ID: 1006873991

View in Genome Browser
Species Human (GRCh38)
Location 6:37279554-37279576
Sequence TTTATGACCTTGTAGTTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006873991 Original CRISPR TTTATGACCTTGTAGTTGGC AGG (reversed) Exonic
906681713 1:47731057-47731079 TTTATTACCTTGTAATTAGTAGG + Intergenic
909273615 1:73656063-73656085 GTTATGACCTTGTAGTTATCTGG + Intergenic
909569822 1:77096575-77096597 GTTTTGCCCTTATAGTTGGCTGG - Intronic
910198976 1:84678212-84678234 TTTATGAACTTCTAGAGGGCAGG + Intronic
910380508 1:86621967-86621989 TTTATGACCTTGCAGTGGCATGG - Intergenic
913097024 1:115528286-115528308 TTTATGACCTTGCAGTGGCATGG + Intergenic
915207715 1:154283219-154283241 TTAATAACAATGTAGTTGGCTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916330631 1:163612311-163612333 TTGATGACCTTATGGTGGGCTGG + Intergenic
916553894 1:165876116-165876138 TTTAGGACATTGTAGTAGGTGGG + Intronic
916604207 1:166325187-166325209 TCTATAACTCTGTAGTTGGCTGG - Intergenic
918797489 1:188920915-188920937 TTTATAACCTTTTAGTGGGTTGG + Intergenic
918954085 1:191182598-191182620 TGTGTGCCCTTGTAGTTTGCTGG - Intergenic
921111005 1:212036447-212036469 TTTATGACCGTGTAGTAAACGGG - Intronic
921614234 1:217247996-217248018 TTCATGTTCTTGTAGTTGGAAGG - Intergenic
922649657 1:227326800-227326822 TTAATGTCCTTTTAGTTGGAAGG + Intergenic
1063843070 10:10093207-10093229 TCTCTGACCTTGTATTGGGCGGG + Intergenic
1065278238 10:24107956-24107978 TCTGTGACATTGTAGGTGGCAGG + Intronic
1065631887 10:27688962-27688984 TTCATGATCTAGAAGTTGGCTGG + Intronic
1068986346 10:63110933-63110955 CTTCAGAACTTGTAGTTGGCAGG + Intergenic
1075476598 10:122740705-122740727 TTTATGATCTTGTAGTTCTAGGG + Intergenic
1076332145 10:129677968-129677990 TTTATGACCTCATGGCTGGCTGG - Intronic
1082620861 11:55420155-55420177 TTTATGACCTTGTAGCGGCATGG + Intergenic
1085699221 11:78731369-78731391 TGTATGTCCTTCTTGTTGGCTGG + Intronic
1086442781 11:86845901-86845923 TTTATGACCTTGCAGTAGCATGG - Intronic
1088209349 11:107436713-107436735 TTTATTACCATGTAGTTAGTAGG - Intronic
1095454783 12:42371412-42371434 TTTAAGACCTAGGAGTTGGCCGG - Intronic
1099815708 12:87644702-87644724 CTTATGAATTTGGAGTTGGCCGG - Intergenic
1107758623 13:43652233-43652255 TTTATGTCCTTGGAGATGGCTGG - Intronic
1108248760 13:48544032-48544054 TTAATGACCTTTTAAATGGCTGG + Intergenic
1110095294 13:71511240-71511262 TTTATAACCTTGTTATTGACTGG + Intronic
1110408025 13:75172491-75172513 TTTCTTACCTTGAACTTGGCTGG + Intergenic
1111017209 13:82397064-82397086 TTTATGACCTTGCAGTGGCATGG - Intergenic
1113007099 13:105718690-105718712 TTTATGCCCATTTATTTGGCAGG - Intergenic
1116142473 14:41016276-41016298 TTTATGACCTTGCAGTGGCATGG + Intergenic
1120322721 14:82985682-82985704 TTTATGGCCTTGGAGTTGCTGGG - Intergenic
1123187549 14:106534901-106534923 TTTATGACCTTGCAGTGGCGTGG + Intergenic
1124431542 15:29612903-29612925 TTTGTTACCTTATAGTTGGAGGG - Intergenic
1129045412 15:72729670-72729692 TGTAATACCTTGTAGTTGGTAGG - Exonic
1133648853 16:7790551-7790573 TTTCTGAGCATGTAGTTGGTGGG + Intergenic
1139614754 16:68082251-68082273 TTTCTGAGATTGTAGTTGGCTGG + Intergenic
1141035435 16:80621818-80621840 TCTATGACCTTGTCTTAGGCAGG + Intronic
1141349220 16:83277227-83277249 GTTATGACCTTGCATTTGGATGG + Intronic
1141382471 16:83588675-83588697 TTTACCACTTTGTAGATGGCAGG + Intronic
1142048323 16:87940547-87940569 TTTATGACCTTGCAGCTGCACGG - Intergenic
1143241498 17:5446762-5446784 TTTAGGACCCTGTAGTGGCCAGG - Intronic
1145779975 17:27556591-27556613 TTTCTAAACTTGTACTTGGCTGG + Intronic
1150650299 17:67005759-67005781 TTTCGGACCTTGTAGTTCCCTGG + Intronic
1153811708 18:8757875-8757897 TTTAGAACCTTGGATTTGGCTGG + Intronic
1155205689 18:23556189-23556211 TAGATGACCTTGTGGTTTGCTGG - Intronic
1158211238 18:55052836-55052858 TTTATGACATTTTAGGTAGCAGG + Intergenic
1159033642 18:63256511-63256533 TTTATTACCATAAAGTTGGCCGG - Intronic
930198005 2:48528724-48528746 TTTTTGACCTTGGAGTTCGCTGG - Intergenic
940203630 2:151178171-151178193 TTTATGACTTTACAGTTGGACGG - Intergenic
944152362 2:196573555-196573577 TATATGACCTGGCAGTTAGCTGG + Intronic
946058987 2:216925649-216925671 TTCATGACCTTGAATTTGACAGG - Intergenic
946318975 2:218937658-218937680 TTAATTACATTGTGGTTGGCAGG + Intergenic
947028330 2:225763940-225763962 TCCCTGACCTTGTAGGTGGCAGG + Intergenic
947708413 2:232294592-232294614 TGTCTGACCTTGGAGATGGCTGG - Intronic
1169561861 20:6810083-6810105 TTCATGACATTGGATTTGGCAGG - Intergenic
1170007943 20:11689071-11689093 ATTAAGACCTGGTATTTGGCAGG + Intergenic
949169617 3:982991-983013 TTCTTGACCTTGTAGATGGGTGG - Intergenic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
950457350 3:13100561-13100583 TCAGTGACCTTGTAGTTGCCTGG - Intergenic
951915091 3:27792167-27792189 TTGTTGACCTGGTAGCTGGCAGG - Intergenic
952524128 3:34192153-34192175 CTTATGACCTTGTTGTGGGGGGG + Intergenic
952900109 3:38106458-38106480 TTTAAGACCTTTTAGTGGCCAGG + Intronic
956594311 3:70949387-70949409 TCTCTGCCCTTGTAGTTGGAAGG + Intergenic
957445150 3:80307335-80307357 TTTATAACCTTGTAGTGGCATGG - Intergenic
957663565 3:83193534-83193556 TTTTTGACCTTGTAATTATCTGG + Intergenic
960434751 3:117612147-117612169 TTTATGACCGTGTAGTTCCATGG - Intergenic
960903072 3:122571431-122571453 ATTAATACTTTGTAGTTGGCAGG + Intronic
964222936 3:154367465-154367487 TTTATGACCTTGCAGTGGCATGG - Intronic
966602135 3:181786366-181786388 TTAATGACATTGTAGTGGTCTGG + Intergenic
967576899 3:191105104-191105126 TTTATGACCTTGCAGCAGCCTGG + Intergenic
969060192 4:4428000-4428022 ATAGTGACCTTGTAGTTGTCTGG - Intronic
970269486 4:14329201-14329223 TTTATGACCTTGCACCTAGCAGG + Intergenic
971118208 4:23673154-23673176 GTTATAACCTTGATGTTGGCAGG - Intergenic
972049822 4:34715508-34715530 TTTATGACCTTGCAGTGGCATGG - Intergenic
974993037 4:69116887-69116909 TTTATGACCTTGCAGCTGTATGG - Intronic
975081465 4:70285524-70285546 TTTATGACAGTGTGGTTTGCAGG - Intergenic
980571242 4:134622991-134623013 TTTATGACCTTGCAGTGGCATGG + Intergenic
984323803 4:178226562-178226584 TTTATGACCTTGTAGCGGCATGG + Intergenic
984673464 4:182518754-182518776 TTTATGATCTTACAGTTTGCAGG - Intronic
989802555 5:45561932-45561954 TTTAAGACTTTGCATTTGGCTGG + Intronic
994356420 5:98798603-98798625 TTTATTACATTGCAGTTGGCAGG - Intronic
994798857 5:104344075-104344097 TTTCTCACCTTGTAGATGTCAGG + Intergenic
996014616 5:118519319-118519341 TTTATGACATTCTACTTGGCTGG - Intergenic
996196613 5:120614639-120614661 TTGTTCAGCTTGTAGTTGGCAGG + Intronic
996603301 5:125291688-125291710 TTTCTGACATTGTTCTTGGCAGG - Intergenic
998122757 5:139592457-139592479 TTTCTGACCTGGTAGTTGTGGGG + Intronic
1001086824 5:168706686-168706708 TTTAAGACTTTGGAGGTGGCTGG + Intronic
1001797429 5:174514049-174514071 TTGATGTCATTGTATTTGGCAGG - Intergenic
1002279817 5:178123662-178123684 TTTATGGCCATGTAAGTGGCAGG + Exonic
1006873991 6:37279554-37279576 TTTATGACCTTGTAGTTGGCAGG - Exonic
1009394425 6:63181853-63181875 TCTATAACCTTGTAGTTTACTGG - Intergenic
1019806997 7:3135029-3135051 TTTATTACCTTGTGGTTCCCGGG - Intergenic
1023817200 7:43960176-43960198 TTAATCACCTTCTAGTTGTCAGG - Intergenic
1035626464 8:1074914-1074936 TTGGTCACCTTGCAGTTGGCAGG + Intergenic
1037893191 8:22634932-22634954 TTTCTGACCTTGAGATTGGCAGG - Intronic
1038280092 8:26156306-26156328 TTTCTGTCCTTCTACTTGGCTGG - Intergenic
1038531989 8:28325811-28325833 TTTATAACCTTGTTGCTGTCAGG - Intronic
1038921938 8:32094270-32094292 TCTTTGACCTTGCTGTTGGCAGG - Intronic
1039491685 8:37952604-37952626 TTTAAGACCATGAAGTTGGTGGG - Intergenic
1050250974 9:3744706-3744728 TTTGAGACCCTGTTGTTGGCAGG + Intergenic
1053384454 9:37675730-37675752 ATTATGAACTTGGAGGTGGCAGG + Intronic
1053429323 9:38031776-38031798 TTTATGACTTTGCATTTGGAAGG - Intronic
1059125567 9:111681413-111681435 TTTATGACCTTGAAGTTTTAAGG - Intergenic
1196779333 X:119368884-119368906 TTTATGACCTTGTAGTAAGGAGG - Intergenic