAACAGG - Intergenic
1012201126 6:96407028-96407050 GGTGGAGCCCTTGGAGGAGCAGG - Intergenic
1013480636 6:110549881-110549903 GGTGGAGGCATGGGAGGAGCTGG - Intergenic
1014738564 6:125122876-125122898 GGTGGAGTCCTTGGAGGAACAGG - Intronic
1016854474 6:148652715-148652737 GGTGGAGTCCTTGGATGAACAGG - Intergenic
1016997119 6:149968503-149968525 AGTGAAGGCCTCTGAGGGGCTGG - Intronic
1019116857 6:169772062-169772084 GGTGGTGGCACAGGAGGGACAGG - Intronic
1019290543 7:248100-248122 GGGAGAGGCCCCTGAGGGACTGG - Intronic
1019324672 7:432267-432289 GGTGGGGGTGTCCGAGGGACAGG + Intergenic
1019539326 7:1544700-1544722 GGCGGAGGCGTCTGAGGGTCAGG + Exonic
1019739338 7:2664996-2665018 GGGCGGGGCCTCGGAGTGACTGG + Intergenic
1020096174 7:5370810-5370832 GGTGGAGGCCAAGGAGGAGCCGG - Exonic
1023402160 7:39798211-39798233 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1023800465 7:43829412-43829434 GCTGGAGCCCTTGGAGGAACAGG - Intergenic
1024076143 7:45818841-45818863 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1024472121 7:49775263-49775285 GGTGGGGGCCGCGGCGGGCCGGG + Intronic
1024647460 7:51382449-51382471 GTTGGAGGCCACTGAGTGACTGG - Intergenic
1025012037 7:55405283-55405305 TGTTCAGGCCTTGGAGGGACTGG + Intronic
1025051294 7:55736944-55736966 GTTGGAGGCCACTGAGTGACTGG - Intergenic
1025128258 7:56362611-56362633 GTTGGAGGCCACTGAGTGACTGG - Intergenic
1025176640 7:56805492-56805514 GTTGGAGGCCACTGAGTGACTGG - Intergenic
1025695152 7:63770894-63770916 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1025741125 7:64196636-64196658 GGTGGATGCCTCAGAGAAACAGG - Intronic
1025768877 7:64484702-64484724 GGTGGAGCCCTTGGAAGAACAGG - Intergenic
1026772248 7:73209923-73209945 GCTGATGGCCTGGGAGGGACGGG - Intergenic
1026852874 7:73735833-73735855 GCTGGAGGCCTGGGAGGTAGGGG + Intergenic
1027013117 7:74763316-74763338 GCTGATGGCCTGGGAGGGACGGG - Intergenic
1027074924 7:75182718-75182740 GCTGATGGCCTGGGAGGGACGGG + Intergenic
1027212807 7:76164527-76164549 GGAGGGGGCCGCGGGGGGACGGG + Intergenic
1028149822 7:87358708-87358730 GGTGGAGGAAGAGGAGGGACTGG + Intronic
1029524204 7:101085357-101085379 GGTGGGGGCCTTGGCGGGAGAGG + Intergenic
1029811050 7:103049605-103049627 GGTGGAGTCCTCGCAAGAACAGG + Intronic
1032052676 7:128658604-128658626 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1033052562 7:138019481-138019503 GGTGGAGCCCTTTGAGGAACAGG - Intronic
1033158013 7:138972672-138972694 GGAGAAGGAATCGGAGGGACTGG - Intronic
1033452653 7:141475485-141475507 GGTAGATGCCTCAGAGTGACTGG - Exonic
1033660725 7:143399939-143399961 GGTAGAGGCCACGGCGGGTCAGG + Exonic
1034263815 7:149772282-149772304 GGCGGGGGCCTCGGAGGGGAAGG - Intronic
1035107681 7:156455867-156455889 TGTGGAGGCCACGGAGGCACAGG - Intergenic
1035161086 7:156950216-156950238 GGTGGCGGCTGCGGAGGGTCTGG - Exonic
1035376619 7:158410929-158410951 GTGGGAGGCCCCGGAGGGACAGG + Intronic
1035453175 7:158992361-158992383 GCTGGGGGCCCCGCAGGGACTGG - Intergenic
1035483527 7:159204923-159204945 GGCAGAGGCCTCAGAAGGACTGG - Intergenic
1036129383 8:6094540-6094562 GCTGGAGGCCTCAGAGGCAGAGG - Intergenic
1036177672 8:6554740-6554762 AGAGGAGCCCTCGGAGGGAGCGG + Intronic
1039912092 8:41833931-41833953 GGAAGAGGCTGCGGAGGGACGGG + Intronic
1040526465 8:48229479-48229501 GGTGGAGCCCTTGGAGAAACAGG - Intergenic
1042845942 8:73169591-73169613 GGTGGAAGCCTGGGAAGGATGGG + Intergenic
1043012989 8:74903317-74903339 GGTGGAGTCCTTTGAGGAACAGG - Intergenic
1044075864 8:87821133-87821155 GGAGGAGGCTCCGGAGGCACAGG - Intergenic
1044439509 8:92207416-92207438 GGTGGAGCCCTTAGAGGAACAGG + Intergenic
1045305220 8:100951943-100951965 GGTGGTGGCGGCGGACGGACGGG + Exonic
1045492502 8:102680875-102680897 GGTGAAGGCCCCGGAGGAATGGG - Intergenic
1047286652 8:123493065-123493087 GGTGGAGGAGTGGGAGGGGCTGG - Intergenic
1048380376 8:133860225-133860247 GGTCTTGGCCTCGAAGGGACTGG + Intergenic
1049312513 8:141940818-141940840 GGTCCAGGCCTAGGTGGGACAGG - Intergenic
1049328178 8:142034882-142034904 GGTAGAGGCCTCAGGAGGACAGG + Intergenic
1049717539 8:144099990-144100012 TGTGGAGGCTTCCGGGGGACTGG + Exonic
1050172056 9:2830473-2830495 GGTGGAGACTGGGGAGGGACAGG - Intronic
1050537724 9:6645209-6645231 AGGGGAGGCCGCGGAGGGCCGGG + Intronic
1050657912 9:7849083-7849105 GGTGGAGTCCTTGGAAGAACAGG - Intronic
1052857373 9:33415660-33415682 GGTGGAGCCCTTGAGGGGACTGG - Intergenic
1052896275 9:33750762-33750784 GGAGGAGGGCTCGAAGGGAGAGG + Intronic
1053082599 9:35190003-35190025 GATGGAGCCCTTGGAGGAACAGG + Intronic
1053223166 9:36328138-36328160 TGTGGAGGCCTGGCAGGGACAGG - Intergenic
1055970835 9:81911271-81911293 GGTGGAGTCCTTGGAAGAACAGG + Intergenic
1056727003 9:89127946-89127968 GGTGGAGCCCTCAGAGGAACAGG - Intronic
1057228518 9:93304931-93304953 CGTGGAGGCCTCCGTGGGCCAGG + Intronic
1057666932 9:97053287-97053309 GGTGGAGGCCTTGGAGGCTGAGG + Intergenic
1058355644 9:104081131-104081153 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1059698966 9:116756974-116756996 GGTGGAGGATTTGGAGAGACAGG - Intronic
1060106731 9:120877257-120877279 GGGGGAGGCGGCGGAGGGAGGGG + Exonic
1060306718 9:122420443-122420465 GGTGGAGTCCTTGGAGGAACAGG + Intergenic
1060681588 9:125569686-125569708 GGTGGAGTCCTTGGAAGAACAGG - Intronic
1060934276 9:127506528-127506550 GATGGAGGCCACAGAAGGACAGG + Exonic
1061014767 9:127975251-127975273 GATGGTGGCCCCGGAGGCACAGG - Intronic
1061296064 9:129677464-129677486 GGGGGAGGCCCAGGAGGGATGGG + Intronic
1061888486 9:133605447-133605469 GGTGGAGGCTGGGCAGGGACTGG - Intergenic
1061986337 9:134132286-134132308 GGTGGAGGAAGCCGAGGGACGGG - Intergenic
1062327248 9:136018193-136018215 GGTGGGGGTCATGGAGGGACTGG - Intronic
1062382354 9:136292520-136292542 GGAGGAGGACTCTGAGGGTCAGG - Intronic
1062434901 9:136542660-136542682 GGTGGGGGCCGGGGAGGGAGGGG + Intronic
1062460199 9:136659778-136659800 GGTGGAGGCCCGGCAGGGGCAGG - Intronic
1062461167 9:136663116-136663138 AGGGGTGGCCTCGGAGGGGCAGG + Intronic
1062755405 9:138284186-138284208 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1203783661 EBV:115326-115348 GGCGGAGGCCGAGCAGGGACTGG - Intergenic
1203523975 Un_GL000213v1:68829-68851 GGTGGAGTCCGCGGAGCGGCAGG - Intergenic
1203469860 Un_GL000220v1:111635-111657 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1203477681 Un_GL000220v1:155607-155629 GGTGGAGGCGCGGGAGGGGCCGG - Intergenic
1203579319 Un_KI270745v1:28358-28380 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1187904586 X:24054371-24054393 GGTGAAGGGCTCAGAGGGGCAGG - Intergenic
1188686930 X:33081093-33081115 GGTGGAGCCTTTGGAGGAACAGG + Intronic
1189821396 X:44873016-44873038 GGTGGCGGCCTCGGTGGGCGGGG + Intergenic
1190108021 X:47573014-47573036 GGTGGAGGCGTGGGAGGAAGGGG + Intronic
1190385545 X:49879671-49879693 GGTGGAGACGGCGGAGGGTCCGG + Intergenic
1190477968 X:50847127-50847149 GGTGGAGCCCTTGGAGAAACAGG + Intergenic
1190815713 X:53927290-53927312 GGCGGAGCCCTTGGAGGAACAGG - Intergenic
1191184188 X:57592402-57592424 GGAGGAGGCCGAGGAGGGCCCGG + Exonic
1191613162 X:63138068-63138090 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
1191623135 X:63240858-63240880 GGTGGAGCCCTTGGAGGAACAGG + Intergenic
1192765442 X:74134885-74134907 GGTGGAGCCCTTGGATGAACAGG - Intergenic
1192888667 X:75364311-75364333 GGTGGAGCCCTTGGAGGAACAGG - Intergenic
1193791160 X:85816360-85816382 GGTGTAGCCCTTGGAGGAACAGG - Intergenic
1193888801 X:87017384-87017406 GCAGGAGCCCTGGGAGGGACTGG - Intergenic
1194757291 X:97752065-97752087 AGTGGAGGTCTCTGAGGCACTGG + Intergenic
1195877108 X:109552876-109552898 GATGGAGCCCTTGGAGGAACAGG - Intergenic
1199793406 X:151175415-151175437 GGGGGAGGCCTGAGAGGGATGGG + Intergenic
1200102529 X:153695091-153695113 GGTGGAGGCCCCAGATGGGCTGG - Exonic
1200320932 X:155188918-155188940 GGTGGAGACTTCAAAGGGACAGG + Intergenic
1202381925 Y:24280980-24281002 GTTGGAGGCCACTGAGTGACTGG + Intergenic
1202488859 Y:25389145-25389167 GTTGGAGGCCACTGAGTGACTGG - Intergenic