ID: 1006844918

View in Genome Browser
Species Human (GRCh38)
Location 6:37055535-37055557
Sequence ATCCTTTCTCTGAGCCCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006844909_1006844918 19 Left 1006844909 6:37055493-37055515 CCATGAGGCTCCACCTGACACCT No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data
1006844914_1006844918 -6 Left 1006844914 6:37055518-37055540 CCTTGCCAGGCCAACCAATCCTT No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data
1006844908_1006844918 20 Left 1006844908 6:37055492-37055514 CCCATGAGGCTCCACCTGACACC No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data
1006844910_1006844918 9 Left 1006844910 6:37055503-37055525 CCACCTGACACCTCACCTTGCCA No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data
1006844912_1006844918 6 Left 1006844912 6:37055506-37055528 CCTGACACCTCACCTTGCCAGGC No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data
1006844913_1006844918 -1 Left 1006844913 6:37055513-37055535 CCTCACCTTGCCAGGCCAACCAA No data
Right 1006844918 6:37055535-37055557 ATCCTTTCTCTGAGCCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006844918 Original CRISPR ATCCTTTCTCTGAGCCCCCG AGG Intergenic
No off target data available for this crispr