ID: 1006844910

View in Genome Browser
Species Human (GRCh38)
Location 6:37055503-37055525
Sequence TGGCAAGGTGAGGTGTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006844910_1006844918 9 Left 1006844910 6:37055503-37055525 CCACCTGACACCTCACCTTGCCA No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006844910 Original CRISPR TGGCAAGGTGAGGTGTCAGG TGG (reversed) Intergenic
No off target data available for this crispr