ID: 1006841252

View in Genome Browser
Species Human (GRCh38)
Location 6:37029214-37029236
Sequence GAGCTTTGACCTTAGTTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006841252_1006841257 21 Left 1006841252 6:37029214-37029236 CCGGTGAACTAAGGTCAAAGCTC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1006841257 6:37029258-37029280 ATAAGACAAGCAGAGAGGGGAGG 0: 1
1: 0
2: 2
3: 50
4: 458
1006841252_1006841258 30 Left 1006841252 6:37029214-37029236 CCGGTGAACTAAGGTCAAAGCTC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1006841258 6:37029267-37029289 GCAGAGAGGGGAGGAGAGTGAGG 0: 1
1: 1
2: 27
3: 241
4: 1978
1006841252_1006841255 17 Left 1006841252 6:37029214-37029236 CCGGTGAACTAAGGTCAAAGCTC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1006841255 6:37029254-37029276 AACAATAAGACAAGCAGAGAGGG 0: 1
1: 0
2: 0
3: 27
4: 523
1006841252_1006841256 18 Left 1006841252 6:37029214-37029236 CCGGTGAACTAAGGTCAAAGCTC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1006841256 6:37029255-37029277 ACAATAAGACAAGCAGAGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 421
1006841252_1006841254 16 Left 1006841252 6:37029214-37029236 CCGGTGAACTAAGGTCAAAGCTC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1006841254 6:37029253-37029275 GAACAATAAGACAAGCAGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006841252 Original CRISPR GAGCTTTGACCTTAGTTCAC CGG (reversed) Intergenic
901263903 1:7894534-7894556 GTGATTTGTCCTTAGTGCACTGG - Intergenic
907494263 1:54832574-54832596 GTGCTTTGACCATATTACACAGG - Intronic
911432182 1:97804806-97804828 GAGCATTGAACTGAGTTGACAGG + Intronic
914952847 1:152132299-152132321 GGTCTTTGACCTGAGTCCACAGG - Intergenic
915956011 1:160220579-160220601 GAGCTCTGGCCTTAGATGACTGG + Intronic
916142293 1:161710570-161710592 TAGTTTTGACCTTGATTCACTGG - Intronic
916265099 1:162882586-162882608 GAGCTTTGGTCTTTGTGCACTGG - Intergenic
917029008 1:170669261-170669283 GCGCTCTGACCTGAGTGCACCGG - Intronic
918226081 1:182484550-182484572 AAGCTTTGGCTTCAGTTCACAGG + Intronic
924548151 1:245049676-245049698 GAGCTTTGACCGTAGATCCAGGG - Intronic
1065812525 10:29455411-29455433 AAACTTTGACCTTTGTACACTGG - Intergenic
1073072627 10:100804236-100804258 AAGCTTTGTCCTCAGGTCACTGG - Intronic
1073263363 10:102207470-102207492 GAGCTGTGACCTTTGGTCAAGGG - Intergenic
1074355574 10:112780580-112780602 GAGCTCTGACTCTAGTTCCCGGG - Intronic
1078644584 11:13128773-13128795 GAGCTTGGGCATTAGTTCATGGG - Intergenic
1078965726 11:16339247-16339269 GAGATTTGATCTAAGTTCAATGG - Intronic
1080720254 11:34841484-34841506 GATCTTTGCCCTTAGTACACTGG - Intergenic
1087222668 11:95563277-95563299 GAGTTTTCACCTTAGTTCTCTGG + Intergenic
1088505807 11:110525773-110525795 GAACTTTGTCCTAATTTCACTGG - Intergenic
1089616763 11:119699266-119699288 GAGCTTTGACCTGAGCTGAGGGG + Intronic
1091897565 12:4117504-4117526 GGTCTTTGGCCTTAGCTCACTGG + Intergenic
1092487115 12:8912390-8912412 GACCTATGACCTTAGAACACTGG + Intergenic
1092658189 12:10709934-10709956 GACCTTTGACCGTCGCTCACGGG - Exonic
1096362540 12:51000633-51000655 CTGCCTTGACCTTCGTTCACAGG - Intronic
1098990109 12:77056713-77056735 GATATGTGACCTTACTTCACAGG + Intronic
1100662354 12:96713882-96713904 GAACTTTCACCTTTGTTCACTGG - Intronic
1102418407 12:112784460-112784482 GAGATACGACCATAGTTCACGGG - Intronic
1107293668 13:38887242-38887264 GAGCCTTAAACTTAGTTCTCTGG + Intergenic
1129556331 15:76513901-76513923 GAGCTTTGATTTTAGTTGAGGGG - Intronic
1130764841 15:86859386-86859408 GAGTTTTCACCTTAGCTCAGTGG - Intronic
1132926225 16:2430315-2430337 GACCTTAGCCCTTATTTCACAGG - Intronic
1133611968 16:7442011-7442033 GAGCTTTTCCCCTAGTTCATGGG + Intronic
1135676506 16:24419366-24419388 GGGCTTTGAGCTTAGGTGACTGG - Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1144843350 17:18202470-18202492 GAGCTTAGACCTTAGCTCTAGGG + Intronic
1148242916 17:46012081-46012103 GAGCTTTGATCCTGGTTCTCTGG + Intronic
1149782636 17:59410093-59410115 TAGCTTTTACCTTATTCCACTGG + Intergenic
1149933405 17:60779393-60779415 GAGCTTTGCCCTTATTGCCCAGG + Intronic
1150674066 17:67229183-67229205 GAGCTTTGACATTATTTTATAGG - Intronic
1158045601 18:53151389-53151411 GAGTTTTGACCTTAGAGAACAGG - Intronic
1163868242 19:19793751-19793773 GTGCTTACACCTTATTTCACAGG - Intronic
1163878168 19:19893572-19893594 GTGCTTATACCTTATTTCACAGG + Exonic
1164501268 19:28822274-28822296 GAGCTTTGACCTTTGTTGGAGGG - Intergenic
1167523147 19:49968992-49969014 GAACTTGGACCTTACATCACAGG - Intergenic
925260888 2:2527523-2527545 TACCTTTGAGCTTCGTTCACTGG + Intergenic
927332742 2:21885200-21885222 GAGCTTTAACCATAGTCCAGGGG + Intergenic
928527392 2:32155761-32155783 GATATTTGCCCTTAGTTTACTGG + Exonic
932127922 2:69161260-69161282 GAGCTTTACCATTAGTCCACAGG - Intronic
933413679 2:81956947-81956969 GATCTTTGTTCTTAGTTCAGAGG - Intergenic
939474241 2:142665703-142665725 GATATTCGGCCTTAGTTCACTGG - Intergenic
940415965 2:153420602-153420624 CAGCTTTGACATTAGCTGACAGG - Intergenic
941465554 2:165821950-165821972 GAGGTGTAATCTTAGTTCACTGG - Intergenic
943455132 2:188097259-188097281 GGGTTTTGACTTTAGTACACAGG + Intergenic
946202612 2:218079682-218079704 GAGCTTTGTCCTTAGCTCCCTGG - Intronic
947034489 2:225836529-225836551 GAACTTTTACCTGAGGTCACTGG - Intergenic
948033745 2:234840970-234840992 GAGCTTTGAGGTTCGTTCAAGGG + Intergenic
1169345801 20:4827302-4827324 GACCTTTGACCTTAGAGCAGAGG + Intergenic
1169807965 20:9578958-9578980 AAGCTGTCACCTTAGTTCCCAGG - Intronic
1170942751 20:20862832-20862854 GAGCTTTCATCTGTGTTCACTGG + Intergenic
1171950011 20:31413164-31413186 CACCTTTGTCCTTAGTCCACAGG - Intergenic
1174244559 20:49167675-49167697 CAGCTATGACCTTATTTCATTGG + Intronic
1175109051 20:56633331-56633353 CAGCTCTGACCTTCATTCACAGG + Exonic
1182411286 22:30189132-30189154 GAGATTTGACCTTAGTTTTCGGG - Intergenic
1183364843 22:37401465-37401487 TGGCTTGGCCCTTAGTTCACTGG - Intronic
1184105434 22:42364963-42364985 GGGCTTTGACCTCAGGTCTCCGG + Intergenic
950439387 3:12999939-12999961 GAGCTTGGACTTTATTACACAGG - Intronic
952480022 3:33751805-33751827 GAGTTTTGCCCTTACTTCCCAGG + Intergenic
953344515 3:42164130-42164152 CACCTTTGTCCTGAGTTCACAGG + Intronic
956580923 3:70812343-70812365 CAGCTTTGACCTTTGGGCACTGG - Intergenic
957617009 3:82542791-82542813 TAGCATTGACCTTACTTCAATGG - Intergenic
959035565 3:101359194-101359216 GTGCTTACACCTTATTTCACAGG + Intronic
962434413 3:135351420-135351442 GACCTGAGACCTTAGTTCACTGG - Intergenic
963939305 3:151084606-151084628 GAGCATTTACCTAACTTCACTGG - Intergenic
965910853 3:173773363-173773385 GAGCATTGGACTAAGTTCACAGG + Intronic
976354765 4:84104316-84104338 GAGCTTTCACCTTGTTGCACAGG - Intergenic
978724904 4:111958214-111958236 GGACTTTGCCCTTAGCTCACTGG + Intergenic
980143201 4:128947135-128947157 GTACTTTGACCTTAGAACACTGG + Intronic
981449773 4:144883270-144883292 CAGCATTGACCTTCTTTCACTGG - Intergenic
995354483 5:111223220-111223242 GCGCTTTCACCTTACTTCACAGG - Intergenic
996086669 5:119311813-119311835 GAGCTTTGTCCCTCCTTCACGGG - Intronic
996414710 5:123197852-123197874 GAGCTTTGCCCTGAGGTCAGTGG - Intergenic
999855078 5:155585743-155585765 GAGCTTTGACCAAGGTTCCCTGG - Intergenic
1002324731 5:178396943-178396965 GATCTTTGACGTTTGTTCACTGG - Intronic
1003044009 6:2715988-2716010 GAGCTTTGACCAGAGTGCAAAGG - Intronic
1003775555 6:9358378-9358400 GATCTTTGACTTTGGTTCAATGG - Intergenic
1003912025 6:10751767-10751789 GAGCTTTCAACTGACTTCACTGG + Intronic
1004225120 6:13777988-13778010 GATATTTGACCTTACTACACAGG + Intergenic
1004225200 6:13778580-13778602 GATATTTGACCTTACTACACTGG - Intergenic
1006841252 6:37029214-37029236 GAGCTTTGACCTTAGTTCACCGG - Intergenic
1007976478 6:46106524-46106546 GAGCTTTGCCCTGAGGTCAGTGG + Intergenic
1011280761 6:85675132-85675154 GAGGATTGATGTTAGTTCACAGG + Intergenic
1016524512 6:144986491-144986513 GAGCTTTCAGCTGAGTTAACTGG + Intergenic
1017274676 6:152552645-152552667 GTGATTTGACCTTATTTCTCAGG - Intronic
1018931873 6:168245324-168245346 GAGCTTTGGCCTTAGTACACAGG + Intergenic
1024091555 7:45946732-45946754 GGTCTTTGTCCTTAGTTCATGGG + Intergenic
1025230516 7:57201009-57201031 GTCCCTTGACCTCAGTTCACAGG + Intergenic
1030670220 7:112327070-112327092 CAGCTATGACCTAAGATCACAGG - Intronic
1031004093 7:116452542-116452564 TAGCTTTGGCCTTAGTCAACGGG + Intronic
1031517555 7:122719434-122719456 GAGCTGCCACCTTAGTGCACTGG + Intronic
1041748804 8:61237152-61237174 GTGGTTTGACTTTAGTTCACTGG - Intronic
1046461750 8:114547607-114547629 GCTCTATGACCTTAGTTCTCAGG - Intergenic
1048940515 8:139396551-139396573 GAGCTTTGACTTTATGGCACAGG - Intergenic
1050270586 9:3940426-3940448 CAGTTTTGACCTTAGATCTCAGG - Intronic
1050807216 9:9695461-9695483 CATATGTGACCTTAGTTCACTGG + Intronic
1051181942 9:14420385-14420407 GTGGTGTGATCTTAGTTCACCGG - Intergenic
1051819249 9:21145469-21145491 AAGGTTTGACCTTAAATCACTGG - Intergenic
1052560046 9:30073980-30074002 GAGTTTTGACTTTTGTCCACAGG + Intergenic
1053252792 9:36588850-36588872 TACCTTTCACCTAAGTTCACTGG + Intronic
1055263892 9:74473611-74473633 GAGTTTTGAGCTTAGATCATTGG - Intergenic
1056905828 9:90646786-90646808 GGGCTGTGACCTTAGTTTCCAGG - Intergenic
1186642353 X:11469643-11469665 GACCTTGGACCTTAGTTCCTGGG - Intronic
1192215565 X:69155954-69155976 GAGCCTTGGGCTTAGTTCCCTGG + Intergenic
1194270133 X:91802761-91802783 GAACTGTGACCTTTGTTTACTGG - Intronic
1197259880 X:124306463-124306485 GAGCTTTGACATGTGTTCCCTGG + Intronic
1200587373 Y:5024200-5024222 GAACTGTGACCTTTGTTTACTGG - Intronic