ID: 1006844168

View in Genome Browser
Species Human (GRCh38)
Location 6:37051113-37051135
Sequence GGACCCTGTCCCCACAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006844168_1006844175 12 Left 1006844168 6:37051113-37051135 CCACCACTGTGGGGACAGGGTCC No data
Right 1006844175 6:37051148-37051170 CTTGCACAAGACCTGTGCCAGGG No data
1006844168_1006844174 11 Left 1006844168 6:37051113-37051135 CCACCACTGTGGGGACAGGGTCC No data
Right 1006844174 6:37051147-37051169 CCTTGCACAAGACCTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006844168 Original CRISPR GGACCCTGTCCCCACAGTGG TGG (reversed) Intergenic
No off target data available for this crispr