ID: 1006857863

View in Genome Browser
Species Human (GRCh38)
Location 6:37148208-37148230
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006857853_1006857863 -4 Left 1006857853 6:37148189-37148211 CCCACTCCCCTTCTCAAATGGGG No data
Right 1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG No data
1006857855_1006857863 -5 Left 1006857855 6:37148190-37148212 CCACTCCCCTTCTCAAATGGGGG No data
Right 1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG No data
1006857857_1006857863 -10 Left 1006857857 6:37148195-37148217 CCCCTTCTCAAATGGGGGTAAAA No data
Right 1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006857863 Original CRISPR GGGGGTAAAATGTTGGAGGT GGG Intergenic
No off target data available for this crispr