ID: 1006860961

View in Genome Browser
Species Human (GRCh38)
Location 6:37171093-37171115
Sequence CGAGGGGGCCGCGTTAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006860961_1006860975 17 Left 1006860961 6:37171093-37171115 CCCGCCCTAACGCGGCCCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1006860975 6:37171133-37171155 CACTCGAGTGCCCATGGAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 81
1006860961_1006860968 -6 Left 1006860961 6:37171093-37171115 CCCGCCCTAACGCGGCCCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1006860968 6:37171110-37171132 CCCTCGCCCCTGCAGCCTAATGG 0: 1
1: 0
2: 0
3: 13
4: 156
1006860961_1006860974 11 Left 1006860961 6:37171093-37171115 CCCGCCCTAACGCGGCCCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1006860974 6:37171127-37171149 TAATGGCACTCGAGTGCCCATGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006860961 Original CRISPR CGAGGGGGCCGCGTTAGGGC GGG (reversed) Intronic