ID: 1006847982

View in Genome Browser
Species Human (GRCh38)
Location 6:37076475-37076497
Sequence CCTTAGGAGAAGCGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006847976_1006847982 -1 Left 1006847976 6:37076453-37076475 CCTTGGTTATGCAAGATGTCAAC No data
Right 1006847982 6:37076475-37076497 CCTTAGGAGAAGCGGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006847982 Original CRISPR CCTTAGGAGAAGCGGGTGAA GGG Intergenic
No off target data available for this crispr