ID: 1006844935

View in Genome Browser
Species Human (GRCh38)
Location 6:37055679-37055701
Sequence AGGGGTGCACAGTTTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006844935_1006844950 16 Left 1006844935 6:37055679-37055701 CCCTCCCCAAACTGTGCACCCCT No data
Right 1006844950 6:37055718-37055740 CCCACCATCTTTGCGTCCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006844935 Original CRISPR AGGGGTGCACAGTTTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr