ID: 1006860961

View in Genome Browser
Species Human (GRCh38)
Location 6:37171093-37171115
Sequence CGAGGGGGCCGCGTTAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006860961_1006860975 17 Left 1006860961 6:37171093-37171115 CCCGCCCTAACGCGGCCCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1006860975 6:37171133-37171155 CACTCGAGTGCCCATGGAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 81
1006860961_1006860968 -6 Left 1006860961 6:37171093-37171115 CCCGCCCTAACGCGGCCCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1006860968 6:37171110-37171132 CCCTCGCCCCTGCAGCCTAATGG 0: 1
1: 0
2: 0
3: 13
4: 156
1006860961_1006860974 11 Left 1006860961 6:37171093-37171115 CCCGCCCTAACGCGGCCCCCTCG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1006860974 6:37171127-37171149 TAATGGCACTCGAGTGCCCATGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006860961 Original CRISPR CGAGGGGGCCGCGTTAGGGC GGG (reversed) Intronic
900310134 1:2029496-2029518 GGATGGGGCGGCGTGAGGGCAGG + Intronic
900605966 1:3523654-3523676 CGAGGAGGCCTGGTCAGGGCAGG - Intronic
901512674 1:9725220-9725242 CTAGGGGGCCGCGTGAGCGCTGG + Intronic
904068373 1:27773152-27773174 CGTGCGCGCCGCGTGAGGGCGGG + Intergenic
912514754 1:110210692-110210714 TGCGGGGGCCGCGCTGGGGCGGG - Intergenic
915572365 1:156751519-156751541 GGCGGGGGCCGCGCGAGGGCCGG - Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
921017631 1:211207155-211207177 CGCGGGGGCCGCGCTGGGCCGGG - Intergenic
1063186395 10:3655842-3655864 TGAGGGGGCCCCTTTAGGTCAGG + Intergenic
1069486507 10:68827354-68827376 CCAGGGGGCCGAGTTGGGCCCGG + Intergenic
1069788698 10:71005820-71005842 GGCTGGGGCCGAGTTAGGGCTGG + Intergenic
1076266954 10:129116212-129116234 CGAGGGGGCCAGGGAAGGGCTGG + Intergenic
1077610705 11:3641883-3641905 CCAGGGGTCCGGGTGAGGGCGGG + Exonic
1078210348 11:9265197-9265219 CGAGGGGACCGGGCCAGGGCCGG - Exonic
1084238851 11:67805446-67805468 CGTGGGGGCGGCTCTAGGGCGGG + Intergenic
1084553921 11:69864770-69864792 CGTGGAAGCAGCGTTAGGGCGGG + Intergenic
1084658941 11:70535961-70535983 TGAGGGGGCTGCGTGGGGGCTGG + Intronic
1085125853 11:74001943-74001965 GCAGGGGGCCATGTTAGGGCTGG - Intronic
1089188454 11:116636942-116636964 AGAGGGGGCTGCGTGAGGGAGGG + Intergenic
1091063932 11:132491167-132491189 CGAGGGGAACAAGTTAGGGCAGG - Intronic
1091394952 12:148498-148520 TGAGGGGGCCTGGGTAGGGCTGG - Intronic
1092894647 12:13000405-13000427 CGAGGGGGCGGAGAGAGGGCGGG + Intergenic
1099826640 12:87784414-87784436 CGAGGGGGCCGCGGCAGCGATGG - Intergenic
1107123444 13:36819538-36819560 CCCGGGGGCAGCGTTGGGGCGGG + Exonic
1119483734 14:74975239-74975261 GGAGGGGGCCGTGATGGGGCTGG + Intergenic
1122602651 14:102929281-102929303 CGCGGGGGCCGCGCGAGGGTCGG + Intronic
1124323605 15:28737750-28737772 CGAGGGGGCCCGGCTGGGGCTGG + Intronic
1124527489 15:30470946-30470968 CGAGGGGGCCCGGCTGGGGCTGG + Intergenic
1124771164 15:32536737-32536759 CGAGGGGGCCCGGCTGGGGCTGG - Intergenic
1128454527 15:67825237-67825259 GGTGGGGGCCGCGCTAGGTCCGG + Intronic
1129458135 15:75686607-75686629 GGAGGAGGCAGCGTTTGGGCCGG - Intronic
1129725651 15:77900275-77900297 GGAGGAGGCAGCGTTTGGGCCGG + Intergenic
1131199958 15:90388104-90388126 TGAGGGGGCGGAGTTAGGGGCGG + Intergenic
1132591460 16:728080-728102 GGCGGGGGCCGGGTTAGGTCGGG - Intronic
1140420247 16:74813363-74813385 GCAGGGGGCCGCGAGAGGGCAGG - Intergenic
1142248961 16:88982527-88982549 CCAGGGGGCGGCGGTGGGGCTGG - Intergenic
1142611103 17:1109525-1109547 CGAGGAGGCCGCGGCCGGGCCGG + Intronic
1145762502 17:27433826-27433848 GGAGGGGGCAGGGTTGGGGCAGG - Intergenic
1148853996 17:50568790-50568812 CGAGGAGGAGGTGTTAGGGCGGG + Intronic
1151413793 17:73948360-73948382 AGAGGGGGCAGTGTCAGGGCAGG - Intergenic
1152567618 17:81107194-81107216 CAAGGGGGCAGCGTCTGGGCTGG + Intronic
1153514357 18:5890889-5890911 CAAGGGGGCCGCGATAGGGGCGG - Exonic
1158836104 18:61333535-61333557 CGCGGTGGCCGCGGGAGGGCAGG + Intergenic
1162740217 19:12769854-12769876 GGCGGGGGCGGGGTTAGGGCCGG - Intronic
1163390291 19:17026673-17026695 GGAGGGGGCCGGGCCAGGGCTGG + Exonic
1163741217 19:19014218-19014240 CGAGTGGGCCGCATGAGGTCAGG - Intronic
1166829882 19:45632826-45632848 CGAAGGGGCGGGGTTAGGGTGGG + Intronic
926718516 2:15942340-15942362 CGAGGAGGACGCGTTCGGCCTGG + Exonic
938727279 2:134120114-134120136 CGAGCGGGCCGCGGCAGGGACGG - Intronic
942965772 2:181891661-181891683 CGCGCGGGGCGCGGTAGGGCGGG - Intergenic
944675632 2:202033134-202033156 GGAGGGGGCCGAGTGACGGCGGG - Intergenic
948963208 2:241356234-241356256 CGCGGGGGCGGGGTCAGGGCGGG + Exonic
1172481301 20:35273442-35273464 AGAGGGGGCCGTGTTAGAGATGG + Intronic
1176152487 20:63599162-63599184 GGAGCGGGCCGCGTTAGCGCTGG - Intronic
1179054184 21:37916231-37916253 GGAGGGGCGCGCGTTTGGGCAGG + Exonic
1180108568 21:45636915-45636937 CGAGGGGGCAGCGTGAATGCAGG - Intergenic
1180159196 21:45991475-45991497 CGAGTGGGCAGCGGGAGGGCGGG + Intronic
1181006673 22:20016800-20016822 CGCACGGGCCGCGTGAGGGCGGG - Exonic
1183394513 22:37563504-37563526 CGAGGGGGAGGAGTTAGGGTTGG + Intronic
953387750 3:42516262-42516284 CTATGGGGCCTCATTAGGGCAGG + Intronic
961300054 3:125916469-125916491 CGTGGGGGCGGCTCTAGGGCGGG - Intergenic
962807942 3:138939962-138939984 CGAGGGAGGCGCGTGAGGACTGG + Intergenic
968693460 4:2008594-2008616 CGAGGAGGGGGCGTGAGGGCGGG + Intronic
969114076 4:4860396-4860418 GGAGGGGGCCGGGTGGGGGCCGG + Intronic
976573773 4:86644365-86644387 CGAGCGGGTCGCTTGAGGGCAGG - Intronic
985620569 5:952710-952732 CGCTGGGGCCTCTTTAGGGCAGG + Intergenic
986284267 5:6348251-6348273 CGACAGGGCCGTGCTAGGGCTGG + Intergenic
1006860961 6:37171093-37171115 CGAGGGGGCCGCGTTAGGGCGGG - Intronic
1013792680 6:113855119-113855141 CGAGGGGGCGGGGTGCGGGCGGG - Intergenic
1015843694 6:137497064-137497086 CGAGGGGGCTGCGATGGGCCGGG + Intergenic
1017115586 6:150973473-150973495 CGAGGAGGCTGGGTCAGGGCGGG + Intronic
1020203786 7:6100240-6100262 CTAGGGGGACTAGTTAGGGCTGG - Intergenic
1020560558 7:9726188-9726210 GGAGGGGGCCGGGCCAGGGCTGG - Intergenic
1029501837 7:100935939-100935961 CGAGGGGGACGGGTTTGGGATGG - Intergenic
1034393034 7:150800787-150800809 CGAGCGGGCGGCGGGAGGGCTGG - Exonic
1034425868 7:151013698-151013720 CGGGGCGGCGGGGTTAGGGCGGG - Intronic
1049501868 8:142971405-142971427 GGAGGGGGCCCAGTTCGGGCCGG + Intergenic
1049742716 8:144248781-144248803 TCAGGGGCTCGCGTTAGGGCGGG - Intronic
1060201196 9:121652500-121652522 CCCGGGGGCTGCGTTTGGGCGGG + Intronic
1061378535 9:130240511-130240533 GGAGGGGGCCACTGTAGGGCAGG - Intergenic
1061895267 9:133643726-133643748 CGAGGGGGCCACCTCAGGCCTGG - Intronic
1062589528 9:137267145-137267167 CCAGGGGGCTGCCTCAGGGCTGG + Intronic
1198531107 X:137550091-137550113 CGCCGGCGCCTCGTTAGGGCCGG + Intergenic
1200987897 Y:9323829-9323851 CGAGGGGCACGTGGTAGGGCGGG - Intergenic