ID: 1006845193

View in Genome Browser
Species Human (GRCh38)
Location 6:37056695-37056717
Sequence TTCCCACACAGGCAGCCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006845193_1006845196 -9 Left 1006845193 6:37056695-37056717 CCTGTCGGCTGCCTGTGTGGGAA No data
Right 1006845196 6:37056709-37056731 GTGTGGGAAGCCGCTTGGCGTGG No data
1006845193_1006845204 24 Left 1006845193 6:37056695-37056717 CCTGTCGGCTGCCTGTGTGGGAA No data
Right 1006845204 6:37056742-37056764 CTCATTAGTGGTGATTCACCTGG No data
1006845193_1006845198 12 Left 1006845193 6:37056695-37056717 CCTGTCGGCTGCCTGTGTGGGAA No data
Right 1006845198 6:37056730-37056752 GGCCCTCCCCATCTCATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006845193 Original CRISPR TTCCCACACAGGCAGCCGAC AGG (reversed) Intergenic
No off target data available for this crispr