ID: 1006850756

View in Genome Browser
Species Human (GRCh38)
Location 6:37096574-37096596
Sequence CTACTTTGGTAGTATAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006850756_1006850764 27 Left 1006850756 6:37096574-37096596 CCGGGCCTATACTACCAAAGTAG No data
Right 1006850764 6:37096624-37096646 TGTGTTCTTGACCAGGGCGTGGG No data
1006850756_1006850766 29 Left 1006850756 6:37096574-37096596 CCGGGCCTATACTACCAAAGTAG No data
Right 1006850766 6:37096626-37096648 TGTTCTTGACCAGGGCGTGGGGG No data
1006850756_1006850763 26 Left 1006850756 6:37096574-37096596 CCGGGCCTATACTACCAAAGTAG No data
Right 1006850763 6:37096623-37096645 CTGTGTTCTTGACCAGGGCGTGG No data
1006850756_1006850761 20 Left 1006850756 6:37096574-37096596 CCGGGCCTATACTACCAAAGTAG No data
Right 1006850761 6:37096617-37096639 TAAAATCTGTGTTCTTGACCAGG No data
1006850756_1006850762 21 Left 1006850756 6:37096574-37096596 CCGGGCCTATACTACCAAAGTAG No data
Right 1006850762 6:37096618-37096640 AAAATCTGTGTTCTTGACCAGGG No data
1006850756_1006850765 28 Left 1006850756 6:37096574-37096596 CCGGGCCTATACTACCAAAGTAG No data
Right 1006850765 6:37096625-37096647 GTGTTCTTGACCAGGGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006850756 Original CRISPR CTACTTTGGTAGTATAGGCC CGG (reversed) Intergenic
No off target data available for this crispr