ID: 1006860560

View in Genome Browser
Species Human (GRCh38)
Location 6:37169664-37169686
Sequence GAGAGCCGCAGAGCCGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006860553_1006860560 4 Left 1006860553 6:37169637-37169659 CCTTGACCCAAAACCCTCAGCGA No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data
1006860551_1006860560 15 Left 1006860551 6:37169626-37169648 CCGGCTCGAGCCCTTGACCCAAA No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data
1006860557_1006860560 -9 Left 1006860557 6:37169650-37169672 CCCTCAGCGAAACGGAGAGCCGC No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data
1006860558_1006860560 -10 Left 1006860558 6:37169651-37169673 CCTCAGCGAAACGGAGAGCCGCA No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data
1006860555_1006860560 -2 Left 1006860555 6:37169643-37169665 CCCAAAACCCTCAGCGAAACGGA No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data
1006860556_1006860560 -3 Left 1006860556 6:37169644-37169666 CCAAAACCCTCAGCGAAACGGAG No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data
1006860552_1006860560 5 Left 1006860552 6:37169636-37169658 CCCTTGACCCAAAACCCTCAGCG No data
Right 1006860560 6:37169664-37169686 GAGAGCCGCAGAGCCGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006860560 Original CRISPR GAGAGCCGCAGAGCCGGCCT CGG Intergenic
No off target data available for this crispr